¹Novartis Pharmaceuticals Corporation, Pharmacogenetics, Gaithersburg, USA

²Institute of Psychiatry, Section of Molecular Genetics, London, UK

³Departments of Psychiatry and Biology, University Hospital, Faculty of Medicine, University of Patras, Greece

⁴Division of Medical and Molecular Genetics, Guy's King's and St Thomas School of Medicine, London, UK

Correspondence to: Dr M H Polymeropoulos, Novartis Pharmaceuticals Corporation, Pharmacogenetics, 9 West Watkins Mill Road, Gaithersburg, MD 20878, USA. E-mail: mihael.polymeropoulos@pharma.novartis.com

Wolfram syndrome, a rare autosomal recessive neurodegenerative disorder, was originally described as a combination of familial juvenile-onset diabetes mellitus and optic atrophy. It was later demonstrated that Wolfram syndrome patients were highly prone to psychiatric disorders. Mutations in exon 8 of the Wolfram syndrome gene account for 88% of the patients with Wolfram syndrome. To examine whether the gene responsible for causing Wolfram syndrome is involved in psychiatric disorders, we screened exon 8 of the Wolfram syndrome gene for mutations in 119 patients with schizophrenia, one patient with schizoaffective disorder, 12 patients with bipolar disorder and 15 patients with major depression, using sequence analysis. In Wolfram syndrome patients, this gene has been shown to have primarily nonsense or frameshift mutations, which would result in a premature truncation of the protein. None of the psychiatric patients screened in this study carried these types of mutations. We identified, however, 24 new variations whose significance remains to be determined. Molecular Psychiatry (2001) 6, 39-43.

Wolfram syndrome gene; psychiatric diseases; polymorphism; mutation; variation; schizophrenia; schizoaffective disorder; bipolar disorder; major depression

Introduction

Wolfram syndrome (WS), also referred to as DIDMOAD (MIM222300) is a rare autosomal recessive disorder characterized by Diabetes Insipidus, juvenile Diabetes Mellitus, bilateral Optic Atrophy, sensoneural Deafness and acquired urinary tract abnormalities.^1,2,3 In WS homozygous patients, the pleiotropic effects caused by Wolframin mutations include psychiatric symptoms such as paranoid delusions, severe depression, attempted suicide and violent behavior.⁴ An increase in psychiatric disorders was observed in 36 families with Wolfram syndrome.⁵ We have reported that families of patients with WS have an increased risk for hospitalization in psychiatric institutions, pointing to a potential link of the WS gene to psychiatric disorders.⁶ In that study, 10 of 11 relatives of patients with WS diagnosed with major depression requiring hospitalization, were carriers for the WS gene.

The gene causing WS has been recently identified and is predicted to code an ubiquitously expressed 100-kDa transmembrane protein.^7,8,9 In WS patients, the WS gene has been shown to have primarily nonsense or frameshift insertion/deletion mutations, which would result in a premature truncation of the protein. A number of missense mutations, inframe deletions/insertions, a splice mutation and a microscopic deletion have also been described.^7,8,9 Eighty-eight percent of these mutations are located within exon 8, which represents 68% of the WS gene coding sequence.

To assess the role of the WS gene in psychiatric disorders, we screened exon 8 for mutations in patients with schizophrenia, schizoaffective disorder, bipolar disorder and major depression. The aim of the study was to determine whether or not any of these patients carried a deletion or nonsense mutation in the WS gene. Although no such mutations were observed, we identified a number of new variations.

Materials and methods

Subjects

Patient samples used were from the NIMH Cell Repository, Bethesda MD, USA; the Institute of Psychiatry (IoP), London, UK and the Departments of Biology and Psychiatry, Medical Faculty, University of Patras, Greece. The NIMH Cell Repository is a collection of US origin. These pedigrees have at least two affected biologically first-degree relatives. At least one member diagnosed with schizophrenia and a second member diagnosed with schizophrenia or schizoaffective disorder-depressive type were required for pedigree enrollment. All patients were interviewed using the Diagnostic Interview for Genetic Studies (DIGS)¹⁰ and diagnosis was according to DSM-III-R.¹¹ We screened 89 probands from the NIMH collection. All of the probands met the criteria for schizophrenia.

Forty subjects from the IoP were collected between 1994 and 1999. All these subjects were of UK origin. Fifteen patients with schizophrenia from the IoP were receiving clozapine at the time of sampling, and were diagnosed by clinical interview according to DSM-III-R¹¹ or DSM-IV¹² criteria. Family history of psychosis was not recorded for this group. They may represent an 'atypical' group of patients since the licensing requirements of clozapine in the UK include the failure of a given patient to respond to typical neuroleptics. Ten patients with bipolar and 15 patients with unipolar disorder were diagnosed according to DSM-IV criteria using information from hospital case-notes, structured interviews (SADS-L, SCAN or a structured hospital discharge vignette) and all other available sources of information. Patients with schizoaffective disorder or a family history of schizophrenia were excluded from the bipolar disorder sample. The remaining patients were not selected with respect to family history of a psychiatric illness. Subjects from the Department of Psychiatry in Patras, Greece, belong to 18 unrelated pedigrees. These patients are of Greek origin. All patients were diagnosed using the Structured Clinical Interview for DSM-III-R.¹³ There were 15 patients meeting DSM-IV criteria for schizophrenia, one for schizoaffective and two for bipolar I disorder. The origin and the diagnoses of the patients studied are listed in Table 1. Patient samples from the UK and Greece were collected upon informed consent and (Institutional Review Board) IRB approval of the protocol.

Variation screening and sequencing analysis

Exon 8 of the WS gene was amplified by PCR using four sets of overlapping primers previously published by Inoue et al [8AF 5' TGTAAAACGACGGCCAGT CCTCGTTCCCACGTACCATC 3'; 8AR 5' CAGGAAACAGCTATGACCGTAGCAGTAGGTGCCCTTGA 3'; 8BF 5' TGTAAAACGACGGCCAGTCCTGGTCG TCCT CAATGTCA 3'; 8BR 5' CAGGAAACAGCTATGACCA TAGAACCAGCAGAACAGC 3'; 8CF 5' TGTAAAAC GACGG CCAGTT GGTTCACGTCTCTGGAGCT 3', 8DR 5' CAGGAAACAGCTATGACCGAACTTCTTGATGTG GCAGG 3'; 8EF 5' TGTAAAAC GACGGCCAGTCT GGATGCGCTGCCTCTACG 3', 8FR 5' CAGGAAA CAGCTATGAC CCCAAACAAA TAAGA AATGCT 3'].⁷ The M13 universal primer sequence was incorporated into the 5' terminus of primers for direct sequence analysis using the dideoxy terminator method. The amplicons were sequenced on an ABI 377 sequencer (Perkin Elmer, Foster City, CA, USA) according to the manufacturer's recommendations.

The frequency of the Ala602Val variation was assessed using Third Wave Technologies (TWT, Madison, WI, USA) Invader Assay.¹⁴ Probe sets for each locus were designed and synthesized by TWT and the assay run according to the manufacturer's instructions.

Results/discussion

To investigate the role and nature of germline mutations of the WS gene, in familial and sporadic cases of psychiatric disorders, exon 8 of the WS gene, which hosts 88% of the mutations found in WS patients, was sequenced after amplification of patients' genomic DNA. None of the mutations found in Wolfram patients to date, summarized in Table 2, were found in our group of psychiatric patients.

However, we identified 17 new independent missense mutations, which resulted in amino-acid substitutions (Table 3; Figure 1). An Ala602Val change was found in six schizophrenic patients from the NIMH collection out of 138 psychiatric patients tested. To assess the frequency of this variation, 168 individuals from the Coriell DNA Polymorphism Panel (M450PDR, http://locus.umdnj.edu/nigms/pdr.html) were studied. From 336 chromosomes, 10 revealed the C to T nucleotide change at position 1807 corresponding to a variation frequency of 3% against the 2% frequency observed in psychiatric patients. All other variations observed in this group of patients had a frequency of less than 1%, with the exception of change Arg818Cys which had a frequency of 2.2%. Two compound heterozygous were identified; a schizophrenic patient with a Gly786Ser and an Asp866Asn substitution, and a patient with major depression, showing an Ala559Thr change associated to an Ala586Thr substitution. The rare Ala559Thr variation has been recently reported in three bipolar and one unipolar patient¹⁵ and was observed in one schizophrenic and one patient with major depression in our group of patients. Sequence analysis also revealed a number of silent variants.

Most of the mutations leading to WS are nonsense or frameshift insertion/deletion mutations predicting a premature truncation of the protein. None of these were found in this set of psychiatric patients, suggesting that the genetic contribution of these types of mutation of the WS gene in the disorders studied is expected to be rare. We have, however, identified a number of new variations. The significance of these new variants in the etiology of psychiatric disorders remains to be examined.

Acknowledgements

We thank Dr Graeme Bilbe from Novartis Pharma AG, Basel, Switzerland for sharing with us the DNA samples from the NIMH Cell Repository, Bethesda, Maryland, USA.

1 Wolfram DJ, Wagner HP. Diabetes mellitus and simple optic atrophy among siblings: report of four cases. Mayo Clin Proc 1938; 13: 715-718,

2 Shaw DA, Duncan LJP. Optic atrophy and nerve deafness in diabetes mellitus. J Neurol Neurosurg Psychiat 1958; 21: 47-49,

3 Dreyer M, Rudiger HW, Bujara K, Herberhold C, Kuhnau J, Maack P et al. The syndrome of diabetes insipidus, diabetes mellitus, optic atrophy, deafness, and other abnormalities (DIDMOAD-syndrome). Two affected sibs and a short review of the literature (98 cases). Klin Wochenschr 1982; 60: 471-475, MEDLINE

4 Swift RG, Sadler DB, Swift M. Psychiatric findings in Wolfram syndrome homozygotes. Lancet 1990; 336: 667-669, MEDLINE

5 Swift RG, Perkins DO, Chase CL, Sadler DB, Swift M. Psychiatric disorders in 36 families with Wolfram syndrome. Am J Psychiatry 1991; 148: 775-779, MEDLINE

6 Swift RG, Polymeropoulos MH, Torres R, Swift M. Predisposition of Wolfram syndrome heterozygotes to psychiatric illness. Mol Psychiatry 1998; 3: 86-91, MEDLINE

7 Inoue H, Tanizawa Y, Wasson J, Behn P, Kalidas K, Bernal-Mizrachi E et al. A gene encoding a transmembrane protein is mutated in patients with diabetes mellitus and optic atrophy (Wolfram syndrome). Nat Genet 1998; 20: 143-148, Article MEDLINE

8 Strom TM, Hortnagel K, Hofmann S, Gekeler F, Scharfe C, Rabl W et al. Diabetes insipidus, diabetes mellitus, optic atrophy and deafness (DIDMOAD) caused by mutations in a novel gene (wolframin) coding for a predicted transmembrane protein. Hum Mol Genet 1998; 7: 2021-2028, Article MEDLINE

9 Hardy C, Khanim F, Torres R, Scott-Brown M, Seller A, Poulton J et al. Clinical and molecular genetic analysis of 19 Wolfram syndrome kindreds demonstrating a wide spectrum of mutations in WFS1. Am J Hum Genet 1999; 65: 1279-1290, MEDLINE

10 Nurnberger JI Jr, Blehar MC, Kaufmann CA, York-Cooler C, Simpson SG, Harkavy-Friedman J et al. Diagnostic interview for genetic studies. Rationale, unique features, and training. NIMH Genetics Initiative. Arch Gen Psychiatry 1994; 51: 849-859; discussion 863-864, MEDLINE

11 American Psychiatric Association. Diagnostic and Statistical Manual of Mental Disorders, revised 3rd edn. American Psychiatric Press: Washington, DC, 1987,

12 American Psychiatric Association. Diagnostic and Statistical Manual of Mental Disorders, revised 4th edn. American Psychiatric Press: Washington, DC, 1994,

13 Spitzer RL, Williams JB, Gibbon M, First MB. The Structured Clinical Interview for DSM-III-R (SCID). I: History, rationale, and description. Arch Gen Psychiatry 1992; 49: 624-629, MEDLINE

14 Lyamichev V, Mast AL, Hall JG, Prudent JR, Kaiser MW, Takova T et al. Polymorphism identification and quantitative detection of genomic DNA by invasive cleavage of oligonucleotide probes. Nat Biotechnol 1999; 17: 292-296, Article MEDLINE

15 Furlong RA, Ho LW, Rubinsztein JS, Michael A, Walsh C, Paykel ES et al. A rare coding variant within the wolframin gene in bipolar and unipolar affective disorder cases. Neurosci Lett 1999; 277: 123-126, MEDLINE

16 Rost B, Fariselli P, Casadio R. Topology prediction for helical transmembrane proteins at 86% accuracy. Protein Sci 1996; 5: 1704-1718, MEDLINE

Figure 1 Distribution of missense mutations throughout the hypothetical structure of Wolframin in a group of psychiatric patients. Schematic representation of Wolframin according to the PredictProtein program (http://dodo.cpmc.columbia. edu/predictprotein/).¹⁶ Exon 8, represented in blue, spans the whole 240 aa intracellular region, nine hypothetical transmembrane domains and 34 out of the 320 aa of the protein extracellular domain. Red spots throughout the structure indicate amino acid changes.

Table 1 Origin and diagnosis of patients used in the study

Table 2 Summary of published mutations in WS patients

Table 3 Variations found in exon 8 of the WS1 gene in psychiatric disorders