|
|
|
| May 2001, Volume 6, Number 3, Pages 259-260 |
| Table of contents Previous Article Next [PDF] |
 |
| Scientific Correspondence |
| Mutation screening of the KCNN3 gene reveals a rare frameshift mutation |
 |
| T Bowen1, N Williams1, N Norton1, G Spurlock1, O H Wittekindt2, D J Morris-Rosendahl2, H Williams1, L Brzustowicz3, B Hoogendoorn1, S Zammit1, G Jones1, R D Sanders1, L A Jones1, G McCarthy1, S Jones1, A Bassett4, A G Cardno1, M J Owen1 and M C O'Donovan1 |
 |
1Division of Psychological Medicine, University of Wales College of Medicine, Cardiff CF14 4XN, UK
2Institut fuer Humangenetik und Anthropologie, University of Freiburg, Germany
3Department of Genetics, Rutgers University, Piscataway, NJ 08854, USA
4Genetics Section, Schizophrenia Research Program, Centre for Addiction and Mental Health, Queen Street Division, Toronto M6J 1H4, Canada
|
 |
Correspondence to: M C O'Donovan, E-mail: odonovanmc@cardiff.ac.uk
|
 |  |
SIR - Chandy and colleagues1 reported association between schizophrenia and moderately large alleles of a CAG repeat in the KCNN3 gene encoding hKCa3, a calcium-activated potassium channel. Although others have reported similar findings, most have not replicated this finding.2 However, recently, Brzustowicz and colleagues3 have reported linkage between schizophrenia (maximum heterogeneity lod score of 6.5) and chromosome 1q21-22. As KCNN3 also maps to 1q21,4 it can be considered a positional candidate gene for schizophrenia.
To allow further investigation of KCNN3, we have screened its genomic sequence for other sequence variants using denaturing high performance liquid chromatography (DHPLC).5 We found two synonymous polymorphisms and a frameshift mutation in exon 1 that is predicted to result in a truncated protein. We tested this variant for association in a sample of 184 individuals of British Caucasian origin diagnosed with DSM-IV schizophrenia, and 184 matched blood donor controls. Furthermore, we also genotyped 93 affected individuals from the 22 pedigrees in the study that yielded strong evidence for linkage to 1q21-22.3 No further chromosome carrying this mutation were found.
Each exon of KCNN3 was amplified in a series of 10 fragments of size ranging between 158 and 497 bp, using unpublished data concerning its genomic structure (Morris-Rosendahl, unpublished). Amplified sequence included the complete cDNA sequence of the KCNN3 except bases 410-484. These lie between the two CAG repeat arrays in exon 1 and the fragment is too small for DHPLC analysis without the inclusion of the repetitive sequence. DHPLC was performed based upon a protocol that results in detection of 95-100% of mutations.6 Where DHPLC analysis suggested that any subject was heterozygous, the PCR products from all 14 cases were sequenced using ABI PRISM BigDye Terminator Cycle Sequencing Kits. In order to give an estimate of allele frequencies, the exons with polymorphisms in cases were also sequenced in 13 blood donor controls. The screening set for DHPLC consisted of 14 unrelated subjects meeting DSM-IV criteria for schizophrenia. Details of primers, PCR conditions, and DHPLC analysis are available on request.
We detected: (i) a 4-bp deletion 1137 1140delGTGA in exon 1 (del 1/28 chromosomes in cases, 0/26 chromosomes in controls); (ii) a g.1333T>C in exon 3 (T allele 8/28 chromosomes in cases and 8/26 in controls); and (iii) a tri-allelic polymorphism g.1378A>C<G also in exon 3 (A allele, 3/28 chromosomes in cases, 7/26 in controls; G allele 13/28 in cases, 9/26 in controls; C allele 12/28 in cases, 10/26 in controls). All changes from the reference sequence (GenBank AF031815) in exon 3 are synonymous.
Because they are synonymous, the polymorphisms in exon 3 were not analyzed further. The 1137 1140delGTGA changes the open reading frame and predicts that, following L283fs, translation would proceed for three more amino acids before a stop codon (L283fs287X). Carrying only 283 of its full length of 731 amino acids plus three frame-shifted residues, the truncated protein is predicted to have no transmembrane domains and hence to lack normal function.7 Whether the small truncated protein with a polyglutamine motif would result in a gain of function is unknown. We therefore genotyped a case control sample of 184 unrelated subjects with DSM-IV schizophrenia and 184 controls. These have been recently described in detail elsewhere.8 Furthermore, we also genotyped 63 narrow-definition (schizophrenia or schizoaffective disorder) affected individuals and 30 individuals with schizophrenia spectrum disorders (non-affective psychotic disorder, schizotypal personality disorder, or paranoid personality disorder) from the 22 pedigrees in the study that yielded strong evidence for linkage to 1q21-22.3
Primers 1cGF CCTGCTCCATCACCCTAATG and 1cGR TGAGTACAAACCCCAAGAGAG were used to amplify a fragment of 235 bases. PCR products were digested with DdeI and resolved on a 1.5% agarose gel. The deletion variant remains uncut, the insertion is cut into fragments of 152 and 83 bases.
No further individuals with the 1137 1140delGTGA mutation were identified in the case control or the linkage samples. Consequently, we cannot distinguish between the possibility that 1137 1140delGTGA is a rare cause of schizophrenia or simply a chance finding, although the latter is, a priori, more likely. We can, however, exclude the possibility that this rare variant is responsible for the major linkage finding on 1q21-22,3 but it may also be advisable for researchers with other families displaying linkage between schizophrenia and this region 1 to screen their affected patients for this mutation.
The present study provides no further support for KCNN3 as a susceptibility gene for schizophrenia. Caveats apply. Although our screening sample has power of over 0.8 to detect alleles with a frequency of 0.06 in schizophrenics, and power of 0.95 to detect alleles with a frequency of 0.1 in schizophrenics, we cannot exclude susceptibility variants deep in the introns (we analysed an average of <50 bp of flanking intronic sequence flanking per exon) or polymorphisms 5' to the first 57 bases of the promoter region. Moreover we have only genotyped the variant in KCNN3 that is predicted to change the amino acid structure of hKCa3. The rationale for this is that with limited genotyping technology, such variants should be prioritised because they are a priori more likely to be involved in disease pathogenesis. In doing so, we recognise the possibility that some synonymous variants might occasionally have functional sequelae.
|
 |
| References |
 |
1 Chandy KG et al. Mol Psychiatry 1998; 3: 32-37, , MEDLINE
2 O'Donovan MC, Owen MJ. Am J Hum Genet 1999; 65: 587-592, MEDLINE
3 Brzustowicz LM et al. Science 2000; 288: 678-682, Article MEDLINE
4 Wittekindt O et al. Neurogenetics 1998; 1: 259-265, Article MEDLINE
5 Oefner PJ, Underhill PA. In: Dracopoli NC et al (eds). Current Protocols in Human Genetics Suppl 19. Wiley & Son: New York, 1998, 7.10.1-7.10.12.
6 Jones AC et al. Clin Chem 1999; 45: 1133-1140, MEDLINE
7 Gargus JJ, Fantino E, Gutman GA. Mol Med Today 1998; 4: 518-524, MEDLINE
8 Austin J et al. Mol Psychiatry 2000; 5: 208-212, MEDLINE
|
 |
 |
 |
|
 |
| May 2001, Volume 6, Number 3, Pages 259-260 |
 |
| Table of contents Previous Article Next [PDF] |
|
|