Nature Publishing Group, publisher of Nature, and other science journals and reference works NATURE.COM NATURE NEWS NATUREJOBS NATUREEVENTS ABOUT NPG
Help Nature.com site index  
Molecular Psychiatry
SEARCH     advanced search my account e-alerts subscribe register
Journal home
Advance online publication
Current issue
Archive
Press releases
For authors
For referees
Contact editorial office
About the journal
For librarians
Subscribe
Advertising
naturereprints
Contact NPG
Customer services
Site features
NPG Subject areas
Access material from all our publications in your subject area:
Biotechnology Biotechnology
Cancer Cancer
Chemistry Chemistry
Dentistry Dentistry
Development Development
Drug Discovery Drug Discovery
Earth Sciences Earth Sciences
Evolution & Ecology Evolution & Ecology
Genetics Genetics
Immunology Immunology
Materials Materials Science
Medical Research Medical Research
Microbiology Microbiology
Molecular Cell Biology Molecular Cell Biology
Neuroscience Neuroscience
Pharmacology Pharmacology
Physics Physics
Browse all publications
 
2002, Volume 7, Number 10, Pages 1115-1119
Table of contents    Previous  Article  Next   [PDF]
Original Research Article
Association study of the serotonin transporter promoter polymorphism and symptomatology and antidepressant response in major depressive disorders
Y W-Y Yu1, S-J Tsai2,3, T-J Chen4, C-H Lin4 and C-J Hong2,3

1Yu's Psychiatric Clinic, Kaohsiung, Taiwan, ROC

2Division of Psychiatry, School of Medicine, National Yang-Ming University, Taipei, Taiwan, ROC

3Department of Psychiatry, Veterans General Hospital-Taipei, Taipei, Taiwan, ROC

4Kai-Suan Psychiatric Hospital, Kaohsiung, Taiwan, ROC

Correspondence to: C-J Hong, MD, Department of Psychiatry, Veterans General Hospital-Taipei, No. 201, Shih-Pai Road, Sec. 2, 11217, Taipei, Taiwan, ROC. E-mail: cjhong@vghtpe.gov.tw

Abstract

The serotonin transporter (5-HTT) is the site of primary action for the selective serotonin reuptake inhibitors (SSRIs). Previous Western reports have demonstrated that the lallele of the 5-HTT gene-linked polymorphic-region (5-HTTLPR) polymorphism is associated with better SSRI antidepressive effects than the s allele, however, another study of a Korean population has produced a contrasting finding. The present study tested the hypothesis that the 5-HTTLPR genetic polymorphism is associated with SSRI antidepressant response by evaluating total and cluster depressive symptoms for 121 Chinese patients diagnosed with major depression. Analysis of the results reveals that patients with the l/l genotype had a significantly better response to SSRI (fluoxetine) when compared with s allele carriers, as evaluated on the basis of total (P = 0.013), core (P = 0.011), and psychic-anxiety (P = 0.005) and somatic-anxiety (P = 0.002) Hamilton Depression Rating Scale-score percentage change. Our findings confirm reports that the l allele is associated with better SSRI response.

Molecular Psychiatry (2002) 7, 1115-1119. doi:10.1038/sj.mp.4001141

Keywords

major depressive disorders; polymorphism; selective serotonin reuptake inhibitors; serotonin transporter; treatment response

Introduction

The introduction of fluoxetine in 1988, followed by other selective serotonin reuptake inhibitors (SSRIs; citalopram, fluvoxamine, paroxetine and sertraline), has revolutionized the treatment of major depressive disorders (MDD) because of the favourable side-effect profiles. Not all MDD patients benefit from SSRI treatment, however, with partial or zero response demonstrated for 29-46% of MDD patients.1 These inter-individual variations in response to SSRI treatment have prompted several studies aimed at finding biological markers to predict therapeutic response, facilitating determination of optimal drug selection (eg cortisol responses to d-fenfluramine,2 plasma total tryptophan/large neutral amino acids ratio,3 lymphocyte glucocorticoid receptor density,4 and plasma free 3-methoxy-4-hydroxyphenylglycol5).

The primary mode of action for SSRIs is binding to the serotonin transporter (5-HTT), inhibiting its capacity to transport serotonin and thus modulating serotonergic activity. It has been determined that, in terms of transcriptional activity, the long (l) variant in the 5-HTT gene-linked polymorphic region (5-HTTLPR) is more than twice as active as the short (s) variant, with differences in 5-HTT mRNA synthesis and 5-HTT expression.6 Lesch et al have demonstrated that carriers of the s variant of the polymorphism had higher anxiety-related traits than homozygotes of the l variant in healthy subjects.7 Variations in the 5-HTTLPR polymorphism have been associated with major depression.8 However, study of the 5-HTTLPR polymorphism in Japanese patients with major depressions could not find any differences between patients and the control group.9 An association between fluvoxamine response and 5-HTTLPR polymorphism was first reported by Smeraldi et al, in 1998,10 with better response to fluvoxamine demonstrated for the l allele carriers (l/l and l/s) in comparison to homozygotes for the s variant (s/s). Two subsequent studies produced similar findings.11,12 For late-life MDD, Pollock et al, demonstrated significantly more rapid improvement for depressive symptoms for paroxetine-treated patients bearing the l/l genotype than for analogs carrying the s allele.11 In another paroxetine study, l/l genotype patients had significantly better response than s/s genotype analogs, with those bearing heterozygote (l/s) falling between the two.12 A contrasting finding was reported in the study of a Korean population, however, with the frequency of the s variant homozygote significantly higher for responders than for non-responders.13 The hypothesis that the discrepancy between these studies is likely to be the result of ethnic differences prompted this investigation of the association between the 5-HTTLPR promoter polymorphism and SSRI treatment response in a Chinese population. In addition, the relationship between 5-HTTLPR genotypes and improvement for specific cluster symptoms was explored.

Materials and methods

For this investigation, patients with moderate-to-severe depression were recruited from a psychiatric clinic. Inclusion criteria were: (1) diagnosis of MDD according to DSM-IV guidelines; (2) minimum baseline score of 18 on the 21-item Hamilton Depression Rating Scale (HAM-D);14 and (3) presence of depressive symptoms for at least 2 weeks before entry into the study, without antidepressant treatment (patients were fresh cases or had quit antidepressants for more than 2 weeks). Exclusion criteria were additional diagnoses on Axis 1 (including substance abuse, generalized anxiety disorders, panic disorders or obsessive compulsive disorders) of the DSM-IV, personality disorders, pregnancy, attempted suicide, and major medical and/or neurological disorders. A total of 121 MDD patients (male/female: 70/51; mean age: 44.7 (SD: 16.7) years) were enrolled in this study. The sample consisted entirely of ethnic Chinese, with informed consents obtained from all participants. Treatment efficacy was evaluated by one investigator (YWY), blind to patient's genotype, administering the HAM-D before and after the 4-week antidepressant treatment. 'Responders' were defined as at least 50% decrease in the HAM-D total score after 4 weeks of mediation and 'remitters' were defined as subjects having a HAM-D total score of 7 or less points after 4 weeks of mediation. All the 121 patients took fluoxetine (range: 20-60 mg day-1; mean 29.4 ± 10.4 mg day-1).

Genomic DNA was extracted from EDTA-containing venous blood samples using Lahiri and Nurnberger's protocol.15 For genotyping, fragments of 5-HTTLPR were amplified by polymerase chain reaction (PCR) using the primers as described with 5-HTTLPR-3: ATGCCAGCACCTAACCCCTAATG plus 5-HTTLPR-2: GAGGGACTGAGCTGGACAACCAC.16 Polymorphisms of 5-HTTLPR were determined according to the size which was determined from agarose-gel electrophoresis. The sizes of the s and l 5-HTTLPR alleles were 469-470 bp and 511-513 bp, respectively.

To evaluate specific cluster depressive symptoms, the HAM-D items were grouped according to the following factors: core (Items 1, 2, 7, 8, 10, 13), sleep (Items 4, 5, 6), activity (Items 7, 8), psychic anxiety (Items 9, 10), somatic anxiety (Items 11, 12, 13), and delusion (Items 2, 15, 20), as described by Serretti et al.17 Both the total and subcategory HAM-D scores were subjected to statistical analysis. Therapeutic response was evaluated by the percentage score reduction in total and subcategory HAM-D scores ((baseline score - 4-week score) ´ 100/baseline score).

The categorical data were analyzed using the chi-square test or the Fisher exact test if necessary. Gender differences for continuous variables were evaluated by student t-test. Genotype differences for continuous variables were evaluated using one-way analysis of variance followed by the LSD multiple range tests for comparison among groups. A linear-regression analysis was performed with total HAMD score percentage reduction as the dependent variable, and with 5-HTTLPR genotype as the predictor variables. The criterion for significance was set at P < 0.05 for all of the tests. Data are presented as mean (SD).

Results

The genotype distribution for the 5-HTTLPR polymorphism, which was in Hardy-Weinberg equilibrium, and the HAM-D scores for 121 MDD patients are presented in Table 1. No significant differences were demonstrated for age and sex comparing the three 5-HTTLPR genotype groups. There were also no significant differences comparing the three genotype groups for the baseline total HAM-D scores. Marginal significant differences were found in the core (P = 0.030) and sleep (P = 0.037) sub-HAM-D scores among the three 5-HTTLPR genotype groups.

Therapeutically, patients bearing the l/l genotype had a significantly better response to antidepressants when compared with s allele carriers, as evaluated on the basis of total (P = 0.013; power is 73% with effect size = 0.0708), core (P = 0.011), psychic anxiety (P = 0.005) and somatic anxiety (P = 0.002) HAM-D score percentage reduction (Table 1). A linear-regression analysis was performed with 5-HTTLPR genotype as the predictor variables, and it was demonstrated that the 5-HTTLPR l/l genotype was a significant predictor of therapeutic response (P = 0.007; r2 = 0.051). 'Responders' were also more commonly found in patients of the 5-HTTLPR l/l genotype than in patients of other genotypes (P = 0.019; power = 75%), while the percentage of the 'remitters' was similar among the three genotype patients (P = 0.150; power = 47%) (Table 1). No difference in total HAM-D score percentage reduction was found between either gender (P = 0.862).

Discussion

In this study of a Chinese sample population, it was demonstrated that patients bearing the 5-HTTLPR l/l genotype had a better response to SSRI treatment than s allele carriers. Although this finding confirms three previous Western reports,10,11,12 it contrasts with a Korean study.13 There are several possible explanations for this discrepancy. Firstly, the 5-HTTLPR polymorphism may be in linkage disequilibrium with a functional variant that affects SSRI response, and the extent of this linkage disequilibrium is not similar for all ethnic populations. Thus, the association between 5-HTTLPR genetic variants and SSRI treatment response may be ethnicity-dependent. This is less likely, however, since it seems reasonable to assume that the Chinese and Koreans are more likely to be similar genetically, given their geographical proximity. Secondly, this discrepancy may have resulted from differences in MDD severity or subtype for MDD populations enrolled in the various studies. Thirdly, compared with the European American population, the l allele frequency in Chinese or Korean populations was much lower.10,11,12,13 The s/s population is five times bigger than the l/l and two times bigger than the heterozygous in our or Korean studies. Only 13 of our 121 patients and five of the 120 Korean patients were l/l homozygotes. Thus, the results will be likely influenced by a chance finding and further study with a larger sample is needed. Finally, differences in therapeutic-response assessment, duration of treatment and SSRI type may have produced the different results. For example, a study stratifying the patients into responders and non-responders may lead to the reclassification of some non-responders as responders in a longer follow-up. In this study, patients were assessed after 4-week medication, while in the Korean study patients were assessed after a 6-week trial.

The 5-HTTLPR allele frequency examined differed for this Chinese population in comparison to the European-American samples.10,11,12 Thus, if carriage of the l allele is associated with better SSRI response, it is likely that Chinese MDD patients would have a less favourable response rate than their Western counterparts. In this study, however, it was determined that the 5-HTTLPR polymorphism accounts for 5.1% of the variance in SSRI response. This is very close to the value of 7% reported in previous studies.18 Moreover, the same article reported that a tryptophan hydroxylase genetic polymorphism (A218C) explained about 5% of the variance in antidepressant efficacy and the effect was independent from that of the 5-HTTLPR polymorphism, suggesting an additive effect.18 As therapeutic antidepressant effect may involve the interaction of many different genes, a single gene may, therefore, play only a relatively minor role in an intricate mechanism and, thus, not be strongly associated with antidepressant response. For example, a recent study of MDD patients demonstrated that angiotensin I-converting enzyme D-allele carriers had a better therapeutic outcome than analogs bearing the I/I genotype.19 Analyses of the interactions of multiple genes, implicated in the pharmacokinetics or pharmacodynamics of SSRIs, may merit attention in future pharmacogenetic study of antidepressants.

We demonstrated that, for our patient population, there were no significant differences comparing the three genotype groups for the baseline total HAM-D scores. However, marginal significant differences were found in the core and sleep sub-HAM-D scores among the three 5-HTTLPR genotype groups (without correction for multiple comparisons). A previous report using similar analytical techniques found no association of the 5-HTTLPR variants and MDD symptomatology.17 This finding and our results suggest that this particular 5-HTTLPR polymorphism plays no major role in MDD symptomatology. In our analysis of the associations between specific symptoms and this 5-HTTLPR polymorphism, however, improvements were demonstrated for core, psychic and somatic anxiety item clusters, but not sleep, activity and delusion analogs. This finding is of interest since a relationship has been demonstrated between the 5-HTTLPR variants and anxiety-related traits.7 In addition, SSRIs have recently been widely used for anxiety disorders such as panic and obsessive-compulsive disorder, social phobia and generalized anxiety disorder.20 It would be of interest to test whether the 5-HTTLPR polymorphism may also be a predictor for efficacy of SSRI treatment for these dysfunctions.

Since the 5-HTTLPR polymorphism may affect 5-HTT gene transcription,6 we suggest that using the 'knockout' or 'knockdown' strategy may provide further elaboration of 5-HTT's contribution for mediation of the effects of SSRIs. For example, a leading hypothesis for the therapeutic actions of SSRI is desensitization of somatodendritic serotonin 5-HT1A autoreceptors in the midbrain raphe.21 Recent studies demonstrated that altered expression and function of serotonin 5-HT1A receptor in mice lacking the 5-HTT may partially explain the association of the 5-HTTLPR polymorphism and SSRI therapeutic effects.22,23,24

One limitation of this study is that plasma levels of fluoxetine were not analyzed. However, this effect is minimal since a previous study had demonstrated that there were no significant relationships between fluoxetine blood levels and clinical response in depressed patients.25

In summary, it was demonstrated that, for our Taiwanese Chinese population, patients bearing the 5-HTTLPR l/l genotype had a superior response to SSRI treatment than s allele-carrier analogs, supporting Western reports. Further, our results suggest an association between 5-HTTLPR genotypes and improvement for anxiety-cluster symptoms.

Acknowledgements

This work was supported by grant DOH89-TD-1095 from the Department of Health, Taiwan, ROC and grant VGH89-398-15 from Veterans General Hospital-Taipei. The authors would like to thank Miss Shu-Chiung Chiang for her assistance in statistical analysis.

References

1 Fava M. Management of nonresponse and intolerance: switching strategies. J Clin Psychiatry 2000; 61 Suppl 2: 10-12.

2 Cleare AJ, Murray RM, O'Keane V. Assessment of serotonergic function in major depression using d-fenfluramine: relation to clinical variables and antidepressant response. Biol Psychiatry 1998; 44: 555-561.

3 Lucini V, Lucca A, Catalano M, Smeraldi E. Predictive value of tryptophan/large neutral amino acids ratio to antidepressant response. J Affect Disord 1996; 36: 129-133.

4 Sallee FR, Nesbitt L, Dougherty D, Hilal R, Nandagopal VS, Sethuraman G. Lymphocyte glucocorticoid receptor: predictor of sertraline response in adolescent major depressive disorder (MDD). Psychopharmacol Bull 1995; 31: 339-345.

5 Ko HC, Lu RB, Shiah IS, Hwang CC. Plasma free 3-methoxy-4-hydroxyphenylglycol predicts response to fluoxetine. Biol Psychiatry 1997; 41: 774-781.

6 Heils A, Teufel A, Petri S, Stober G, Riederer P, Bengel D et al. Allelic variation of human serotonin transporter gene expression. J Neurochem 1996; 66: 2621-2624. MEDLINE

7 Lesch KP, Bengel D, Heils A, Sabol SZ, Greenberg BD, Petri S et al. Association of anxiety-related traits with a polymorphism in the serotonin transporter gene regulatory region. Science 1996; 274: 1527-15231. Article MEDLINE

8 Mann JJ, Huang YY, Underwood MD, Kassir SA, Oppenheim S, Kelly TM et al. A serotonin transporter gene promoter polymorphism (5-HTTLPR) and prefrontal cortical binding in major depression and suicide. Arch Gen Psychiatry 2000; 57: 729-738. MEDLINE

9 Kunugi H, Hattori M, Kato T, Tatsumi M, Sakai T, Sasaki T et al. Serotonin transporter gene polymorphisms: ethnic difference and possible association with bipolar affective disorder. Mol Psychiatry 1997; 2: 457-462. Article MEDLINE

10 Smeraldi E, Zanardi R, Benedetti F, Di Bella D, Perez J, Catalano M. Polymorphism within the promoter of the serotonin transporter gene and antidepressant efficacy of fluvoxamine. Mol Psychiatry 1998; 3: 508-511. Article MEDLINE

11 Pollock BG, Ferrell RE, Mulsant BH, Mazumdar S, Miller M, Sweet RA et al. Allelic variation in the serotonin transporter promoter affects onset of paroxetine treatment response in late-life depression. Neuropsychopharmacology 2000; 23: 587-590. Article MEDLINE

12 Zanardi R, Benedetti F, Di Bella D, Catalano M, Smeraldi E. Efficacy of paroxetine in depression is influenced by a functional polymorphism within the promoter of the serotonin transporter gene. J Clin Psychopharmacol 2000; 20: 105-157. Article MEDLINE

13 Kim DK, Lim SW, Lee S, Sohn SE, Kim S, Hahn CG et al. Serotonin transporter gene polymorphism and antidepressant response. Neuroreport 2000; 11: 215-219. MEDLINE

14 Hamilton M. Development of a rating scale for primary depressive illness. Br J Soc Clin Psychol 1967; 6: 278-296.

15 Lahiri DK, Nurnberger JI Jr. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res 1991; 19: 5444. MEDLINE

16 Heils A, Teufel A, Petri S, Stober G, Riederer P, Bengel D et al. Allelic variation of human serotonin transporter gene expression. J Neurochem 1996; 66: 2621-2624. MEDLINE

17 Serretti A, Cusin C, Lattuada E, Di Bella D, Catalano M, Smeraldi E. Serotonin transporter gene (5-HTTLPR) is not associated with depressive symptomatology in mood disorders. Mol Psychiatry 1999; 4: 280-283. Article MEDLINE

18 Serretti A, Zanardi R, Rossini D, Cusin C, Lilli R, Smeraldi E. Influence of tryptophan hydroxylase and serotonin transporter genes on fluvoxamine antidepressant activity. Mol Psychiatry 2001; 6: 586-592. Article MEDLINE

19 Baghai TC, Schule C, Zwanzger P, Minov C, Schwarz MJ, de Jonge S. Possible influence of the insertion/deletion polymorphism in the angiotensin I-converting enzyme gene on therapeutic outcome in affective disorders. Mol Psychiatry 2001; 6: 258-259.

20 Zohar J, Westenberg HG. Anxiety disorders: a review of tricyclic antidepressants and selective serotonin reuptake inhibitors. Acta Psychiatr Scand Suppl 2000; 403: 39-49.

21 Stahl SM. Mechanism of action of serotonin selective reuptake inhibitors. Serotonin receptors and pathways mediate therapeutic effects and side effects. J Affect Disord 1998; 51: 215-235.

22 Gobbi G, Murphy DL, Lesch KP, Blier P. Modifications of the serotonergic system in mice lacking serotonin transporters: an in vivo electrophysiological study. J Pharmacol Exp Ther 2001; 296: 987-995.

23 Fabre V, Beaufour C, Evrard A, Rioux A, Hanoun N, Lesch KP et al. Altered expression and functions of serotonin 5-HT1A and 5-HT1B receptors in knock-out mice lacking the 5-HT transporter. Eur J Neurosci 2000; 12: 2299-2310.

24 Gingrich JA, Hen R. Dissecting the role of the serotonin system in neuropsychiatric disorders using knockout mice. Psychopharma-cology 2001; 155: 1-10.

25 Burke WJ, Hendricks SE, McArthur-Campbell D, Jacques D, Stull T. Fluoxetine and norfluoxetine serum concentrations and clinical response in weekly versus daily dosing. Psychopharmacol Bull 1996; 32: 27-32.

Tables

Table 1 Demographic data and fluoxetine therapeutic response among three 5-HTTLPR genotype groups

Received 25 October 2001; revised 13 February 2002; accepted 4 March 2002
2002, Volume 7, Number 10, Pages 1115-1119
Table of contents    Previous  Article  Next    [PDF]
Privacy Policy © 2002 Nature Publishing Group