Introduction
Major histocompatibility complex (MHC) class II molecules play a central role in the immune response through the presentation of antigens to CD4+ T lymphocytes.1 Constitutive expression of MHC class II molecules is restricted to professional antigen-presenting cells (APCs), including B lymphocytes, dendritic cells and macrophages. In most other cell types, interferon-gamma (IFN-
) can, however, induce MHC class II expression.2
HLA-D gene expression is mainly regulated at the transcriptional level by four conserved cis-acting promoter elements termed W, X1, X2 and Y boxes.2,3 These DNA motifs are the binding sites for the transcription factors regulatory factor binding to the X box (RFX), nuclear factor Y and cyclic-AMP response element-binding protein (CREB).4,5 An additional protein, the Class II Trans-Activator (CIITA),6 is essential to the formation of a functional transcriptional complex. Indeed, CIITA creates a scaffold through its interaction with the above-mentioned transcription factors,7 with histone transacetylases like p300/CREB-binding protein (CBP) and pCAF,8,9 and with components of the transcription initiation and elongation machinery.10,11
In addition, CIITA controls the tissue-specific expression of HLA-D genes12,13 through the alternative usage of at least three distinct promoters present in its encoding gene, MHC2TA. Promoter I regulates the constitutive expression of MHC2TA in dendritic cells, promoter III is used in B lymphocytes and promoter IV responds to IFN-
in the other cell types.14,15 This tissue-specific usage of promoters leads to the generation of three isoforms of CIITA differing in their amino-terminal extremities.16,17
MHC class II deficiency is a hereditary disease leading to a severe immunodeficiency, currently named the bare lymphocyte syndrome (BLS).18 Genetic complementation analysis carried out with patient-derived BLS cell lines has defined four complementation groups (groups A–D).19 Cell lines from complementation groups B, C and D display mutations in RFXANK,20 RFX521 and RFXAP,22 respectively, the three subunits of the RFX heterotrimer. Group A patients present mutations in CIITA.6,23
Defects in MHC class II expression have also been observed in various tumor cell lines. Indeed, complete or partial loss of cell-surface expression of these molecules was evidenced in small-cell lung cancers,24 non-small-cell lung cancers, neuroblastoma,25 cervical carcinoma and retinoblastoma cell lines,26 pancreatic tumors,27 fibrosarcoma28 or in choriocarcinoma.29 Interestingly in all these cell lines or tumor cells, MHC class II defects result from an altered transcription of MHC2TA.
The consequences of MHC class II loss are not clear when considering tumor cells originating from non-APCs. However the disappearance of MHC class II expression in tumors cells from APCs, like B-cell lymphoma, is considered as an immune escape mechanism.30 Indeed, lymphoma lacking HLA-DR expression are less immunogenic and consequently more tumorigenic.31,32 It is therefore essential to delineate the molecular events leading to the loss of MHC class II expression in these tumor cells.
We report here about a human B lymphoma cell line, Rec-1, with a defective MHC class II expression. Like cell lines from patients with MHC class II deficiency, this lymphoma cell line displays an altered HLA-D gene transcription. Genetic complementation with BLS cell lines further demonstrated that the Rec-1 cell line belongs to group A, thereby suggesting a defect in MHC2TA. Accordingly, CIITA transcript and protein amounts are highly residual in this cell line. This analysis therefore shows that like all non-APC-originating tumors lacking MHC class II expression, the Rec-1 cell line is defective for MHC2TA transcription. However, this is the first evidence of a defect in the CIITA-encoding gene affecting its expression in a tumor cell line.
Materials and methods
Clinical case
A 61-year-old man presented with fatigue, dysphagia and enlarged lymph nodes. Physical examination showed bilateral cervical and left inguinal lymphadenopathy. The right tonsil was markedly enlarged. A chest tomography (CT) scan disclosed moderate para-aortic and iliac lymphadenopathy. Biopsy of the cervical mass revealed a diffuse lymphoma of B-cell lineage, which was classified as mantle cell lymphoma, blastoid variant. The karyotype of the tumor cells was complex: 45,xy, del(1)(p21p31), t(2;16)(q24;q24), der(8)t(8;11)(p11;q13), add(9)(q32), add(9)(p21), der(12)t(8;12)(q11;p12), del(13)(q32), der(14)t(11;14)(q13;q32), del(17)(q22), i(18q), del(18)(q21),-22 [cp18]. Bone marrow aspiration and biopsy were normal. The LDH level was 265 U/ml. A chemotherapy according to the GELA LNH-8433 regimen was administered and a complete remission was obtained after the induction phase. After 1 month, as the consolidation phase begun, new cervical lymphadenopathy and a splenomegaly appeared. Biopsy of the cervical lymph node showed a diffuse large B-cell lymphoma. A salvage treatment failed to obtain a response and lymphoma blastoid cells disclosing a nearly identical karyotype appeared in the peripheral blood. The patient died a few weeks later. The Rec-1 cell line spontaneously originate from this blood sample. The presence of a t(11;14)(q13;q32) confirming the mantle cell origin of the cell line was later confirmed using molecular methods: the cell line discloses a BCL-1–JH MTC (major translocation cluster)34 translocation and over-expresses cyclin D1.
Cell lines
The B-cell lymphoma Raji cell line, expressing MHC class II molecules, is used here as a positive control. RJ2.2.5 is a variant of the Raji cell line obtained by mutagenesis and defective for MHC2TA.35 The COM cell line is a B lymphocyte cell line (B-LCL) immortalized with Epstein-Barr virus (EBV) established from a MHC class II-expressing controls. The BCH, ZAL and THF cell lines are B-LCLs established by EBV transformation from patients with MHC class II deficiency. They belong to groups A,6 B36 and C,21 respectively. BCH and ZAL cells were kindly provided by B Lisowska-Grospierre (INSERM U429, Necker Hospital, Paris), and the THF cell line was a kind gift from P van den Elsen (Leiden University Medical Center, The Netherlands). The RS4,11 cell line is from a pre-B leukemia. The cervical carcinoma HeLa cell line is from the ATCC.
The Raji, HeLa, COM, RJ2.2.5 and RS4,11 cell lines were grown in RPMI 1640 supplemented with 10% fetal calf serum (FCS), antibiotics and 2 mM glutamine under standard conditions. For the BCH, ZAL, THF and Rec-1 cell lines, FCS was replaced by 10% Myoclone serum (Invitrogen Life Technologies, Cergy Pontoise, France).
Flow cytometric analyses
Indirect immunofluorescence assays were carried out with a FACScan (Becton Dickinson Biosciences, Mountain View, CA, USA) using the Cell Quest program. The primary monoclonal antibodies (mAbs) were L243 (Becton-Dickinson), B7/2137 and SPV-L3 (Immunotech, Marseille, France), respectively, directed against membrane HLA-DR, DP and DQ antigens. Human membrane MHC class I antigens were detected with the W6/32 mAb (Serotec, Oxford, UK). Cell labeling was then performed with an anti-mouse Ig FITC-coupled (Biosys, Compiègne, France). Phenotyping of the Rec-1 cell line (Table 1) was performed as described previously.31
Table 1 - Cell-surface expression of different markers assayed by flow cytofluorometry on the Rec-1 cell line.
Reverse transcriptase-polymerase chain reaction (RT-PCR)
Total RNA was isolated from subconfluent cultures with RNeasy (Qiagen, Valencia, CA, USA) following the instructions of the manufacturer. cDNA preparation was performed on 1
g of total RNA with 100 ng poly-dT (Roche, Meylan, France) and 2.5 U of Omniscript reverse transcriptase (Qiagen). PCR was performed with the Taq polymerase (Qiagen) following the instructions of the manufacturer. Quantification of cDNA concentrations was further assessed with GAPDH-specific primers (sense (S): 5'-GTCGTATTGGGCGCCTGGTCAC-3'; anti-sense (AS): 5'-CACGACGTACT CAGCGCCAGCA-3') through a 19-cycle PCR in a PTC 200 thermocycler (MJ Research, San Francisco, CA, USA).
The primers used to study gene expression of HLA-D and DHLAG, encoding the invariant chain, were as follows: HLA-DRA (S: 5'-TGGGAGTTTGATGTCCCAAG-3'; AS: 5'-AACATCATCACCTCCATGTG-3'), HLA-DRB (S: 5'-CAGCATTRAAGTCAGGTGGTTCC-3'; AS: 5'-CTCAGCATCTTGCTCTGTGCAG-3'), HLA-DQA (S: 5'-GTGCTGCAGGTGTAAACTTGTACCAG-3'; AS: 5'-CACGGATCCGGTAGCAGCGGTAGAGTTG-3'), HLA-DQB (S: 5'-CGAGTACTGGAAYAGCCAGAAGG-3'; AS: 5'-GGAGTCATTTCCAGCATCACCAGG-3'); HLA-DPA (S: 5'-GGAGACCGTCTGGCATCTGGA-3'; AS: 5'-CTCTCAGCGACACCCTCAGT-3'); HLA-DPB (S: 5'-GGGACACAGCGCTTCCTGGAG-3'; AS: 5'-CAAGCAGGTTGTGGTGCTGCA-3'); HLA-DMA (S: 5'-GGTTGGCTGGGTTGGTAGC-3'; AS: 5'-GCTGGCATCAAACTCTGGT-3'); HLA-DMB (S: 5'-ATCTTTACAGAGCAGAGCAT-3'; AS: 5'-CCTTCTCACTTGGAGTGGA-3'); HLA-DNA (S: 5'-ACCAGATGCCATGGAGACCC-3'; AS: 5'-CCTGCCATGAATACTGGGGCC-3'); HLA-DOB (S: 5'-GGCTGACTGTTACTTCACCA-3'; AS: 5'-GCTGGTGCAGGAGTGGGGAC-3'); DHLAG (S: 5'-GGATGACCAGCGCGACCTT-3'; AS: 5'-CCAGATCCTGCTTGGTCAC-3').
Analysis of total CIITA transcript expression was performed with 28-cycle amplifications at a 59°C annealing temperature (S: 5'-TTTCTGGGCACCCGCCTCAC-3'; AS: 5'-CTGGGGGAAGGTGGCTGAGA-3'). Promoter III-specific transcripts of CIITA were amplified using the following primers: S, 5'-GGAATTCCA GACTCCGGGAGCTGCTGC-3'; AS, 5'-TGCTGAACTGGTCGCAGTTGATGG-3'. Primers amplifying promoter IV-specific transcripts of CIITA were: S, 5'-GGAATTCCCAGAGCTGGCGGGAGGGA-3'; AS, 5'-TGCTGAACTGGTCGCAGTTGATGG-3'. Stability of the CIITA transcript was assayed using 100
M of the transcription inhibitor DRB (5,6-dichlorobenzimidazole 1-
-D-ribofuronoside) from Sigma-Aldrich (Saint-Quentin Fallavier, France).
The study of genes regulated by CIITA in lymphoma was performed with the following primers: YARS, S: 5'-CAACCAGATGAGGAGCTCAAGC-3'; AS: CAGGAAATGGAGCCCAGCTTG (30-cycle amplification); EIF3S2, S: 5'-GCAACATCA TCATGTTCTCCAC-3', AS: 5'-CAGGACCACATGGTCATAGTTG-3' (26-cycle amplification).
Cell fusions
At 2 days before the fusion, BLS cell lines were depleted from L243-positive cells (caused either by reversion of the phenotype or nonspecific binding of the antibody) through cell sorting using anti-mouse Ig coupled to magnetic beads (Dynal, Great Neck, NY, USA) as described previously.38.Cell fusions were performed with 107 cells of each fusion partner using PEG 4000 (Merck, Strasbourg, France). As a control, homokaryons were prepared with each fusion partner in order to assess the complete lack of MHC class II-positive cells. After fusion, cells were cultured in RPMI 1640 supplemented with 10% Myoclone serum during 48 h. Indirect immunofluorescence analysis was then performed on cells incubated with the anti-HLA-DR L243 mAb. Cells were analyzed under a fluorescence microscope without any permeabilization step of the cells.
Immunoprecipitation and western blot of CIITA
Immunoprecipitation was performed with a polyclonal rabbit anti-human CIITA directed against a peptide (726GEIKDKELPQYLALTR741) described by Zhou et al.39 Western blots were performed with the mAb anti-human CIITA clone 7-1 H (R&D Systems, Lille, France). Cells were lyzed in high salt buffer (10 mM HEPES pH 7.9, 0.4 M NaCl, 1.5 mM MgCl2, 0.1 mM EGTA, 5% glycerol) containing 0.5% Nonidet P-40 (NP-40; Sigma). Lysates were cleared for 2 h with protein-G–Sepharose (Amersham Biosciences), and CIITA proteins were next immunoprecipitated overnight with 2.5
g of affinity-purified polyclonal anti-CIITA antibodies per sample. Immune complexes were recovered by binding for 30 min to protein-G–Sepharose, resolved on a 6% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and adsorbed onto a nitrocellulose membrane (Hybond ECL, Amersham Biosciences). Blocking was performed overnight in PBS-Tween buffer containing 2.5% low-fat dry milk. Incubation with 1.5
g/ml of mAb anti-CIITA was carried out for 1 h at 4°C in PBS-Tween buffer containing 0.25% low-fat dry milk. Immunoreactive bands were visualized with the ECL-Plus Western blotting system (Amersham-Pharmacia Biotech).
Sequencing
Amplification of the 5' (nt. 107–2188) part of the MHC2TA cDNA was performed with the sense 20S primer (5'-TCCTACACAATGCGTTGCCTG-3') and the antisense TAR3 primer (5'-CTAAGCCTTTGGCCATCGCC-3'). The 3' part of the cDNA (nt. 2142–3591) was amplified with the sense primer TAF4 (5'-AGGAGGACCAGT TCCCATCC-3') and the antisense TAR5 (5'-GAGCTGTGTCCACAAGTACC-3'). Sequencing was next carried out on both strands using primers (whose sequences are available on request) covering the whole coding sequence by the Big Dye Terminator cycle sequencing (Perkin-Elmer Applied Biosystem, Norwalk, CT, USA) using an ABI 377 automatic sequencer (Perkin-Elmer).
Untranslated 5' sequences of the CIITA cDNA were amplified with the pIII-CIITA-sense primer (5'-GGAATTCCAGACTCCGGGAGCTGCTGC-3') (nt +92–119 from the transcription initiation site14) and the antisense CM20 primer (5'-TGCTG-AACTGGTCGCAGTTGATGG-3'), which hybridizes to nt. 330–353 following the numbering from Genbank (accession number: X74301). Nucleotide sequencing was performed using the same primers.
In vitro mutagenesis and transfection
Site-specific mutagenesis was performed on a wild-type CIITA cDNA, subcloned in the IRES-Neo vector (Clontech Laboratories, Palo Alto, CA, USA). It was performed with the Quick Change Site-directed Mutagenesis kit (Stratagene, La Jolla, CA, USA) following the instructions of the manufacturer, and using primers encompassing nt. 2440–2476 and carrying the C2457 T and T2460C substitutions. Nucleotide sequencing assessed that the substitutions were introduced in the cDNA. HeLa cells were transfected by electroporation using 20
g of plasmid construct with 975
F, 300 V and 200
conditions, using an ECM 630 electroporator (BTX-Genetronics, San Diego, CA, USA). G418-resistant transfected cells were selected prior to the analysis of HLA-DR cell-surface expression.
Results
B-cell lymphoma cell line Rec-1 is defective for cell-surface expression of MHC class II isotypes
Indirect immunofluorescence analysis of the Rec-1 cell line revealed that none of the MHC II isotypes (HLA-DR, -DP and -DQ) are expressed at its cell surface (Figure 1). A similar observation was made with the RJ2.2.5 B lymphoma cell line presenting a defect in MHC2TA.6 In contrast, the B lymphoma cell line Raji used as a positive control expresses high levels of cell-surface MHC class II molecules. As observed in several BLS and lymphoma cell lines,40 Rec-1 cells additionally present a reduced expression of the HLA-A, -B and -C antigens compared to the positive control.
Figure 1.
Flow cytometric analysis of cell-surface expression of MHC class I and class II molecules in the Rec-1 cell line. The Raji and the MHC2TA-defective RJ2.2.5 B lymphoma cell lines were used, respectively, as positive and negative controls for the expression of the HLA-DR, -DP and -DQ isotypes, respectively, detected with the L243, B7/21 and SPV-L3 mAbs (gray curves). MHC class I expression was analyzed with the W6/32 mAb that recognizes all three HLA-A, -B and -C isotypes. White curves represent cells incubated with the secondary FITC-labeled antibody.
Full figure and legend (103K)Phenotyping of the Rec-1 cell line (Table 1) evidenced the expression of CD19, CD20 and cell-surface IgM and IgD. These data therefore assess that the lack of MHC class II expression in this cell line is neither related to a pro-B state of differentiation, where HLA-D genes are not expressed2 nor to a terminal plasma phenotype where HLA-D gene expression is extinguished.41 Characterization with additional cell-surface markers (Table 1), and the detection of a t(11;14)(q13;q32) translocation (data not shown) further indicate that the Rec-1 lymphoma cells originate from mature B lymphocytes and have a mantle origin.
Rec-1 cell line is defective for the transcription of HLA-D genes
To identify the molecular causes of the absence of the MHC class II molecules in the Rec-1 cell line, HLA-D gene transcription was studied by RT-PCR. The BCH cells are an EBV-established B-LCL derived from a BLS patient defective for MHC2TA. The positive control, COM, is an unrelated B-LCL expressing MHC class II molecules. As seen in Figure 2, HLA-D gene transcription in the Rec-1 cell line is strongly impaired. The residual expressions of HLA-DRA, -DRB, -DQA, -DMA, -DOA and -DOB detected in the Rec-1 cells further assess that the HLA-D locus is not deleted. These data evidence a transcriptional defect of the HLA-D genes in the Rec-1 cell line, thereby resembling cell lines from patients with MHC class II deficiency.
Figure 2.
Analysis of HLA-D and DHLAG (encoding the invariant chain) gene transcription assayed by RT-PCR in the Rec-1 cell line. The COM and BCH B-LCLs are used here as positive and negative controls, respectively. Normalization of cDNA amount was performed through a 19-cycle PCR with GAPDH-specific primers prior to the experiment.
Full figure and legend (73K)Rec-1 cell line belongs to the BLS group A
Genetic complementation was performed by cell fusion of the Rec-1 cell line with BLS cells from groups A (BCH), B (ZAL) and C (THF), respectively, mutated in MHC2TA, RFXANK and RFX5. Heterokaryons were analyzed by indirect immunofluorescence for the cell-surface expression of HLA-DR molecules. As a control, homokaryons were prepared with each fusion partner in order to assess the lack of residual HLA-DR expression or nonspecific binding of the antibody.
The data displayed in Table 2 summarize the results from at least three independent experiments. The fusion between the Rec-1 cell line and BLS cell lines from groups B and C leads to heterokaryons expressing HLA-DR, thereby showing that Rec-1 is not defective for RFXANK or RFX5. This additionally shows that this cell line does not express a dominant repressor of HLA-D gene expression. In contrast, heterokaryons generated by the fusion of Rec-1 and BCH cell lines do not display any HLA-DR cell-surface expression. This demonstrates that the Rec-1 lymphoma cell line belongs to BLS group A, thereby suggesting (a) mutation(s) in both alleles of MHC2TA.
Nucleotide sequencing of the Rec-1 CIITA cDNA
Nucleotide sequencing of the CIITA cDNA isolated from the Rec-1 cell line was performed. Homozygous G2446 T (S777) and G2680A (A855), in addition to heterozygous C3286 T (C1057) silent substitutions, were observed. A heterozygous conservative substitution (A500G) results from a C1614G mutation. The insertion of a TAG codon at nt. 472 was additionally detected. However, this insertion has been previously described in unrelated cell lines and was shown not to affect CIITA activity.42 Finally, two homozygous mutations were found at positions C2457 T and T2460C, leading to S781L and V782A substitutions. To assay the consequences of their presence in the cDNA, we reproduced both substitutions by site-directed mutagenesis. Mutant and wild-type cDNAs were next stably transfected in the HeLa cell line, and cell-surface HLA-DR expression was assayed on the G418-resistant transfected cells. However, flow cytometric analysis did not reveal any major difference between the wild-type and double mutant constructs in their capacity to restore MHC class II expression (Figure 3).
Figure 3.
Functional complementation of the HeLa cell line with the in vitro-mutagenized CIITA cDNA construct containing the C2457 T and T2460C substitutions. HeLa cells were transfected with either the empty IRES-Neo expression vector, with the wild-type CIITA cDNA subcloned in IRES-Neo (wt CIITA-IRES) or with the double C2457T/T2460C mutant. G-418-resistant cells were analyzed by flow cytometry for cell-surface expression of HLA-DR with the L243 mAb. MFI: medium intensity of fluorescence.
Full figure and legend (87K)In addition, sequencing of the region upstream the translation initiation site of the CIITA cDNA did not reveal any mutation. Based on these data, we can conclude that both alleles of MHC2TA are expressed in the Rec-1 cell line, as heterozygous mutations were observed. We additionally demonstrate here that the Rec-1 cell line, although defective for MHC2TA as assessed by genetic complementation, does not display any mutation in the MHC2TA coding sequence that could alter its activity.
CIITA protein expression is strongly reduced in the Rec-1 cell line
We next analyzed the expression of the CIITA protein in the Raji, RJ2.2.5 and Rec-1 cells. Protein extracts (3.6 mg) were submitted to immunoprecipitation with a rabbit polyclonal Ab directed against CIITA and revealed by immunoblotting with an anti-CIITA mAb (Figure 4a). As previously reported by our group, CIITA is expressed in the Raji cell line as two isoforms, B-CIITA and F-CIITA, where B-CIITA is 24 amino acids longer in its N-terminal extremity due to an alternative usage of translation initiation codons.16 The RJ2.2.5 cell line presents defects in both alleles of MHC2TA.35 Accordingly, wild-type CIITA is not expressed in this cell line, indicating that the bands observed in Raji are specific for CIITA. In the Rec-1 cells, CIITA is detected, although it is present at very low levels compared to Raji (Figure 4a).
Figure 4.
Expression of CIITA transcript and protein in the Rec-1 cells. (a) Expression of the CIITA protein in the Rec-1, Raji and RJ2.2.5 cell lines. Cell extracts (3.6 mg) were immunoprecipitated with a rabbit polyclonal antibody directed against CIITA. Immunoblotting was next performed with the 7-1 H mAb. (b) Expression of the CIITA protein in the Rec-1, Raji and RS4,11 cell lines. This analysis was performed as above, except that 2 mg of protein extracts were used. (c) MHC2TA transcript expression in the Raji, RS4,11, RJ2.2.5 and Rec-1 cell lines was assayed by a 28-cycle RT-PCR using primers amplifying all types of CIITA transcripts. Equal loading of cDNAs was assessed using GAPDH primers.
Full figure and legend (135K)Our study of a panel of different B-LCLs and lymphoma cell lines had revealed that the RS4,11 cell line, although expressing cell-surface MHC class II molecules, contains very low amounts of CIITA protein (data not shown). As seen in Figure 4b, where 2 mg of protein extracts were used for the immunoprecipitation, CIITA protein is barely detectable in the Rec-1 protein extracts compared to those of the RS4,11 cells. These data thereby confirm a defect in the expression of CIITA in the Rec-1 cell line, in agreement with its classification in BLS group A. However, the weak expression of the protein is in agreement with the residual transcription of certain HLA-D genes mentioned above (Figure 2).
Altered expression of MHC2TA transcript in the Rec-1 cell line
A defect in MHC2TA transcription might explain the highly residual expression of the CIITA protein. We then studied the expression of this gene in the MHC class II-defective Rec-1 and RJ2.2.5, compared to the MHC class II-expressing Raji and RS4,11 cell lines through RT-PCR using CIITA-specific primers (Figure 4c). This experiment showed that the level of amplification products is lower in the Rec-1 cell line than in the Raji and RS4,11 cell lines. Similar data were observed with several sets of primers hybridizing to different regions of the CIITA cDNA (data not shown). It must be noted that an alternatively spliced messenger was observed more frequently in the Rec-1 cell line when compared to the Raji cell line (data not shown). This transcript, representing about 5–10% of the total amplification products of the Rec-1 cell line, is deleted of one exon (nt. 3263–3349). This exon skipping leads to the production of a truncated CIITA protein that has been shown to lack transactivating activities.43
These data were suggestive of either a defect in MHC2TA transcription or an instability of the transcript that could hamper its efficient translation. To test this latter hypothesis, synthesis of neotranscripts was blocked using the DRB inhibitor. The Raji and Rec-1 cell lines were then treated with the inhibitor during 0, 2, 4, 6 or 8 h. Expression of the CIITA transcripts was next assayed by RT-PCR with an overloading of the Rec-1 cDNA to gain better detection of the amplification product, and more accurate conclusions when compared to Raji (Figure 5). This experiment demonstrates that the transcripts from Raji and Rec-1 cell lines present similar kinetics of disappearance. These data thereby show that the stability of the MHC2TA transcripts is not altered in the Rec-1 cell line and indicate that the low amounts of CIITA transcripts result from a transcriptional defect.
Figure 5.
Stability of the CIITA transcript in the Raji and Rec-1 lymphoma cell lines. Cells were treated for various time periods with 100
M DRB inhibitor prior to RNA extraction. RT-PCR was next performed through coamplification of GAPDH and CIITA. A three-fold higher cDNA loading was used for the Rec-1 cell line in order to visualize more accurately the decay of transcript expression.
Genes deregulated by CIITA
In addition to HLA-D genes, it has been shown that CIITA might affect the expression of other genes in lymphoma. Indeed, using the microarray methodology, transfection of the CIITA-defective RJ2.2.5 cell line with a CIITA cDNA evidenced a deregulation of different genes, including YARS and EIF3S2.44 The YARS product is a tyrosyl tRNA synthetase that can be proteolyzed and thereby generate a cleaved protein resembling IL-8 and possessing inflammatory capacities.45 The EIF3S2 gene encodes the TRIP-1 (TGF-
R-interacting) protein that is involved in the resistance to the antiproliferative properties of TGF-
.46 As their products might participate in tumor progression, it was interesting to examine whether these genes were repressed in Rec-1 as a consequence of the altered CIITA expression. We then performed this analysis by RT-PCR, and set the amplification conditions to minimize the cycle numbers in order to obtain semiquantitative data. As seen in Figure 6, EIF3S2 expression is not reduced in the cell lines lacking CIITA compared to the positive control. In contrast, YARS expression is lower in both CIITA-defective cell lines Rec-1 and RJ2.2.5 compared to Raji. These data indicate that the alteration of CIITA expression in the Rec-1 cell line leads not only to the complete lack of cell-surface MHC class II molecules but might additionally reduce the expression of (a) factor(s) involved in immune escape of the tumor cells.
Figure 6.
Expression of the TRIP- and YARS-encoding genes analyzed by RT-PCR on the Raji, RJ2.2.5 and Rec-1 B lymphoma cell lines. Equal loading of cDNAs was assessed with GAPDH primers using a 1/5 or 1/8 ratio of GAPDH primers compared to the TRIP-1-specific primers.
Full figure and legend (80K)Discussion
In this report we show that the lack of MHC class II expression in the Rec-1 B lymphoma cell line (Figure 1) results from an altered transcription of the HLA-D genes (Figure 2). The cell-surface expression of IgM and IgD, in addition to the CD20 and CD19 markers (Table 1), assesses that Rec-1 originates from a mature B lymphocyte. This indicates that the transcriptional defect of the Rec-1 cell line is not a consequence of methylation47 or extinction41 of the MHC2TA promoters observed in early or late stages of differentiation of B cells, respectively.
Genetic complementation experiments revealed that the Rec-1 cell line belongs to the BLS complementation group A, suggestive of a defect in MHC2TA (Table 2). In agreement, the expression of the CIITA protein was shown to be highly residual in the Rec-1 cell line (Figure 4). However, we did not evidence any mutation in the coding sequence of the CIITA cDNA that might explain a lack of activity or an increased instability of CIITA. Indeed, complementation was obtained with a cDNA carrying the two nonconservative S781L and V782A homozygous substitutions found in Rec-1 (Figure 3). These experiments were performed in the HeLa cell line in which we have shown that recombinant CIITA is expressed at levels close to physiological ones.16 Functional complementation of this cell line is therefore useful as it allows to discriminate fully invalidating defects from leaky mutations.48 We additionally have examined the level of CIITA protein expression in the transfected clones without evidencing any reduction when compared to cell clones transfected with the wild-type cDNA (data not shown). These data therefore indicate that the S781L and V782A mutations do not inactivate CIITA transactivating properties and do not confer a higher instability to the CIITA protein. In agreement with these data, it has to be noted that these aminoacids are not conserved in the mouse CIITA cDNA (corresponding aminoacids: V729 and A730). This suggests that the C2457 T and T2460C variants might represent polymorphisms of the MHC2TA gene.
Based on these data, we propose that the CIITA protein, although functional in the Rec-1 cell line, is likely in a concentration that is not sufficient to permit cell-surface expression of MHC class II molecules. This is in agreement with reports evidencing a threshold of CIITA required for MHC class II expression.49,50 We therefore analyzed the possibility that a defect in MHC2TA might alter its level of expression in the Rec-1 cell line. Indeed, we have evidenced a strongly reduced amount of total CIITA transcripts in this cell line compared to the Raji and RS4,11 cell lines (Figure 4a). Interestingly promoter III- and promoter IV-initiated CIITA transcripts are reduced in the Rec-1 cell line when compared to the RS4,11 cell line (data not shown). We additionally provide evidence that this reduced amount does not result from an abnormal instability (Figure 5). These data therefore are in agreement with a mutation affecting the transcription of MHC2TA. This mutation might be localized in the promoter regions of the gene or in an intronic sequence. Given the length of these regions (about 10 and 30 kb, respectively), and the high degree of polymorphism in both promoters and introns that we had observed during the analysis of BLS group A patients (unpublished data), the identification of this mutation would first necessitate sequencing of MHC2TA in nontumoral cells, however unavailable, of the patient from which Rec-1 was established.
Various tumor cell lines, fibrosarcoma, neuroblastoma, retinoblastoma cell lines, SCLC and pancreatic tumors, were shown by us and others to lack MHC class II expression due to defective MHC2TA transcription.24,26,27,28 One can wonder if this indicates that the alteration of CIITA expression can provide an advantage to the tumor cells. A hypothesis is that the loss of CIITA expression might favor tumor proliferation or resistance to apoptosis. Indeed, it has been shown that CIITA can sequester the transactivators CBP/p300.8,51 As CBP is now described as an antioncogene involved cell growth, differentiation and apoptosis,52 it is possible to hypothesize that the loss of CIITA, through the release of CBP, might favor tumor progression.
Alternatively, through transactivator sequestration or yet unknown mechanisms, it has been shown that CIITA regulates, in addition to HLA-D, the expression of different genes.44 As some of them might be involved in tumor progression, we have assayed two of these genes (Figure 6) and found that one of them, YARS, was presenting a slightly reduced expression in the Rec-1 and RJ2.2.5 cell lines when compared to Raji. As YARS encodes a protein with IL-8-like properties,45 the lower expression of this gene in the Rec-1 cell line might reduce the inflammatory response. To assess further this point, a large panel of lymphomas should be analyzed to determine if the reduced expression of the YARS gene is recurrent for CIITA-defective cells.
In addition to MHC class II, CIITA was shown to enhance MHC class I promoter expression.53 Its disappearance might then further reduce antitumor cytotoxic CD8+ lymphocyte activity. Indeed, in the Rec-1 cell line, MHC class I expression is strongly reduced (Figure 1). Further quantification of cell-surface MHC class I molecules assessed that this reduction is about 60-fold in the Rec-1 cell line when compared to Raji (data not shown). However, we cannot ascertain here that the CIITA defect is entirely or partially responsible for this phenotype. Indeed, the RJ2.2.5 cell line, although defective for CIITA, does not display reduced MHC class I expression (Figure 1). It is then possible that an additional mutation affects a transcription factor required for MHC class I gene expression in the Rec-1 cell line. Alternatively, as the W6/32 mAb recognizes all three MHC class I isotypes, mutations might have occurred in the genes encoding certain isotypes or alleles of MHC class I molecules.
Having reviewed all nonclassical effects of CIITA, it remains important to consider that the main consequence of CIITA defect in APC-derived tumors is the loss of MHC class II expression. Indeed, these tumors express the B7-1 and B7-2 costimulatory molecules, and therefore might activate tumor-specific T lymphocyte responses. The loss of MHC class II molecule expression has been proposed as an immune escape mechanism through a reduced recognition by helper CD4+ T lymphocytes. Titers of tumor-infiltrating lymphocytes were shown to be reduced with human HLA-DR-defective lymphoma.30 Accordingly, the loss of MHC class II expression in mouse lymphoma cells was shown to correlate with a higher tumorigenicity resulting from a lower immunogenicity.32 In addition, although not evidenced to our knowledge in B-cell lymphoma, loss of MHC class II expression might also provide resistance to cytotoxic CD4+ T lymphocytes, as shown in melanoma.54
As MHC class II signaling via HLA-DR has been shown to induce cell death in human lymphoma,55 immunotherapy protocols based on humanized 1D10 and Lym-1 anti-HLA-DR mAbs56 have been envisaged for B-cell lymphoma treatment.57 Indeed, antibody-based lymphoma therapy has already shown its high efficiency with Rituximab, a humanized anti-CD20 mAb.58 However, relapse occurs in about half of Rituximab-treated patients as rituximab-resistant tumor cells arise.59 Interestingly, these resistant tumor cells are mostly CD20- variants.59,60
Spontaneous loss of MHC class II expression in B-cell lymphoma is a rare phenomenon.31 However, anti-HLA-DR immunotherapy protocols might favor the proliferation of HLA-DR- variants. The results presented here demonstrate that lymphoma cells, like other HLA-DR- tumor cells, can lose MHC class II expression due to a defect in CIITA expression. We therefore propose that patients should be scrutineously monitored for the appearance of variants losing MHC class II expression and thereby escaping anti-HLA-DR antibody-based therapies.
References
- Germain RN. MHC-dependent antigen processing and peptide presentation: providing ligands for T lymphocyte activation. Cell 1994; 76: 287–299. | Article | PubMed | ISI | ChemPort |
- Glimcher LH, Kara CJ. Sequences and factors: a guide to MHC class II transcription. Ann Rev Immunol 1992; 10: 13–50. | Article | ISI | ChemPort |
- Reith W, Muhlethaler-Mottet A, Masternak K, Villard J, Mach B. The molecular basis of MHC class II deficiency and transcriptional control of MHC class II gene expression. Microbes Infect 1999; 1: 839–846. | PubMed |
- Reith W, Mach B. The bare lymphocyte syndrome and the regulation of MHC expression. Annu Rev Immunol 2001; 19: 331–373. | Article | PubMed | ISI | ChemPort |
- Harton JA, Ting JP. Class II transactivator: mastering the art of major histocompatibility complex expression. Mol Cell Biol 2000; 20: 6185–6194. | Article | PubMed | ISI | ChemPort |
- Steimle V, Otten LA, Zufferey M, Mach B. Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome). Cell 1993; 75: 135–146. | Article | PubMed | ISI | ChemPort |
- Zhu XS, Linhoff MW, Li G, Chin KC, Maity SN, Ting JP. Transcriptional scaffold: CIITA interacts with NF-Y, RFX, and CREB To cause stereospecific regulation of the class II major histocompatibility complex promoter. Mol Cell Biol 2000; 20: 6051–6061. | Article | PubMed | ISI | ChemPort |
- Kretsovali A, Agalioti T, Spilianakis C, Tzortzakaki E, Merika M, Papamatheakis J. Involvement of CREB binding protein in expression of major histocompatibility complex class II genes via interaction with the class II transactivator. Mol Cell Biol 1998; 18: 6777–6783. | PubMed | ISI | ChemPort |
- Spilianakis C, Papamatheakis J, Kretsovali A. Acetylation by PCAF enhances CIITA nuclear accumulation and transactivation of major histocompatibility complex class II genes. Mol Cell Biol 2000; 20: 8489–8498. | Article | PubMed | ISI | ChemPort |
- Fontes JD, Jiang B, Peterlin BM. The class II trans-activator CIITA interacts with the TBP-associated factor TAFII32. Nucleic Acids Res 1997; 25: 2522–2528. | Article | PubMed | ISI | ChemPort |
- Mahanta SK, Scholl T, Yang FC, Strominger JL. Transactivation by CIITA, the type II bare lymphocyte syndrome- associated factor, requires participation of multiple regions of the TATA box binding protein. Proc Natl Acad Sci USA 1997; 94: 6324–6329. | Article | PubMed | ChemPort |
- Steimle V, Siegrist CA, Mottet A, Lisowska-Grospierre B, Mach B. Regulation of MHC class II expression by interferon-gamma mediated by the transactivator gene CIITA. Science 1994; 265: 106–109. | Article | PubMed | ISI | ChemPort |
- Chang CH, Fontes JD, Peterlin M, Flavell RA. Class II transactivator (CIITA) is sufficient for the inducible expression of major histocompatibility complex class II genes. J Exp Med 1994; 180: 1367–1374. | Article | PubMed | ISI | ChemPort |
- Muhlethaler-Mottet A, Otten LA, Steimle V, Mach B. Expression of MHC class II molecules in different cellular and functional compartments is controlled by differential usage of multiple promoters of the transactivator CIITA. EMBO J 1997; 16: 2851–2860. | Article | PubMed | ChemPort |
- Lennon AM, Ottone C, Rigaud G, Deaven LL, Longmire J, Fellous M et al. Isolation of a B-cell-specific promoter for the human class II transactivator. Immunogenetics 1997; 45: 266–273. | Article | PubMed | ISI | ChemPort |
- Barbieri G, Deffrennes V, Prod'homme T, Vedrenne J, Baton F, Cortes C et al. Isoforms of the class II transactivator protein. Int Immunol 2002; 14: 839–848. | Article | PubMed |
- Nickerson K, Sisk TJ, Inohara N, Yee CS, Kennell J, Cho MC et al. Dendritic cell-specific MHC class II transactivator contains a caspase recruitment domain that confers potent transactivation activity. J Biol Chem 2001; 276: 19089–19093. | Article | PubMed | ISI | ChemPort |
- Griscelli C, Lisowska-Grospierre B, Mach B. Combined immunodeficiency with defective expression in MHC class II genes. Immunodeficiency Rev 1989; 1: 135–143. | ChemPort |
- Benichou B, Strominger JL et al. Class II-antigen-negative patient and mutant B-cell lines represent at least three, and probably four, distinct genetic defects defined by complementation analysis. Proc Natl Acad Sci USA 1991; 88: 4285–4288. | Article | PubMed | ChemPort |
- Masternak K, Barras E, Zufferey M, Conrad B, Corthals G, Aebersold R et al. A gene encoding a novel RFX-associated transactivator is mutated in the majority of MHC class II deficiency patients. Nat Genet 1998; 20: 273–277. | Article | PubMed | ISI | ChemPort |
- Steimle V, Durand B, Barras E, Zufferey M, Hadam MR, Mach B et al. A novel DNA-binding regulatory factor is mutated in primary MHC class II deficiency (bare lymphocyte syndrome). Genes Dev 1995; 9: 1021–1032. | PubMed | ISI | ChemPort |
- Durand B, Sperisen P, Emery P, Barras E, Zufferey M, Mach B et al. RFXAP, a novel subunit of the RFX DNA binding complex is mutated in MHC class II deficiency. EMBO J. 1997; 16: 1045–1055. | Article | PubMed | ISI | ChemPort |
- Dziembowska M, Fondaneche MC, Vedrenne J, Barbieri G, Wiszniewski W, Picard C et al. Three novel mutations of the CIITA gene in MHC class II-deficient patients with a severe immunodeficiency. Immunogenetics 2002; 53: 821–829. | Article | PubMed |
- Yazawa T, Kamma H, Fujiwara M, Matsui M, Horiguchi H, Satoh H et al. Lack of class II transactivator causes severe deficiency of HLA-DR expression in small cell lung cancer. J Pathol 1999; 187: 191–199. | Article | PubMed | ISI | ChemPort |
- Magner WJ, Kazim AL, Stewart C, Romano MA, Catalano G, Grande C et al. Activation of MHC class I, II, and CD40 gene expression by histone deacetylase inhibitors. J Immunol 2000; 165: 7017–7024. | PubMed | ISI | ChemPort |
- Lu Y, Tschickardt ME, Schmidt BJ, Blanck G. IFN-gamma inducibility of class II transactivator is specifically lacking in human tumour lines: relevance to retinoblastoma protein rescue of IFN-gamma inducibility of the HLA class II genes. Immunol Cell Biol 1997; 75: 325–332. | Article | PubMed |
- Xi H, Blanck G. Interferon regulatory factor-2 point mutations in human pancreatic tumors. Int J Cancer 2000; 87: 803–808. | Article | PubMed |
- Naves R, Lennon AM, Barbieri G, Reyes L, Puga G, Salas L et al. MHC class II-deficient tumor cell lines with a defective expression of the class II transactivator. Int Immunol 2002; 14: 481–491. | Article | PubMed |
- Morris AC, Spangler WE, Boss JM. Methylation of class II trans-activator promoter IV: a novel mechanism of MHC class II gene control. J Immunol 2000; 164: 4143–4149. | PubMed | ISI | ChemPort |
- Stopeck AT, Gessner A, Miller TP, Hersh EM, Johnson CS, Cui H et al. Loss of B7.2 (CD86) and intracellular adhesion molecule 1 (CD54) expression is associated with decreased tumor-infiltrating T lymphocytes in diffuse B-cell large-cell lymphoma. Clin Cancer Res 2000; 6: 3904–3909. | PubMed |
- Amiot L, Onno M, Lamy T, Dauriac C, Le Prise PY, Fauchet R et al. Loss of HLA molecules in B lymphomas is associated with an aggressive clinical course. Br J Haematol 1998; 100: 655–663. | Article | PubMed |
- Fuji H, Iribe H. Clonal variation in tumorigenicity of L1210 lymphoma cells: nontumorigenic variants with an enhanced expression of tumor-associated antigen and Ia antigens. Cancer Res 1986; 46: 5541–5547. | PubMed | ISI | ChemPort |
- Coiffier B, Gisselbrecht C, Herbrecht R, Tilly H, Bosly A, Brousse N. LNH-84 regimen: a multicenter study of intensive chemotherapy in 737 patients with aggressive malignant lymphoma. J Clin Oncol 1989; 7: 1018–1026. | PubMed | ISI | ChemPort |
- Meeker TC, Sellers W, Harvey R, Withers D, Carey K, Xiao H et al. Cloning of the t(11;14)(q13;q32) translocation breakpoints from two human leukemia cell lines. Leukemia 1991; 5: 733–737. | PubMed |
- Brown JA, He XF, Westerheide SD, Boss JM. Characterization of the expressed CIITA allele in the class II MHC transcriptional mutant RJ2.2.5. Immunogenetics 1996; 43: 88–91. | PubMed | ChemPort |
- Lisowska-Grospierre B, Fondaneche M-C, Rois M-P, Griscelli C, Fischer A. Two complementation groups account for most cases in inherited MHC class II deficiency. Hum Mol Genet 1994; 3: 953–958. | PubMed | ChemPort |
- Watson AJ, DeMars R, Trowbridge IS, Bach FH. Detection of a novel human class II HLA antigen. Nature 1983; 304: 358–361. | Article | PubMed | ISI | ChemPort |
- Lennon A, Ottone C, Peijnenburg A, Hamon-Benais C, Colland F, Gobin S et al. The RAG cell line defines a new complementation group of MHC class II deficiency. Immunogenetics 1996; 43: 352–359. | Article | PubMed |
- Zhou H, Su HS, Zhang X, Douhan III J, Glimcher LH. CIITA-dependent and -independent class II MHC expression revealed by a dominant negative mutant. J Immunol 1997; 158: 4741–4749. | PubMed | ISI | ChemPort |
- Klein C, Lisowska-Grospierre B, LeDeist F, Fischer A, Griscelli C. Major histocompatibility complex class II deficiency: clinical manifestations, immunologic features, and outcome. J Pediatr 1993; 123: 921–929. | PubMed | ISI | ChemPort |
- Piskurich JF, Lin KI, Lin Y, Wang Y, Ting JP, Calame K. BLIMP-I mediates extinction of major histocompatibility class II transactivator expression in plasma cells. Nat Immunol 2000; 1: 526–532. | Article | PubMed | ISI | ChemPort |
- Riley JL, Westerheide SD, Price JA, Brown JA, Boss JM. Activation of class II MHC genes requires both the X box region and the class II transactivator (CIITA). Immunity 1995; 2: 533–543. | Article | PubMed | ISI | ChemPort |
- Peijnenburg A, Van den Berg R, Van Eggermond MJ, Sanal O, Vossen JM, Lennon AM et al. Defective MHC class II expression in an MHC class II deficiency patient is caused by a novel deletion of a splice donor site in the MHC class II transactivator gene. Immunogenetics 2000; 51: 42–49. | Article | PubMed |
- Nagarajan UM, Bushey A, Boss JM. Modulation of gene expression by the MHC class II transactivator. J Immunol 2002; 169: 5078–5088. | PubMed | ISI |
- Wakasugi K, Slike BM, Hood J, Ewalt KL, Cheresh DA, Schimmel P. Induction of angiogenesis by a fragment of human tyrosyl-tRNA synthetase. J Biol Chem 2002; 277: 20124–20136. | Article | PubMed | ISI | ChemPort |
- Choy L, Derynck R. The type II transforming growth factor (TGF)-beta receptor-interacting protein TRIP-1 acts as a modulator of the TGF-beta response. J Biol Chem. 1998; 273: 31455–31462. | Article | PubMed | ISI | ChemPort |
- Murphy SP, Holtz R, Lewandowski N, Tomasi TB, Fuji H. DNA Alkylating agents alleviate silencing of class II transactivator gene expression in L1210 lymphoma cells. J Immunol 2002; 169: 3085–3093. | PubMed | ISI | ChemPort |
- Wiszniewski W, Fondaneche MC, Le Deist F, Kanariou M, Selz F, Brousse N et al. Mutation in the class II trans-activator leading to a mild immunodeficiency. J Immunol 2001; 167: 1787–1794. | PubMed | ISI | ChemPort |
- Otten LA, Steimle V, Bontron S, Mach B. Quantitative control of MHC class II expression by the transactivator CIITA. Eur J Immunol 1998; 28: 473–478. | Article | PubMed | ChemPort |
- Otten LA, Tacchini-Cottier F, Lohoff M, Annunziato F, Cosmi L, Scarpellino L et al. Deregulated MHC class II transactivator expression leads to a strong Th2 bias in CD4+ T lymphocytes. J Immunol 2003; 170: 1150–1157. | PubMed | ISI | ChemPort |
- Zhu XS, Ting JP. A 36-amino-acid region of CIITA is an effective inhibitor of CBP: novel mechanism of gamma interferon-mediated suppression of collagen alpha(2)(I) and other promoters. Mol Cell Biol 2001; 21: 7078–7088. | Article | PubMed | ISI | ChemPort |
- Chan HM, La Thangue NB. p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J Cell Sci 2001; 114: 2363–2373. | PubMed | ISI | ChemPort |
- Gobin SJ, Peijnenburg A, van Eggermond M, van Zutphen M, van den Berg R, van den Elsen PJ. The RFX complex is crucial for the constitutive and CIITA-mediated transactivation of MHC class I and beta2-microglobulin genes. Immunity 1998; 9: 531–541. | Article | PubMed | ISI | ChemPort |
- Chiari R, Hames G, Stroobant V, Texier C, Maillere B, Boon T et al. Identification of a tumor-specific shared antigen derived from an Eph receptor and presented to CD4 T cells on HLA class II molecules. Cancer Res 2000; 60: 4855–4863. | PubMed | ChemPort |
- Drenou B, Blancheteau V, Burgess DH, Fauchet R, Charron DJ, Mooney NA. A caspase-independent pathway of MHC class II antigen-mediated apoptosis of human B lymphocytes. J Immunol 1999; 163: 4115–4124. | PubMed | ISI | ChemPort |
- Dechant M, Bruenke J, Valerius T. HLA class II antibodies in the treatment of hematologic malignancies. Semin Oncol 2003; 30: 465–475. | Article | PubMed | ISI | ChemPort |
- Nagy ZA, Hubner B, Lohning C, Rauchenberger R, Reiffert S, Thomassen-Wolf E et al. Fully human, HLA-DR-specific monoclonal antibodies efficiently induce programmed death of malignant lymphoid cells. Nat Med 2002; 8: 801–807. | Article | PubMed | ISI | ChemPort |
- Kosmas C, Stamatopoulos K, Stavroyianni N, Tsavaris N, Papadaki T. Anti-CD20-based therapy of B cell lymphoma: state of the art. Leukemia 2002; 16: 2004–2015. | Article | PubMed | ChemPort |
- Foran JM, Norton AJ, Micallef IN, Taussig DC, Amess JA, Rohatiner AZ et al. Loss of CD20 expression following treatment with rituximab (chimaeric monoclonal anti-CD20): a retrospective cohort analysis. Br J Haematol 2001; 114: 881–883. | Article | PubMed | ChemPort |
- Boye J, Elter T, Engert A. An overview of the current clinical use of the anti-CD20 monoclonal antibody rituximab. Ann Oncol 2003; 14: 520–535. | Article | PubMed | ChemPort |
Acknowledgements
We thank Mrs Céline Pangault for her technical help in the lymphoma phenotyping. This work was supported in part by the Association pour la Recherche sur le Cancer and the Fondation de France. TP was supported by grants from the Association pour la Recherche sur le Cancer and the Fondation pour la Recherche Médicale. GB was supported by grants from the Fondation de France and the INSERM.
