Introduction
The instability of the short arm of chromosome 12 (12p) in haematological malignancies, was first highlighted in a study which included three patients with myeloid disorders in whom fluorescence in situ hybridization (FISH), revealed translocation of terminal 12p probes, while the proximal probes only hybridized to the normal 12—an indication of an interstitial deletion from the abnormal homologue.1 These findings were confirmed in 16 patients with a variety of 12p abnormalities, of whom ten had interstitial deletions not suspected from the cytogenetics. However, direct involvement of ETV6 was only proved in two cases.2 Subsequently it has been shown that ETV6 is involved in a significant number of cases with visible cytogenetic abnormalities of 12p or loss of heterozygosity (LOH) in that region.3, 4, 5, 6, 7, 8, 9 There is some evidence that the gene is more often involved when the 12p rearrangements are balanced rather than unbalanced, the latter often being associated with a complex karyotype.10, 11 The inherent instability of the ETV6 gene has been demonstrated in several different studies by the use of cosmid probes to its individual exons. However, the series of probes used have not always covered the complete gene, so the significance of some findings is unclear.3, 6, 7, 8 Although ETV6 is an attractive candidate for the main target of the deletions and translocations associated with 12p, its central role remains unproven.12
The fusion partners of ETV6, of which over twenty have been described, are either protein tyrosine kinases in which the majority of ETV6 breakpoints occur in intron 4 or 5 of the gene, or transcription factors of which the commonest is the fusion with RUNX1 in B-cell progenitor acute lymphoblastic leukaemia (BCP-ALL), with a breakpoint in intron 5. A third group of cases in which the 'fusion' does not always result in a meaningful protein product, has a breakpoint in intron 2.13
The rearrangements resulting from intron 2 breakpoints are of two types. The first of these includes both of the conserved domains of the ETV6 gene. Examples are the t(4;12)(q11–q12;p13) involving the CHIC2 gene, and the t(5;12)(q31;p13) the ACS2 gene,14 the t(7;12)(q36;p13) involving the HLXB9 gene,15, 16, 17 the t(9;12)(q11;p13) the PAX5 gene18, 19 and the t(12;22)(p13;q11) the MN1 gene.20, 21, 22 These are all recurrent translocations but only some of the fusions are in frame.
The other type of ETV6 abnormality with an intron 2 breakpoint, joins the first two exons of the 5' end of ETV6 to a growing list of partners which include MDS2,23 MDS1/EVI1,24, 25 STL,26 AF7p15,27 GOT1,28 BAZ2A29 and CDX2.30 This group comprises both unique and rare recurrent examples. None appeared to result in a fusion protein to which an oncogenic potential could be attributed, demanding an alternative explanation that implicated an upregulatory function for the truncated gene.
Insertion of genetic material from one chromosome into another is a recurrent phenomenon in many types of acute leukaemia. Surprisingly, given the incidence of the t(12;21)(p13;q22) translocation, there are only three published examples of insertions which have created an ETV6–RUNX1 fusion—one of material from chromosome 21 into 12p31 and two reporting the reverse.32, 33 Secondary insertional events associated with the fusion include a case with chromosome 3 material inserted into the derived chromosome 12 (der(12)) and four cases in which the reciprocal part of the RUNX1 gene was inserted into chromosomes other than 12.34, 35 The formation of an ETV6–ABL1 fusion by insertion was reported in two cases.36, 37 As for the RUNX1 gene, its involvement in insertions which result in a t(8;21)(q22;q22) translocation, is well established.38, 39
The five cases which are presented here were identified during routine diagnostic interphase FISH screening for the ETV6–RUNX1 fusion.40 Each had a different number of ETV6 signals to that expected. The purpose of the study, performed with FISH and other molecular techniques where possible, was to clarify the role of ETV6 by looking for features that the cases shared.
Materials and methods
Patients
The five patients in this study with a diagnosis of ALL had been entered to one of the Medical Research Council treatment trials—ALL97 or the MRD Pilot Trial for patients aged 1–18 years inclusive. White blood cell (WBC) counts and immunophenotypes were determined locally and the data collected by the Clinical Trial Service Unit in Oxford. The patients were among 2027 tested for ETV6–RUNX1 fusion by FISH.
Cytogenetics
Diagnostic bone marrow samples, obtained with consent, were processed by established short-term culture methods. The fixed cell suspensions were used for conventional chromosomal analysis and for FISH. The cases were initially investigated in the UK regional cytogenetic centres and their findings were then reviewed by the Leukaemia Research Cytogenetics Group (formerly the Leukaemia Research Fund/United Kingdom Cancer Cytogenetics Group Karyotype Database in acute lymphoblastic leukaemia).41 The karyotypes were described according to the International System for Human Cytogenetic Nomenclature.42
FISH
FISH was carried out according to the manufacturers' instructions and 200 interphase nuclei were scored for each sample. The commercial probes used included: LSI TEL/AML1 ES (Vysis Abbott Diagnostics, Maidenhead, UK); split signal probes for ETV6 and TLX3 (Dakocytomation, Glostrup, Denmark); whole chromosome paints (STAR*FISH Human Whole Chromosome-Specific Probes, Cambio, Cambridge, UK); arm specific paints (Qbiogene, California, USA); Multiplex FISH (M-FISH) in combination with the Spectra Vysion 24-color chromosome painting kit (Vysis); centromeric probes (Cambio) and subtelomeric probes (Qbiogene). The non-commercial probes used included: cosmid probes to the ETV6 gene: 179A6 (exon 1), 15A4 (intron 1), 50F4 (exon 2), 132B11 (intron 2), 242E1 (introns 2–3), 163E7 (exon 3-intron 5), 54D5 (exons 5–8), 148B6 (exon 8); YACs: 693F4 (5q33), 802F5 (5q34), 889G5 (5q35); BACs: RP11-210K16, RP11-35O10 (5q34); RP11-15F10, RP11-9I14 (5q35.1); RP11-88L12 (5q35.2); RP11-423H2, RP11-47L17, RP11-26G19, RP11-39H3, RP11-233O11 (5q35.3); RP11-34J24 (7p11 to 7p12); RP11-109N2 (7p13); RP11-243E12, RP11-273L18 (7p14.1); RP11-246L12, RP11-426J23 (7q34) (Sanger Centre, Cambridge, UK).
Array-based comparative genomic hybridization (aCGH) (cases 3912 and 5944)
Test DNA samples were sex-matched with normal genomic reference DNA (Promega, Madison, USA). aCGH was performed according to the manufacturers' instructions.43 Samples were processed with 185K whole genome oligonucleotide arrays and analysed with proprietary software (Agilent Technologies, Santa Clara, California, USA). Preliminary analysis identified statistically significant groups of probes, based on a 2 Mb genomic window size and a z-score beyond 6.0. The aberration detection method 1 (ADM1, Agilent Technologies) algorithm was used for a robust estimation of the position and extent of the aberration, defined as a minimum of five consecutive probes that deviated by
0.25 from a normalized ratio of zero.
Molecular copy-number counting (MCC) (case 3912)
MCC was carried out as described with slight modifications.44 Human male genomic DNA (Promega) was used to determine the working concentration of DNA by making a series of dilutions to give
0.25–8 genomes of DNA per aliquot. Using 96-well plates, a clear copy number change of genomic loci for the PAX5 and MGC39900 genes (two and one copy per genome, respectively), was observed at 0.03 genomes
l-1 (0.09 pg
l-1) of genomic DNA. This concentration was employed for MCC analyses of the patient (data not shown).
Eleven markers in ETV6 intron 2 were chosen according to FISH and aCGH data to screen the genomic region of
42 kb between 11833359 and 11875231 bp on 12p. Three PCR primers were designed for each marker (Table 1). Markers 1–5, with intervals
11 kb apart, were used for the first round of MCC, markers 6–9,
1.7 kb apart, for the second and markers 10 and 11,
500 bp apart, for the third.
Semi-nested PCR assays were performed. The master mix for the first PCR contained
0.09 pg
l-1 of genomic DNA, 0.15
M of each oligo of the external forward and common reverse PCR primers of the chosen markers, 200
M of each dNTP and 1
GoTaq Flexi buffer, 1.5 mM of MgCl2, 0.05 U
l-1 of GoTaq Flexi DNA polymerase (Promega). A 10
l aliquot of this mixture was dispensed into each of 88 wells of a 96-well plate and the same mix but without the DNA, into the remaining 8 wells as negative controls. An MJ PTC-225 Thermal Cycler (MJ Research, Genetic Research Instrumentation Ltd, Braintree, UK) was used for PCR. Reaction conditions were as follows: denaturation at 95 °C for 2 min followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 52 °C for 30 s, extension at 72 °C for 1 min and a final extension for 7 min at 72 °C.
The second PCR was performed with 2
l of each 1st-PCR reaction diluted to 200
l with water. The concentration of reagents was the same as that for the 1st-PCR, except that 0.5
M of each of the oligos of the internal forward and common reverse primers of the chosen markers were used. Thermocycling was identical to that of the 1st-PCR.
Following PCR, 3
l of each 2nd-PCR product was mixed with 2
l of formamide dye mix (98% formamide, 10 mM EDTA/pH 8.0, 0.015% xylene cyanol FF), and loaded into a 192-well horizontal 7.5% polyacrylamide gel (MadgeBio Ltd, Grantham, Lincolnshire, UK). The amplified 2nd-PCR products were separated by electrophoresis for 15 min at 200 V. The gel was stained in 1
SYBR Gold (Invitrogen, Paisley, UK) for 10 min and scanned using a Typhoon Trio Imager (Amersham, UK). The presence or absence of the PCR product in each well was scored using microplate array diagonal gel electrophoresis (MADGE)-specific gel image analysis software (Phoretix Ltd, Newcastle, UK) and MCC data were analysed as described.
Long-distance inverse PCR (LDI–PCR) cloning (case 3912)
LDI–PCR was carried out as previously described,45 using the following PCR primers: first round forward PCR (GGCATTCATTGAATTTGCTG), second round forward PCR/sequencing (GCAACAAGCATCCGTGTC), and common reverse PCR/sequencing (CTGTACTGCTACATCAATG).
Quantitative real-time PCR (qRT-PCR) (case 3912)
Total RNA was isolated from cell pellets and cDNA prepared according to protocol (Promega). mRNA levels of TLX3, RANBP17, NPM1 and ETV6 were assessed using the Taqman gene Expression Assays (Applied Biosystems, Foster City, California, UK) in patient 3912 and in a series of controls according to standard methodologies.46 The control samples included: normal bone marrow, two BCP-cell lines SEM, RCH-ACV and two T-ALL patients, cases 8956 and 11216 (negative controls) and HPB-ALL, a TLX3 overexpressing T-ALL cell line (positive control).
Results
Patient data
The clinical, laboratory and cytogenetic data for the five patients are shown in Table 2. Four patients had BCP-ALL while one had T-ALL. The median age of the patients was four years (range 2–10 years) and the median WBC was 13
109 l-1 (range 4–14
109 l-1).
Table 2 - Clinical, Laboratory and Cytogenetic Data for five patients with an unexpected interphase FISH signal pattern for ETV6.
Interphase FISH
The interphase FISH pattern for the three ETV6–RUNX1 negative patients showed three green signals for the ETV6 gene and two red signals for the RUNX1 gene (Figure 1a). The two fusion positive patients had a single red signal, two green ones and a fusion signal which appeared as a small yellow spot inside a larger red one (Figure 1b).
Figure 1.
FISH analysis. (a) Case 3912: TEL/AML1 ES probe shows three green interphase signals for TEL and two red ones for AML1. (b) Case 6106: TEL/AML1 ES probe shows two green signals for TEL, one red for AML1 and a fusion appearing as a tiny yellow spot inside a larger red one, indicative of an insertion. (c) Case 3912: probe 179A6 to exon 1 (green) and probe 148B6 to exon 8 (red) of ETV6 and wcps for chromosomes 5 (red) and 12 (blue) show part of 12p and probe 179A6 on 5q. (d) case 3912: wcps and subtelomeric probes for chromosomes 5 and 12 show a third copy of the 12p subtelomere on chromosome 5 replacing a 5q subtelomere. (e) case 4008: wcps and subtelomeric probes for chromosomes 7 and 12 show a 7p subtelomere on 12q, a 12p subtelomere on 7p and a 12q subtelomere on 12p (f) case 5944: wcps and subtelomeric probes for chromosomes 7, 9 and 12 show a 7p subtelomere on 12p, a 9p subtelomere on 7p and a12p subtelomere on 9p.
Full figure and legend (197K)Determination of karyotypes
Karyotypes were established by conventional cytogenetics and refined by FISH (Figures 1c–f and Table 2). The karyotypic abnormality in case 3912 was cryptic by conventional cytogenetics. It was revealed when the three ETV6 signals were seen on metaphases (Figure 1c). There were no suitable cells in case 6816 for metaphase FISH.
ETV6 breakpoint analysis
The presence or absence on metaphases of the eight overlapping cosmid probes covering the ETV6 gene is shown in Table 3. It seemed likely that when a chromosome was positive for 132B11 and for 242E1 but negative for 163E7 that the breakpoint in the gene was in the 3' end of intron 2, close to exon 3. In the two fusion positive cases, the 5' breakpoint of the inserted fragment appeared to be in intron 2 in case 6106 and proved to be so in case 6816. The 3' breakpoint was in cosmid 54D5 in both cases.
Table 3 - Presence (shaded) or absence (blank) on metaphase chromosomes of cosmid probes to the ETV6 gene and the subtelomeres involved.
Case 3912
The third interphase ETV6 signal seen in 82% of the nuclei, was produced by the telomeric part of 12p translocated to the long arm of chromosome 5 which extended in a centromeric direction and included at least part of the region covered by the 242E1 cosmid. The two normal copies of chromosome 12 each had signals for the complete set of the eight ETV6 cosmid probes (Figures 1c and d, Tables 2 and 3). A series of ten bacterial artifical chromosome probes (BACs) extending from 5q34 to 5q35.3 showed that 5q had been deleted from 5q35.1 between two probes RP11-15F10 (Mb position 169.07) and RP11-9I14 (Mb position 171.1). The Mb position of TLX3 (170.67) thus fell between them. The telomeric part of the commercial dual colour probe to TLX3 was missing, confirming the deletion.
Interphase FISH with probes to chromosome 12 centromere and yeast artificial chromosome (YAC) 889G5 mapping to 5q35, showed a 10% normal population with two signals for each, a 10–15% population with three signals for 12 centromere and two for the 5q YAC and an
80% population with two signals for 12 centromere and one for the 5q YAC. The same YAC 889G5 was used in conjunction with a Y chromosome centromeric probe. All cells which had lost the Y (
35%) had only one signal for the 5q YAC, whereas those that had retained the Y (
65%), had either one or two signals, proving that the loss of Y was a secondary event.
Array CGH revealed eight copy number changes involving chromosomes 4, 5, 12, 15, 21 and Y, ranging from a 0.07 Mb deletion at 12p11.22 to the loss of the entire Y chromosome. A gain of 12p encompassing the region from 12pter to 12p13 (genomic position 0–11847532 bp) was observed, where the centromeric breakpoint was positioned between array features A_14_P128751 (11847473–11847532 bp) and A_16_P12994461 (11861497–11861556 bp) within intron 2 of ETV6. A loss of 5q35 to 5qter (170677140–180644869 bp) showed that the centromeric breakpoint was 3' (telomeric) of TLX3 (Figures 2a and b). A 1.5 Mb deletion of chromosome band 21q22.12 was observed that resulted in the loss of the 5' telomeric end of RUNX1 (35276320–36793708 bp).
Figure 2.
Molecular analysis of patient 3912. (a) The aCGH profiles (not to scale) for chromosomes 5 and 12. The chromosome idiograms are positioned vertically with the profile shown as a dark line following a log ratio of 0.0 for normal copy number. A deletion of 5q and a duplication of 12p are shown as deviation from this normal ratio value, where the shaded areas define regions of copy number change according to a z-score algorithm. (b) The same aCGH analysis enlarged for the TLX3 gene on chromosome 5 and the ETV6 gene on chromosome 12. The shaded areas of the profiles show the precise regions of copy number change using a mathematical aberration model. (c) MCC analysis refines the position of the breakpoint in ETV6 intron 2, from 11 kb (round 1) to 1.7 kb (round 2) to 0.5 kb (round 3). (d) Alignment of the der(5) breakpoint sequence (middle line) against the normal sequences of chromosome 12 (top line) and 5 (bottom line). (e) Diagram of the normal ETV6 locus (top), the normal TLX3 locus (middle) and the sequences flanking the breakpoint of the der(5) chromosome (bottom). (f) Expression analysis for three genes positioned on 5q. Expression is shown as fold change.
Full figure and legend (253K)The MCC technique used to locate and map the unbalanced der(5)t(5;12)(q35;p13) is based on the fact that nonreciprocal translocations result in a copy number change. The first round of MCC showed a shift in relative copy number between markers 2 (11835489–11835739 bp) and 3 (11854415–11854643 bp), consistent with the aCGH results. A combination of these results located the possible breakpoint within a region of
7 kb (11847533–11854643 bp) in ETV6 intron 2 that was subsequently covered by markers 6–9 for the second round of MCC. These results in their turn revealed a change in copy number between markers 7 (11849014–11849287 bp) and 8 (11850567–11850812 bp), further refining the breakpoint region to within
1.5 kb. The third round of MCC was carried out using the new markers 10 and 11 (located between markers 7 and 8), in addition to all the second round markers. The putative breakpoint was finally located within a
600 bp region between markers 11 (11849895–11850189 bp) and 8 (11850567–11850812 bp) (Figure 2c).
LDI–PCR was then used with primers designed to clone the junction of chromosomes 5 and 12 in the der(5)t(5;12)(q35;p13). The sequence of the second PCR product (
1.4 kb) revealed the fusion of ETV6 (12p13) to LOC391847 (5q35;
40 kb telomeric to TLX3). The genomic location of the breakpoint in ETV6 was at 11 850 627 bp (intron 2; within marker 8), and of that in LOC391847 at 170 675 801 bp (intron 8) (Figures 2d and e).
qRT-PCR showed that TLX3 was highly upregulated in comparison to normal bone marrow both in case 3912 (515.56-fold) and in the HPB-ALL cell line (484.38-fold). In contrast, the two BCP-ALL cell lines (SEM and RCH-ACV) and the two T-ALL patients (cases 8956 and 11216) showed a lower expression of the gene than in normal bone marrow (0.4-, 0.5-, 0.62- and 0.29-fold, respectively).
The expression levels of the upstream RANBP17 and the downstream NPM1 genes located close to TLX3, were also analysed by quantitative PCR. The results showed similar expression levels of RANBP17 and NPM1 in the three T-ALL patients. The expression levels of these two genes were also similar between the three cell-lines analysed, but there was a lower level of RANBP17 and a higher one of NPM1 compared with the patient samples (Figure 2f).
The mRNA levels of ETV6 exons 1–2 and exons 5–6 showed no significant difference as compared with other samples, suggesting that the translocated fragment of ETV6 containing exons 1–2 was not expressed.
Case 4008
The third interphase ETV6 signal, seen in 57% of the nuclei, was the result of an insertion of 12q sequences into the short arm of one copy of chromosome 12, dividing the green signal for ETV6 into two. The part of 12p on the der(7)t(7;12) showed signals for the 12p subtelomere and for cosmid probes extending in a centromeric direction to 242E1. The reciprocal der(12) had no signals for ETV6 exons: whole arm paints demonstrated that 7p material was translocated to 12q while 12p terminated in the 12q subtelomere. The second der(12) had a 12p subtelomeric signal and the signals for the cosmid probes 242E1 to 148B6 split by the insertion (Figure 1e, Tables 2 and 3). Two BAC probes to 7p showed that the breakpoint on chromosome 7 was between 7p12 and 7p13.
Case 5944
The third interphase ETV6 signal, seen in 35% of the nuclei, was due to a translocation between the short arms of chromosomes 7 and 12 with the 7p breakpoint telomeric to 7p14, as FISH showed that the TRG@ gene was intact. Further rearrangements had produced a der(9) chromosome with sequences from 12p, 7p, 7q, 7p, 9p, 9q, 7q and 9q between its short and long arm subtelomeres of which the 12p component extended in a centromeric direction to cosmid probe 242E1 of ETV6. BAC probe RP11-246L12 from 7q34 (including the 5' portion of the TRB@ gene), split the red signal of the ETV6 Dakocytomation probe into two, by its probable insertion into intron 2 of ETV6. Material from 7q was also inserted into the long arm of this der(9). The second copy of chromosome 12 had an interstitial deletion including part of ETV6. (Figure 1f, Tables 2 and 3). One copy of CDKN2A was deleted from 50% of interphase nuclei.
aCGH revealed a 0.078 Mb deletion of chromosome 4q13.2 (genomic position 70305861–70384008 Mb) and a 7.7 Mb deletion of chromosome 9p22.2 (genomic position 19997631–27721327 Mb) for this patient.
Cases 6106 and 6816
The second interphase ETV6 signal in these ETV6–RUNX1 fusion positive patients occurred in 66 and 36% of nuclei, respectively. The inserted 12p fragments appeared roughly equal in size as they extended between the same two cosmids—132B11 and 54D5 (Table 3). The presence of the subtelomeric probe to 21q on the der(21)ins(21;12) in both cases, confirmed that the fusions had occurred by insertion.
Discussion
The five cases in our study each had an unexpected number of signals for the ETV6 gene when the probe defining the ETV6–RUNX1 fusion was applied to interphase cells. The fusion negative cases had three rather than two, while the fusion positive ones had two rather than the one that normally represents the copy of ETV6 not involved in the fusion. In addition, when cosmid probes to ETV6 were applied to metaphases, there appeared to be a break in intron 2 of the gene in each case. The cosmid probes provided a more accurate picture of the actual involvement of the gene than the commercial probe, which was expressly designed to identify the fusion and thus only covered part of the gene and sequences telomeric to it. The cases were rare, occurring among more than 2000 tested, with an incidence of 0.2%.
Although each of the fusion negative cases had three green ETV6 signals at interphase, the mechanisms underlying their formation were different. A duplication of part of the ETV6 gene had occurred in one, a division of the signal into two by an insertion in another and a complex reciprocal translocation in the third. However, one signal in each case was produced by the same 5' cosmid probes of ETV6. In contrast, the second signals in the two fusion positive cases were the result of similar sized insertions into the long arm of chromosome 21, small enough to leave a residual green signal for ETV6 on the short arm of the der(12).
Case 3912 had a third copy of the telomeric region of 12p, terminating in an incomplete copy of ETV6 translocated to 5q. Case 4008 had large deletions of ETV6, and no complete copy of the gene. Only one set of 5' exons was present on 7p and only one of 3' exons on the second 12. The general instability of the whole of chromosome 12 was evident from the insertion of 12q material into 12p and by a 12q telomere on 12p and 7p sequences on 12q. Such radical losses and rearrangements compare with those reported for two cases of acute myelogenous leukaemia (AML).7 Case 5944 had a split in ETV6 suggesting a reciprocal translocation, although the 5' exons attached to 7p had undergone a further translocation with 9p. The visibly deleted second copy of chromosome 12 with an intact 12p telomere, had surprise interstitial deletions from ETV6. A similar unexpected loss of ETV6 exons has been reported in several other cases of ALL.3, 4, 6, 9, 11, 32 aCGH confirmed the balanced nature of the t(7;12) but did not reveal any loss of ETV6. The apparent discrepancy between FISH and aCGH results may have been because of the population size. It has been reported that a 40–50% population is needed for detection of an abnormality with aCGH,46, 47 whereas in our case the population comprised only 35% of the cells. FISH showed a monoallelic deletion of CKDN2A from 50% of interphase cells that was clearly visible by aCGH, in support of this interpretation.
As for the partner chromosomes, the FISH, aCGH and MCC results for the position of the telomeric breakpoint on chromosome 5 were in close accord in case 3912. This case proved an exception in that the unbalanced nature of the translocation allowed MCC to be used for the first time in a haematological malignancy, to define the breakpoints both in intron 2 of ETV6 and on chromosome 5, at the level of the base pairs involved. LDI–PCR was then employed to identify the partner sequences, followed by qRT-PCR to measure the expression of genes that could have been affected by the abnormal apposition of the truncated ETV6 gene to the telomeric region of chromosome 5.
FISH showed that the 7p breakpoint in case 4008 was somewhere between 7p12 and 7p13, but lack of material prevented a finer definition. In case 5944, the 7p breakpoint with 12p was clearly more telomeric, as the TRG@ gene at 7p14.1 was present. The insertion of 5'TRB@ sequences from 7q into the 12p fragment attached to 7p meant that the 5' sequences of ETV6 were probably attached to 7q rather than to 7p.
RT–PCR for case 6816 was negative for the ETV6–RUNX1 fusion, possibly because of the use of inappropriate primers. The intron 2 cosmid was split between chromosomes 12 and 21 indicating that the 5' break was probably closer to exon 2 than in the three fusion negative cases. In case 6106, it was impossible to be certain that the 5' breakpoint was in intron 2, because of the deletion of the exon 2 cosmid. It is plausible that the 5' breakpoints of the inserted fragments might be related to the presence of the alternative exon 1B of ETV6 in intron 2.48 The 3' breakpoint of the inserted fragment was in cosmid 54D5 in both patients, suggesting a location in intron 5, as in the majority of cases with ETV6–RUNX1 fusion.
The apparent rarity of insertions causing ETV6–RUNX1 fusions, may, with hindsight, be due to the difficulty in seeing the fusion when the insertions are as small as we have reported here. Tiny reciprocal constitutional insertions required spectral karyotyping (SKY) and aCGH to define them.49 In haematological malignancies with a t(9;22)(q34;q11) or a t(15;17)(q22;q21) translocation, there were insertions which were microscopically visible and others which needed FISH probes to define them on metaphases.50, 51, 52 Very large insertions associated with the RUNX1–ETO fusion occurred in
8% of positive cases and varied between 2 and 44 megabases in size.38, 39 A case that was positive for ETV6–RUNX1 fusion had an insertion of most of the short arm of chromosome 12 into 21q. Thus the interphase FISH pattern of 1R1G1F/2R1G1F did not suggest anything out of the ordinary. It was only when the probes were located on metaphases that the insertion came to light, indicating that large insertions can also be missed if cells are only examined at interphase.32
Most of the reported cases in which the first two exons of ETV6 were attached to various different partners are single examples. They cover a range of both chronic and acute myeloid and lymphoid malignancies. The t(3;12)(q26;p13) in myeloproliferative disorders involving the MDS1 gene is an exception in that it has been proved to be recurrent. The MDS1 gene was itself fused to EVI1 while a direct fusion between ETV6 and EVI1 has also been reported in the progression of chronic myelogenous leukaemia to myeloid blast crisis.24, 25 Overexpression of EVI1 was proved. Other myeloid examples include a case of myelodysplastic syndrome (MDS) in which the fusion partner was the MDS2 gene at 1p36, with upregulation of the 3' flanking gene RPL11.23 The GOT1 gene at 10q24 was involved in another case of MDS transforming to AML with upregulation of the upstream c10orf gene. Although three cases of AML all had a t(12;13)(p13;q12) with a disrupted ETV6 gene, only one of them showed a direct in-frame fusion between the second exons of ETV6 and CDX2, respectively. Both normal and fusion CDX2 transcripts were detected in this patient.30 The ectopic expression of intact CDX2 rather than the ETV6–CDX2 fusion proved essential for leukaemogenesis.53 Reports of lymphoid malignancies include a B-cell precursor cell line in which the STL gene at 6q23 was the partner26 and a case of paediatric pre-B ALL, the BAZ2 gene at 12q13.29 Our three cases thus add significantly to the lymphoid examples.
The breakpoint in chromosome 5 in case 3912 was located
7 kb downstream of the TLX3 gene, thus leaving it intact. The first description of the recurrent t(5;14)(q35;q32) of T-cell ALL found that most of the breakpoints in chromosome 5 were close and within the RANBP17 gene 10 kb upstream of TLX3, while those in chromosome 14 were widely spread over a 700 kb region downstream of BCL11B. The authors concluded that the ectopic activation of TLX3 rather than the dysregulation of BCL11B was the important consequence of the translocation.54 This explanation was clarified by use of the HPB-ALL cell line which suggested that the ectopic expression of TLX3 was due to elements posited in the 3' region of BCL11B, albeit far downstream of the gene.55 Variant translocations which included a recurrent t(5;7)(q35;q21) with the CDK2 gene involved, as well as insertions or deletions of sequences between the BCL11B and RANBP17/TLX3 loci, all of which resulted in the ectopic expression of TLX3, have provided additional support.56 The most recent research using DNAse1 hypersensitive experiments identified T-lymphoid restricted cis-transcriptional regulatory elements downstream of BCL11B which are juxtaposed to the TLX3 locus as a result of the t(5;14). Thus t(5;14) T-cell ALL provides a novel paradigm for oncogene dysregulation.57, 58
The T-ALL case which we have presented here showed, that as in the recurrent t(5;14)(q35;q32) translocation of T-ALL, the end result of the t(5;12)(q35;p13) was the ectopic expression of TLX3. We were able to demonstrate that TLX3 was as highly upregulated in our patient, as it was in the t(5;14) positive HPB-ALL cell line, when compared to a series of controls. The upstream RANBP17 and the downstream NPM1 genes were not upregulated. In addition, the fact that it was upregulation of TLX3 that was important was emphasized by the fact that we were unable to show expression of the translocated fragment of ETV6.
We have thus provided unequivocal evidence that the truncated ETV6 gene had an upregulatory function in our case. Previous examples have pointed in this direction, but here we have provided the surest proof to date. Upregulation of TLX3 is now known to be central to a significant 20% of T-ALL cases. The positioning of the enhancer/promoter sequences of the ETV6 gene only 165 kb downstream of the promoter of TLX3 in our case must make it the most likely causative agent for the deregulation of the proto-oncogene. The closest reported example is perhaps the upregulation of the intact CDX2 gene, which it was suggested, was the result of it having come under the control of the promoter of ETV6 located in intron 2 of the gene. The authors concluded that activation of proto-oncogenes might be a more common phenomenon in ETV6 associated leukaemia than was previously thought.30, 53 Our case was different in that the promoter in intron 2 was deleted, suggesting that the promoter upstream of exon 1 was the one involved.
In conclusion, this study has added three lymphoid examples to the expanding group of cases involving the first two exons of the ETV6 gene that have generated both negative and positive explanations as to their significance. On the negative side, as the ETV6 component of the fusion lacks both its functional domains, a loss of function rather than a dominant effect has been postulated. To counteract this we have been able to provide overwhelming positive evidence that the promoter region of the gene has induced the ectopic expression of a neighbouring proto-oncogene. We have also added two regions of chromosome 7 to the number of genomic sites that are probably susceptible to the same truncated sequences of ETV6. The two insertion cases involving breakpoints in intron 2 of the gene are the first of similar size to be reported in association with ETV6–RUNX1 fusion. As to whether the frequency of breakpoints in the second intron of the ETV6 gene is the result of structural or biological constraints or merely due to chance is a question that still needs to be addressed.
References
- Kobayashi H, Rowley JD. Identification of cytogenetically undetected 12p13 translocations and associated deletions with fluorescence in situ hybridization. Genes Chromosomes Cancer 1995; 12: 66–69. | Article | PubMed | ChemPort |
- Hoglund M, Johansson B, Pedersen-Bjergaard J, Marynen P, Mitelman F. Molecular characterization of 12p abnormalities in hematologic malignancies: deletion of KIP1, rearrangement of TEL, and amplification of CCND2. Blood 1996; 87: 324–330. | PubMed | ISI | ChemPort |
- Raynaud SD, Cave H, Baens M, Bastard C, Cacheux V, Grosgeorge J et al. The 12;21 translocation involving TEL and deletion of the other TEL allele: two frequently associated alterations found in childhood acute lymphoblastic leukemia. Blood 1996; 87: 2891–2899. | PubMed | ISI | ChemPort |
- Berger R, Le Coniat M, Daniel M-T, Lessard M, Berthou C, Maryen P et al. Chromosome abnormalities of the short arm of chromosome 12 in hematopoietic malignancies: a report including 3 novel translocations involving the ETV6 gene. Leukemia 1997; 11: 1400–1403. | Article | PubMed | ChemPort |
- Takeuchi S, Seriu T, Bartram CR, Golub TR, Reiter A, Miyoshi I et al. TEL is one of the targets for deletion on 12p in many cases of childhood B-lineage acute lymphoblastic leukemia. Leukemia 1997; 11: 1220–1223. | Article | PubMed | ISI | ChemPort |
- Sato Y, Bohlander SK, Kobayashi H, Reshmi S, Suto Y, Davis EM et al. Heterogeneity in the breakpoints in balanced rearrangements involving band 12p13 in hematologic malignancies identified by fluorescence in situ hybridization: TEL (ETV6) is involved in only one half. Blood 1997; 90: 4886–4893. | PubMed | ChemPort |
- Andreasson P, Johansson B, Billstrom R, Garwicz S, Mitelman F, Hoglund M. Fluorescence in situ hybridization analyses of hematologic malignancies reveal frequent cytogenetically unrecognized 12p rearrangements. Leukemia 1998; 12: 390–400. | Article | PubMed | ChemPort |
- Wlodarska I, La Starza R, Baens M, Dierlamm J, Uyttebroeck A, Selleslag D et al. Fluorescence in situ hybridization characterization of new translocations involving TEL (ETV6) in a wide spectrum of hematologic malignancies. Blood 1998; 91: 1399–1406. | PubMed | ISI | ChemPort |
- Sato Y, Kobayashi H, Suto Y, Olney HJ, Davis EM, Super HG et al. Chromosomal instability in chromosome band 12p13: multiple breaks leading to complex rearrangements including cytogenetically undetectable sub-clones. Leukemia 2001; 15: 1193–1202. | Article | PubMed | ISI | ChemPort |
- Odero MD, Carlson K, Calasanz MJ, Lahortiga I, Chinwalla V, Rowley JD. Identification of new translocations involving ETV6 in hematologic malignancies by fluorescence in situ hybridization and spectral karyotyping. Genes Chromosomes Cancer 2001; 31: 134–142. | Article | PubMed | ChemPort |
- Odero MD, Carlson K, Lahortiga I, Calasanz MJ, Rowley JD. Molecular cytogenetic characterization of breakpoints in 19 patients with hematologic malignancies and 12p unbalanced translocations. Cancer Genet Cytogenet 2003; 142: 115–119. | Article | PubMed | ChemPort |
- Vieira L, Marques B, Cavaleiro C, Ambrosio AP, Jorge M, Neto A et al. Molecular cytogenetic characterization of rearrangements involving 12p in leukemia. Cancer Genet Cytogenet 2005; 157: 134–139. | Article | PubMed | ChemPort |
- Bohlander SK. ETV6: a versatile player in leukemogenesis. Semin Cancer Biol 2005; 15: 162–174. | Article | PubMed | ISI | ChemPort |
- Cools J, Mentens N, Odero MD, Peeters P, Wlodarska I, Delforge M et al. Evidence for position effects as a variant ETV6-mediated leukemogenic mechanism in myeloid leukemias with a t(4;12)(q11–q12;p13) or t(5;12)(q31;p13). Blood 2002; 99: 1776–1784. | Article | PubMed | ISI | ChemPort |
- Beverloo HB, Panagopoulos I, Isaksson M, van Wering E, van Drunen E, de Klein A et al. Fusion of the homeobox gene HLXB9 and the ETV6 gene in infant acute myeloid leukemias with the t(7;12)(q36;p13). Cancer Res 2001; 61: 5374–5377. | PubMed | ISI | ChemPort |
- Tosi S, Hughes J, Scherer SW, Nakabayashi K, Harbott J, Haas OA et al. Heterogeneity of the 7q36 breakpoints in the t(7;12) involving ETV6 in infant leukemia. Genes Chromosomes Cancer 2003; 38: 191–200. | Article | PubMed | ChemPort |
- von Bergh AR, van DE, van Wering ER, van Zutven LJ, Hainmann I, Lonnerholm G et al. High incidence of t(7;12)(q36;p13) in infant AML but not in infant ALL, with a dismal outcome and ectopic expression of HLXB9. Genes Chromosomes Cancer 2006; 45: 731–739. | Article | PubMed | ChemPort |
- Cazzaniga G, Daniotti M, Tosi S, Giudici G, Aloisi A, Pogliani E et al. The paired box domain gene PAX5 is fused to ETV6/TEL in an acute lymphoblastic leukemia case. Cancer Res 2001; 61: 4666–4670. | PubMed | ISI | ChemPort |
- Strehl S, Konig M, Dworzak MN, Kalwak K, Haas OA. PAX5/ETV6 fusion defines cytogenetic entity dic(9;12)(p13;p13). Leukemia 2003; 17: 1121–1123. | Article | PubMed | ChemPort |
- Buijs A, Sherr S, van Baal S, van Bezouw S, van der Plas D, Geurts van Kessel A et al. Translocation (12;22) (p13;q11) in myeloproliferative disorders results in fusion of the ETS-like TEL gene on 12p13 to the MN1 gene on 22q11. Oncogene 1995; 10: 1511–1519. | PubMed | ISI | ChemPort |
- Buijs A, Van Rompaey L, Molijn AC, Davis JN, Vertegaal AC, Potter MD et al. The MN1-TEL fusion protein, encoded by the translocation (12;22)(p13;q11) in myeloid leukemia, is a transcription factor with transforming activity. Mol Cell Biol 2000; 20: 9281–9293. | Article | PubMed | ISI | ChemPort |
- Carella C, Bonten J, Rehg J, Grosveld GC. MN1-TEL, the product of the t(12;22) in human myeloid leukemia, immortalizes murine myeloid cells and causes myeloid malignancy in mice. Leukemia 2006; 20: 1582–1592. | Article | PubMed | ISI | ChemPort |
- Odero MD, Vizmanos JL, Roman JP, Lahortiga I, Panizo C, Calasanz MJ et al. A novel gene, MDS2, is fused to ETV6/TEL in a t(1;12)(p36.1;p13) in a patient with myelodysplastic syndrome. Genes Chromosomes Cancer 2002; 35: 11–19. | Article | PubMed | ChemPort |
- Peeters P, Wlodarska I, Baens M, Criel A, Selleslag D, Hagemeijer A et al. Fusion of ETV6 to MDS1/EVI1 as a result of t(3;12)(q26;p13) in myeloproliferative disorders. Cancer Res 1997; 57: 564–569. | PubMed | ISI | ChemPort |
- Nakamura Y, Nakazato H, Sato Y, Furusawa S, Mitani K. Expression of the TEL/EVI1 fusion transcript in a patient with chronic myelogenous leukemia with t(3;12)(q26;p13). Am J Hematol 2002; 69: 80–82. | Article | PubMed | ChemPort |
- Suto Y, Sato Y, Smith SD, Rowley JD, Bohlander SK. A t(6;12)(q23;p13) results in the fusion of ETV6 to a novel gene, STL, in a B-cell ALL cell line. Genes Chromosomes Cancer 1997; 18: 254–268. | Article | PubMed | ISI | ChemPort |
- Yuji K, Mitani K, Ueno H, Sato Y, Ikawa S, Qiao Y et al. A new partner gene of the TEL/ETV6, AF7p15, cloned in acute myeloid leukemia with t(7;12)(p15;p13). Blood 2000; 96: 693a (abstract 2986).
- Janssen H, Wlodarska I, Mecucci C, Hagemeijer A, Vandenberghe P, Marynen P et al. Fusion of ETV6 to GOT1 in a case with myelodysplastic syndrome and t(10;12)(q24;p13). Haematologica 2006; 91: 949–951. | PubMed | ChemPort |
- Panagopoulos I, Strombeck B, Isaksson M, Heldrup J, Olofsson T, Johansson B. Fusion of ETV6 with an intronic sequence of the BAZ2A gene in a paediatric pre-B acute lymphoblastic leukaemia with a cryptic chromosome 12 rearrangement. Br J Haematol 2006; 133: 270–275. | Article | PubMed | ChemPort |
- Chase A, Reiter A, Burci L, Cazzaniga G, Biondi A, Pickard J et al. Fusion of ETV6 to the caudal-related homeobox gene CDX2 in acute myeloid leukemia with the t(12;13)(p13;q12). Blood 1999; 93: 1025–1031. | PubMed | ISI | ChemPort |
- Reddy KS, Yang X, Mak L, Wang S, Johnston M. A child with ALL and ETV6/AML1 fusion on a chromosome 12 due to an insertion of AML1 and loss of ETV6 from the homolog involved in a t(12;15)(p13;q15). Genes Chromosomes Cancer 2000; 29: 106–109. | Article | PubMed | ChemPort |
- Jalali GR, Martineau M, Ford AM, Greaves M, Stevens RF, Harrison CJ. A unique variant of ETV6/AML1 fusion in a child with acute lymphoblastic leukemia. Leukemia 2003; 17: 993–995. | Article | PubMed | ChemPort |
- Poppe B, Cauwelier B, Van LH, Yigit N, Philippe J, Verhasselt B et al. Novel cryptic chromosomal rearrangements in childhood acute lymphoblastic leukemia detected by multiple color fluorescent in situ hybridization. Haematologica 2005; 90: 1179–1185. | PubMed | ISI | ChemPort |
- Douet-Guilbert N, Morel F, Le Bris MJ, Herry A, Le Calvez G, Marion V et al. Translocation (12;21) followed by insertion of chromosome 3 material in the derivative chromosome 12 in a case of childhood acute lymphoblastic leukemia. Cancer Genet Cytogenet 2003; 142: 120–123. | Article | PubMed | ChemPort |
- Mathew S, Shurtleff SA, Raimondi SC. Novel cryptic, complex rearrangements involving ETV6-CBFA2 (TEL-AML1) genes identified by fluorescence in situ hybridization in pediatric patients with acute lymphoblastic leukemia. Genes Chromosomes Cancer 2001; 32: 188–193. | Article | PubMed | ChemPort |
- Andreasson P, Johansson B, Carlsson M, Jarlsfelt I, Fioretos T, Mitelman F et al. BCR/ABL-negative chronic myeloid leukemia with ETV6/ABL fusion. Genes Chromosomes Cancer 1997; 20: 299–304. | Article | PubMed | ChemPort |
- Meyer-Monard S, Muhlematter D, Streit A, Chase AJ, Gratwohl A, Cross NC et al. Broad molecular screening of an unclassifiable myeloproliferative disorder reveals an unexpected ETV6/ABL1 fusion transcript. Leukemia 2005; 19: 1096–1099. | Article | PubMed | ISI | ChemPort |
- Gamerdinger U, Teigler-Schlegel A, Pils S, Bruch J, Viehmann S, Keller M et al. Cryptic chromosomal aberrations leading to an AML1/ETO rearrangement are frequently caused by small insertions. Genes Chromosomes Cancer 2003; 36: 261–272. | Article | PubMed | ChemPort |
- Specchia G, Albano F, Anelli L, Zagaria A, Liso A, La SR et al. Insertions generating the 5'RUNX1/3'CBFA2T1 gene in acute myeloid leukemia cases show variable breakpoints. Genes Chromosomes Cancer 2004; 41: 86–91. | Article | PubMed | ChemPort |
- Harrison CJ, Moorman AV, Barber KE, Broadfield ZJ, Cheung KL, Harris RL et al. Interphase molecular cytogenetic screening for chromosomal abnormalities of prognostic significance in childhood acute lymphoblastic leukaemia: a UK Cancer Cytogenetics Group Study. Br J Haematol 2005; 129: 520–530. | Article | PubMed |
- Harrison CJ, Martineau M, Secker-Walker LM. The Leukaemia Research Fund/United Kingdom Cancer Cytogenetics Group Karyotype Database in acute lymphoblastic leukaemia: a valuable resource for patient management. Br J Haematol 2001; 113: 3–10. | Article | PubMed | ChemPort |
- ISCN. An International System for Human Cytogenetic Nomenclature, 1st edn. S. Karger: Basel, 1995.
- Barrett MT, Scheffer A, Ben-Dor A, Sampas N, Lipson D, Kincaid R et al. Comparative genomic hybridization using oligonucleotide microarrays and total genomic DNA. Proc Natl Acad Sci USA 2004; 101: 17765–17770. | Article | PubMed | ChemPort |
- Daser A, Thangavelu M, Pannell R, Forster A, Sparrow L, Chung G et al. Interrogation of genomes by molecular copy-number counting (MCC). Nat Methods 2006; 3: 447–453. | Article | PubMed | ChemPort |
- Willis TG, Jadayel DM, Coignet LJ, Abdul-Rauf M, Treleaven JG, Catovsky D et al. Rapid molecular cloning of rearrangements of the IGHJ locus using long-distance inverse polymerase chain reaction. Blood 1997; 90: 2456–2464. | PubMed | ISI | ChemPort |
- Strefford JC, van Delft FW, Robinson HM, Worley H, Yiannikouris O, Selzer R et al. Complex genomic alterations and gene expression in acute lymphoblastic leukemia with intrachromosomal amplification of chromosome 21. Proc Natl Acad Sci USA 2006; 103: 8167–8172. | Article | PubMed | ChemPort |
- Hosoya N, Sanada M, Nannya Y, Nakazaki K, Wang L, Hangaishi A et al. Genomewide screening of DNA copy number changes in chronic myelogenous leukemia with the use of high-resolution array-based comparative genomic hybridization. Genes Chromosomes Cancer 2006; 45: 482–494. | Article | PubMed | ChemPort |
- Baens M, Peeters P, Guo C, Aerssens J, Marynen P. Genomic organization of TEL: the human ETS-variant gene 6. Genome Res 1996; 6: 404–413. | Article | PubMed | ISI | ChemPort |
- Matthaei A, Werner W, Gerlach EM, Koerner U, Tinschert S, Nitz I et al. Small reciprocal insertion detected by spectral karyotyping (SKY) and delimited by array-CGH analysis. Eur J Med Genet 2005; 48: 328–338. | Article | PubMed |
- Aurich J, Dastugue N, Duchayne E, Schlaifer D, Rigal-Huguet F, Caballin MR. Location of the BCR-ABL fusion gene on the 9q34 band in two cases of Ph-positive chronic myeloid leukemia. Genes Chromosomes Cancer 1997; 20: 148–154. | Article | PubMed | ChemPort |
- Grimwade D, Biondi A, Mozziconacci MJ, Hagemeijer A, Berger R, Neat M et al. Characterization of acute promyelocytic leukemia cases lacking the classic t(15;17): results of the European Working Party. Groupe Francais de Cytogenetique Hematologique, Groupe de Francais d'Hematologie Cellulaire, UK Cancer Cytogenetics Group and BIOMED 1 European Community-Concerted Action 'Molecular Cytogenetic Diagnosis in Haematological Malignancies'. Blood 2000; 96: 1297–1308. | PubMed | ISI | ChemPort |
- Robinson HM, Martineau M, Harris RL, Barber KE, Jalali GR, Moorman AV et al. Derivative chromosome 9 deletions are a significant feature of childhood Philadelphia chromosome positive acute lymphoblastic leukaemia. Leukemia 2005; 19: 564–571. | Article | PubMed | ChemPort |
- Rawat VP, Cusan M, Deshpande A, Hiddemann W, Quintanilla-Martinez L, Humphries RK et al. Ectopic expression of the homeobox gene Cdx2 is the transforming event in a mouse model of t(12;13)(p13;q12) acute myeloid leukemia. Proc Natl Acad Sci USA 2004; 101: 817–822. | Article | PubMed | ChemPort |
- Bernard OA, Busson-LeConiat M, Ballerini P, Mauchauffe M, Della VV, Monni R et al. A new recurrent and specific cryptic translocation, t(5;14)(q35;q32), is associated with expression of the Hox11L2 gene in T acute lymphoblastic leukemia. Leukemia 2001; 15: 1495–1504. | Article | PubMed | ISI | ChemPort |
- MacLeod RA, Nagel S, Kaufmann M, Janssen JW, Drexler HG. Activation of HOX11L2 by juxtaposition with 3'-BCL11B in an acute lymphoblastic leukemia cell line (HPB-ALL) with t(5;14)(q35;q32.2). Genes Chromosomes Cancer 2003; 37: 84–91. | Article | PubMed | ISI | ChemPort |
- Su XY, Busson M, Della VV, Ballerini P, Dastugue N, Talmant P et al. Various types of rearrangements target TLX3 locus in T-cell acute lymphoblastic leukemia. Genes Chromosomes Cancer 2004; 41: 243–249. | Article | PubMed | ISI | ChemPort |
- Su XY, la-Valle V, ndre-Schmutz I, Lemercier C, Radford-Weiss I, Ballerini P et al. HOX11L2/TLX3 is transcriptionally activated through T-cell regulatory elements downstream of BCL11B as a result of the t(5;14)(q35;q32). Blood 2006; 108: 4198–4201. | Article | PubMed | ChemPort |
- Nagel S, Scherr M, Kel A, Hornischer K, Crawford GE, Kaufmann M et al. Activation of TLX3 and NKX2-5 in t(5;14)(q35;q32) T-cell acute lymphoblastic leukemia by remote 3'-BCL11B enhancers and coregulation by PU.1 and HMGA1. Cancer Res 2007; 67: 1461–1471. | Article | PubMed | ChemPort |
Acknowledgements
We thank Marina Lafage-Pochitaloff and David Grimwade for helpful discussion and Dr Peter Marynen for the ETV6 cosmid probes. This work was supported by Leukaemia Research UK.
MORE ARTICLES LIKE THIS
These links to content published by NPG are automatically generated
RESEARCH
Leukemia Original Article
Leukemia Original Article
Leukemia Original Article
E2A-ZNF384 and NOL1-E2A fusion created by a cryptic t(12;19)(p13.3; p13.3) in acute leukemia
Leukemia Original Article
