Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Letter to the Editor
  • Published:

Hypermethylation of TTC12 gene in acute lymphoblastic leukemia

Leukemia volume 21, pages 2370–2373 (2007)Cite this article

11q23 may house several genes that are important for the process of leukemogenesis. Structural aberrations involving 11q are among the most common aberrations in a number of hematological malignancies and often harbor a breakpoint at 11q23.1 One of the common aberrations is deletion, that is associated with a poor clinical outcome.2 Chromosome deletion suggests that the region might contain at least a tumor suppressor gene important for the genesis of lymphoproliferative disorders.3, 4 Investigating cancer-specific methylation is a preferential approach for identifying genes that are important in cancer development.5 There have been few reports regarding methylation involving 11q23 in leukemia. Therefore, we further investigated whether, in leukemia, there exists a gene that is controlled by the epigenetic modification in this region.

We investigated if TTC12 methylation is directly correlated with the inhibition of expression in leukemia. Hypermethylation was demonstrated in all leukemic cells, except K562, (Figure 1b). In contrast, epithelial cells were not methylated (Figure 1b). The cDNA was amplified by PCR and real-time PCR with the TTC12-RT primers, TGGGCGAATCAGGGATTCC and GCATTCATCCTCCTCCTGGT, and the GAPDH primers, GTGGGCAAGGTATCCCTG and GATTCAGTGTGGTGGGGGAC. GAPDH was used as control and to calculate the relative quantity of TTC12 mRNA. Non-methylated and hypermethylated cell lines expressed and did not express TTC12 mRNA levels, respectively (Figure 1b).

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Figure 1
Figure 2

References

  1. Rowley JD . Rearrangements involving chromosome band 11Q23 in acute leukaemia. Semin Cancer Biol 1993; 4: 377–385.

    CAS  PubMed  Google Scholar 

  2. Pui CH, Chessells JM, Camitta B, Baruchel A, Biondi A, Boyett JM et al. Clinical heterogeneity in childhood acute lymphoblastic leukemia with 11q23 rearrangements. Leukemia 2003; 17: 700–706.

    Article  CAS  Google Scholar 

  3. Monni O, Knuutila S . 11q deletions in hematological malignancies. Leuk Lymphoma 2001; 40: 259–266.

    Article  CAS  Google Scholar 

  4. Green AR . Chromosomal deletions in haematological malignancies. Lancet 1993; 341: 1567–1568.

    Article  CAS  Google Scholar 

  5. Galm O, Herman JG, Baylin SB . The fundamental role of epigenetics in hematopoietic malignancies. Blood Rev 2006; 20: 1–13.

    Article  CAS  Google Scholar 

  6. Eads CA, Laird PW . Combined bisulfite restriction analysis (COBRA). Methods Mol Biol 2002; 200: 71–85.

    CAS  PubMed  Google Scholar 

  7. Herman JG, Merlo A, Mao L, Lapidus RG, Issa JP, Davidson NE et al. Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res 1995; 55: 4525–4530.

    CAS  PubMed  Google Scholar 

  8. Katoh M, Katoh M . Identification and characterization of TPARM gene in silico. Int J Oncol 2003; 23: 1213–1217.

    CAS  PubMed  Google Scholar 

  9. Riley RS, Massey D, Jackson-Cook C, Idowu M, Romagnoli G . Immunophenotypic analysis of acute lymphocytic leukemia. Hematol Oncol Clin N Am 2002; 16: 245–299, v.

    Article  Google Scholar 

Download references

Acknowledgements

This work was supported by the Thailand Research Fund and Chulalongkorn University. We thank Drs Chintana Chirathaworn, Virote Sriuranpong, Silvio Gutkind and Watchara Kasinrerk for cell lines. We also express our gratitude to the Department of Pediatrics for patients' samples and clinical information.

Author information

Authors and Affiliations

  1. Department of Anatomy, Molecular Biology and Genetics of Cancer Development Research Unit, Chulalongkorn University, Bangkok, Pratumvan, Thailand

    R Wattanawaraporn & A Mutirangura

  2. Department of Pediatrics, Chulalongkorn University, Bangkok, Pratumvan, Thailand

    T Singhsilarak & I Nuchprayoon

Authors
  1. R Wattanawaraporn
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. T Singhsilarak
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. I Nuchprayoon
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. A Mutirangura
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to A Mutirangura.

Rights and permissions

Reprints and permissions

About this article

Cite this article

Wattanawaraporn, R., Singhsilarak, T., Nuchprayoon, I. et al. Hypermethylation of TTC12 gene in acute lymphoblastic leukemia. Leukemia 21, 2370–2373 (2007). https://doi.org/10.1038/sj.leu.2404876

Download citation

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/sj.leu.2404876

Search

Advanced search

Quick links