Introduction

As a group, the acute leukaemias are the most common form of cancer in children, accounting for approximately one-third of all juvenile neoplasms (age <16 years) in developed countries. The majority of these cases are classified as acute lymphoblastic leukaemia (ALL) with about 15% of these being of T-cell phenotype (T-ALL). Despite continual improvements in treatment over many years, ALL is still associated with a significant mortality, and relapsed ALL continues to contribute greatly to the overall morbidity and mortality of childhood cancer. Several chromosomal abnormalities are specifically associated with T-ALL. The most common recurring breakpoints are within the 14q11, 7q32-q36 and 7p15 bands, which contain the T-cell receptor genes TCRA/D, TCRB and TCRG, respectively, and they are involved in 30–35% of T-ALL cases.^1,2,3,4

Molecular analyses of the chromosomal breakpoints have identified several T-cell oncogenes, and most of them have been formally shown to be tumorigenic.⁵ Remarkably, the majority of T-cell oncogenes belong to a number of classic transcription factor families whose expression is most often intended for lineages other than T cells. The factors deregulated in T-ALL comprise the HOX11 homeobox genes (see below), LMO1 and LMO2 which contain duplicated LIM zinc-finger motifs, and MYC, TAL1 (SCL), TAL2 and LYL1 which all encode helix–loop–helix proteins. A recent study on gene expression profiles in T-ALL confirmed the activation of these transcription factors to be a hallmark in these leukaemias.⁶

The HOX11 and the closely related HOX11L2 genes were both identified at recurrent chromosomal breakpoints in T-ALLs.^{7,8,9,10,11,12,13} The cryptic chromosomal translocation t(5;14) (q35;q32) has been reported to be present in approximately 20% of T-ALL cases,^12,13 although a recent report suggests that the frequency may be even higher.¹⁴ Translocations leading to HOX11 gene activation are present in 4–7% of T-ALLs, either by t(10;14)(q24;q11) or t(7;10)(q35;q24).^4,15 However, work in our laboratory suggested that a larger proportion of T-ALLs exhibit deregulated HOX11 expression when molecularly detectable abnormalities are included,¹⁶ and this was recently confirmed.⁶

At the time of diagnosis of ALL in children, several clinical and cytogenetic features are of prognostic significance. The assessment is primarily based on age and white blood cell (WBC) count; however, early response to therapy has emerged as an important prognostic variable.¹⁷ In B-lineage ALL, cytogenetic abnormalities have strong prognostic associations, contrasting with paediatric T-ALL, where cytogenetic features have little or no predictive value.¹⁵ However, one study reported better survival for patients with normal karyotypes and with t(10;14).⁴ Therefore, we have examined the prognostic significance of HOX11 expression in T-ALL patients. In our previous study on a small group of patients, HOX11 expression was measured by conventional polymerase chain reaction (PCR). The much larger group of T-ALL patients studied here allowed us to examine this question further and to assess corresponding cytogenetic aberrations at 10q24 and clinical outcome. In addition, the use of multiplex real-time quantitative reverse-transcriptase PCR (QRT-PCR) achieved much greater accuracy and sensitivity.

Material and methods

Study patients

Bone marrow specimens were obtained from 97 children with newly diagnosed ALL, comprising 76 T-ALL and 21 B-lineage patients. They were enrolled between 1989 and 1997 on risk-adjusted treatment protocols of the Children's Cancer Group (CCG). Cases were studied based on the availability of cryopreserved Ficoll–Hypaque-enriched leukaemic blasts from bone marrow aspirates. Diagnosis was based on morphologic, biochemical and immunological features of the leukaemic cells. Immunophenotyping was performed by indirect immunofluorescence and flow cytometry using a panel of monoclonal antibodies. Cases were classified as T-lineage based on staining using antibodies to CD7 and absence of staining for CD19. The presenting features for 63 T-ALL patients are shown in Table 1.

Table 1 - Clinical and biological presenting features of T-ALL patients.

Full table

The risk-adjusted protocols for newly diagnosed ALL patients were as follows: CCG-1882 and CCG-1961, high-risk protocols for patients age 1–9 years with WBC counts 50 000/l or age 10 years; CCG-1901, high-risk protocol for patients with lymphomatous features; CCG-1922 and CCG-1952, standard risk protocols for patients 1–9 years with WBC <50 000/l; CCG-1953, protocol for infants with ALL. Each protocol was approved by the National Cancer Institute (NCI) and the institutional review boards of the participating CCG-affiliated institutions. Informed consent was obtained from parents, patients, or both, as deemed appropriate, according to Department of Health and Human Services guidelines.

Reference cells

Cell line PER-255^7,8 that exhibits a t(7;10)(q35;q24) was used as a positive control for HOX11 expression. Bone marrow specimens and T-cells purified from peripheral blood of normal individuals were used as control preparations. The latter were obtained by the E-rosetting technique¹⁸ and analysed for purity by indirect immunofluorescence and flow cytometry using a cocktail of monoclonal antibodies (CD2, CD3, CD5 and CD7).¹⁹ The analysis of the 11 T-cell preparations showed that T-cell markers were expressed on 91.3%8.6 of cells.

Real-time RT-PCR analysis in multiplex format

Bone marrow specimens were enriched for lymphoblasts by Ficoll–Hypaque (Pharmacia, Uppsala, Sweden) centrifugation. Total RNA was isolated from cryopreserved specimens and the PER-255 cell line using the TRI reagent (Molecular Research Centre, Cincinnati, OH, USA) according to the manufacturer's instructions. Quantitation was performed by OD 260 nm and OD 280 nm readings on a UV spectrophotometer. For 71 specimens, generation of cDNA was carried out using Superscript II (Life Technologies, Australia) according to the manufacturer's instructions, while for the remaining specimens the reaction was performed using AMV RT from Promega. The QRT-PCR analysis was designed to include an internal control reaction to assess whether sufficient amplifiable material was present in each sample under test. For this the -actin gene was chosen, and we selected an amplicon with substantial differences compared to the known pseudogenes to avoid their amplification. In order to prevent efficient amplification of genomic DNA, all amplicons flanked introns. The probe for HOX11 spans exons 1 and 2, while the -actin probe spans exons 4 and 5. We excluded the possibility that our HOX11 specific primers/probes could inadvertently detect HOX11L2, rather than the HOX11 gene itself, by ensuring that the two 3' base pairs of the antisense extension primer both misaligned with the HOX11L2 template and the Tm for our probe annealing to this inappropriate template was prohibitively low at <30°C. Experimental verification using HOX11L2-positive cells showed them to be negative when analysed using HOX11 primers and probes.

The quality of the assay was verified by testing cDNA samples generated in the absence of reverse transcriptase. The primers for both genes were designed using PE Applied Biosystems Primer Express™ software and were supplied by Life Technologies, Australia. The primers for HOX11 and -actin were as follows: HOX11 cDNA F: tcccctggatggagagtaacc, HOX11cDNA R: cgtgcgcggcttcttct, -actin cDNA F: ggcacccagcacaatgaag and -actin cDNA R: gccgatccacacggagtact. The probe for HOX11 cDNA had the sequence aggacaggttcacaggtcacccctatcaga and was labelled with FAM, while the probe for -actin cDNA, tcaagatcattgctcctcctgagcgc, was labelled with VIC. The specificity of HOX11 primers and probe was checked by Southern blot hybridisation to HOX11 oligo. Both probes were manufactured by PE Applied Biosystems. Primers and probes were optimised for each reaction to achieve minimal threshold cycle numbers (C_T) and maximal delta Rn (fluorescence intensity over background) values. Ideally, the control reaction for the reference gene should be performed in the same tube as the test reaction, and for the measurement of HOX11 it was possible to find conditions for a multiplex format. Hence, both reactions were performed in the same well in a final volume of 50 l. The final concentrations of primers and probes were as follows: HOX11F 200 nM, HOX11R 500 nM, HOX probe 125 nM, -actinF 50 nM, -actinR 25 nM and -actin cDNA probe 100 nM. Each reaction contained 1 l of cDNA. The thermal cycling conditions of the ABI PRISM 7700 Sequence Detection instrument were set to 2 min at 50°C, 10 min at 95°C followed by 40 cycles of 15 s at 95°C alternating with 1 min at 60°C. A calibration curve was included with each experiment using a range of concentrations of cDNA (quantitated using UV spectroscopy OD 260 nm) ranging from 0.19 to 12.25 ng/l of cDNA. In order to ensure that the specimens analysed contained sufficient amplifiable material, specimens yielding a low value for -actin (C_T>25) were excluded from the analysis. The C_T value of 25 corresponds to the reading for -actin for the lowest cDNA concentration measured in each calibration curve, and it was highly reproducible between experiments. Each specimen was analysed in duplicate, and all specimens showing discordant findings were repeated. Five bone marrow preparations from normal individuals yielded a ratio of HOX11/-actin of 0.000530.00033; hence, any value greater than the mean plus 3 s.d., which is 0.0015, was scored as positive.

Cytogenetic analysis

Cytogenetic analyses were done as described previously²⁰ at local institutions on pretreatment bone marrow or peripheral blood specimens and were centrally reviewed by at least two members of the CCG Cytogenetics Committee. Chromosome abnormalities were designated using the 1995 International System for Human Cytogenetics Nomenclature.²¹ Abnormal clones were defined as two or more metaphase cells with identical structural abnormalities or extra chromosomes, or three or more metaphase cells with identical missing chromosomes. Diagnosis of a normal karyotype required complete analysis of a minimum of 20 banded metaphases from bone marrow only.

Statistical methods

² tests were utilised to compare characteristics of patient groups according to the status of HOX11 expression in their leukaemic blasts. The end points used for life table outcome and prognostic factor effects were event-free survival (EFS) and survival measured from time of patient entry to the study on which they were treated. EFS is defined as the time to the first occurrence of any one of the following events: induction death, nonresponse to induction therapy, relapse after initial remission at any site, death in remission and second malignant neoplasm. Life table estimates used the Kaplan–Meier (KM) method.²² Life table comparisons of outcome for the various patient subsets according to HOX11 expression used the log-rank statistic.²³

Results

HOX11 expression in T-ALL cells from paediatric patients

Expression of HOX11 was studied in 76 bone marrow specimens from paediatric T-ALL patients. We established a QRT-PCR method and -actin was measured as the reference gene in a multiplex reaction. The reference gene was also used as an indicator to exclude samples that did not contain sufficient amplifiable material. The level of HOX11 expression was determined as the ratio of HOX11/-actin and specimens were scored as detailed under Materials and methods. The 76 T-ALL specimens segregated clearly into 37 (49%) HOX11-expressing and 39 (51%) nonexpressing specimens. Among the positive specimens there were 15 (19.7%) specimens expressing HOX11 at a high level (ratio 0.05) and 22 (28.9%) at a low level (ratio >0.0015<0.05; Figure 1). The PER-255 cell line which exhibits a t(7;10)(q35;q24) and expresses HOX11 was included for reference, showing that the expression level of this cell line was in the range of the patient specimens expressing the gene at high levels.

Figure 1.

Gene expression of HOX11/-actin in 76 T-ALL specimens classified according to the level of expression, positive () or negative (). PER-255 cell line (), normal bone marrow (-), purified peripheral T cells () and 21 B-lineage ALL specimens (). Specimens were scored based on experimental assessment of background level of the reaction, see Material and methods.

Full figure and legend (21K)

We previously reported HOX11 expression to be exclusive to T-ALL since none of the 53 B-lineage ALL showed expression of the gene.¹⁶ In order to confirm this finding with the more sensitive technique used here, we included 21 ALL specimens from patients with B-lineage immunophenotype, previously investigated by the conventional PCR method.¹⁶ All of them were confirmed to be negative for HOX11 expression (Figure 1).

In our previous studies we did not detect HOX11 expression in normal T-cells; however, no consistent findings on this subject have been reported.^10,24,25 In order to address the issue, we purified peripheral blood T-cells from 11 normal individuals and analysed them using the sensitive QRT-PCR method. All of them were clearly negative for HOX11 expression (Figure 1). Taken together these findings on ALL specimens and normal T-cells demonstrate that the method to measure HOX11 expression is appropriate for the detection of low to high expression levels in clinical samples, since it provides sufficient sensitivity and low noise to allow unambiguous detection of signal.

Cytogenetic aberrations in T-ALL specimens expressing HOX11

Cytogenetic results were available for 30 of the 76 patients and they comprised the karyotypic features known to be present in T-ALL patients (Table 2). We examined the relation between HOX11 status and cytogenetic aberrations according to the classification of normal, pseudodiploid, low hyperdiploid (47–50), high hyperdiploid (50+) or hypodiploid chromosomes. Prima facie there appeared to be more low hyperdiploid (47–50 chromosomes) and fewer pseudodiploid patients among the patients with leukaemia cells expressing HOX11 compared with those showing no expression. Comparison by ² tests gives a P-value of 0.04 for the low hyperdiploid vs nonlow hyperdiploid categories, but the comparison for pseudodiploid status is not close to a conventional significance level (P=0.27). Interestingly, only two of the patients showing expression of HOX11 in their leukaemia cells had aberrations of 10q, both involving loss. One patient had monosomy 10, but had three marker chromosomes; therefore, an aberration of HOX11 may have been present in one or more of the marker chromosomes. The second patient had deletions of both chromosome 10 homologues, del(10)(q23q25) and del(10)(q26), neither of which appeared to have a breakpoint involving 10q24, the cytogenetic locus for HOX11.

Table 2 - Cytogenetic results for 30 T-ALL patients.

Full table

Leukaemia cells that express HOX11 in the absence of cytogenetically detectable aberrations at 10q24 may contain small deletions or insertions at this locus. This could be assessed by FISH technique or by a long-range PCR methodology; however, the patient material was not available for this type of analysis.

HOX11 expression and treatment outcome

We first searched for associations between HOX11 status and clinical presentation features in 63 patients (Table 1). We failed to find correlation with any of the clinical characteristics recorded. Next, we examined treatment outcome for these patients. Figure 2 illustrates the EFS and survival analysis stratified by HOX11 status. The 7-year EFS for the 30 patients with HOX11-positive leukaemia cells was 83.3% vs 75.5% for those with HOX11-negative cells (P=0.48; not shown). Similarly, the survival rates were not statistically significantly different for the two groups, 83.3% compared to 73.2% for the patients with HOX11-positive and HOX11-negative cells, respectively (P=0.67; not shown). We next asked whether clinical outcome is a function of the level of HOX11 expression. Comparison of outcome for the patients showing high or low HOX11 levels did not reach a conventional statistical significance level; however, the data revealed somewhat better outcomes for the subgroup with high HOX11 levels in leukaemia cells compared to low level or negative for HOX11. The 7-year EFS rates for the HOX11-high group was 92.9% compared to 75.5% for the HOX11-negative group (P=0.20) and 75.0% for the HOX11-low group (Figure 2a). The survival rates were 92.9% for the HOX11-high group vs 73.2% for the negative group (P=0.24) and 75.0% for the HOX11-low group (Figure 2b). We conducted subgroup analyses for all diagnostic parameters, including WBC, age and NCI risk group stratification.²⁶ None of the groups showed a significant difference regarding treatment outcome according to HOX11 status. We next examined clinical outcome for subgroups of patients treated on the various protocols. A total of 40 patients were treated on study protocols for high-risk patients, 20 on CCG-1901 and 20 on CCG-1961. The number of patients treated on the other study protocols were too small for statistical analysis. Interestingly, we found a different outcome according to HOX11 status for patients on CCG-1901 (based on New York regimen), but not for CCG-1961 (based on Berlin–Frankfurt–Münster regimen, BFM). In all, 10 (50%) of the CCG-1901 patients had HOX11-positive leukaemia cells, five patients showing HOX11 expression at high level and five at low level. No EFS event occurred in this group of 10 patients, contrasting with two medullary relapses, two extramedullary relapses and one death occurring in the 10 patients with HOX11-negative cells. The EFS rates by year 7 were 100% for the HOX11-positive group vs 50% for the HOX11-negative group (P=0.01; Figure 2c) and a corresponding significant difference was found for overall survival in this group of patients as well (P=0.03, Figure 2d).

Figure 2.

EFS (a) and overall survival (b) according to HOX11 status for all 63 T-ALL patients and EFS (c) and overall survival (d) for a subgroup of 20 high-risk patients treated on CCG-1901. (a and b) Clinical outcome for patients with leukaemia cells expressing HOX11 at high (- - - -), at low level (- - - - - - -) or negative for HOX11 (—), (c and d) Outcome for patients with HOX11-positive (- - - -) or HOX11-negative cells (—). P-values in (a) and (b) refer to comparison HOX11 high vs HOX11 negative.

Full figure and legend (48K)

Discussion

Half of the T-ALL patients studied here showed HOX11 expression in their leukaemia cells, indicating that this genetic aberration is one of the most common abnormalities in paediatric T-ALL. The recently reported aberrant expression of the HOX11L2 gene¹² reinforces the role of homeobox oncogenes in T-ALL. The gene most frequently affected in T-ALL is p16, which is deleted in more than 60% of the patients.^27,28

The findings presented in this study revealed that deregulation of the HOX11 gene occurred at a frequency much higher than that reported based on cytogenetic studies. Direct cytogenetic analysis of the patient specimens showing HOX11 expression indicated that only two of the 16 exhibited abnormalities at 10q24. These results confirm and extend our previously published findings on HOX11,¹⁶ and they implicate mechanisms other than chromosomal translocations involving the 10q24 locus for the deregulation of HOX11. Aberrant expression of several T-cell oncogenes in the absence of chromosomal abnormalities has recently been reported.⁶ Cytogenetically silent aberrations are not restricted to T-cell oncogenes, as several studies have provided evidence for similar findings involving TEL-AML1 and p16 in leukaemia.²⁹

There are a number of alternative mechanisms that may account for the deregulation of HOX11. These include subtle mutations in cis-regulatory sequences and translocation of enhancer elements from other genes, such as TCR into the HOX11 locus. Moreover, altered methylation status of the HOX11 promoter or trans-acting factors that control HOX11 gene transcription could lead to deregulation of the gene. Our recent studies demonstrated that demethylation of the promoter accompanies reactivation of the gene.³⁰ In addition, we identified several negative elements upstream of the HOX11 gene,³¹ but have so far failed to find evidence for their mutation in primary patient specimens. The high frequency of HOX11 deregulation in T-ALL suggests its involvement is a key pathway for leukaemogenesis. Future molecular diagnostics may make use of such leukaemia-specific markers as HOX11 to detect minimal residual disease. The findings presented in this study emphasise that deregulation of HOX11 expression is a critical step in one of the major pathways of leukaemogenesis in T-ALL. Intriguingly, the mechanisms leading to deregulation of HOX11, other than via translocations, are not known. Future studies will investigate the influence of chromatin configuration and possible trans-acting factors on HOX11 expression.

The results in Figure 1 show that expression levels in the primary patient specimens range over several orders of magnitude, confirming the findings by Ferrando et al.⁶ The specimens showing the highest levels were expressing HOX11 in the range determined for cell line PER-255 which exhibits a t(7;10)(q35;q24). For two specimens in this high-expressing group, karyotype information was available. One of them showed a deletion of chromosome 10, while the other one did not contain any abnormality affecting this chromosome. This finding demonstrates that specimens without chromosome 10 abnormalities can express the gene at a level similar to the cell line with a translocation involving the 10q24 locus. The use of the QRT-PCR technique revealed that HOX11 expression levels vary considerably among T-ALL specimens and that those scored here as expressing HOX11 at low levels were clearly above the control specimens. It is not known whether expression of HOX11 at a low level produces a qualitatively different effect from expression at high level. The question whether a threshold level of HOX11 expression may be required to exert a leukaemogenic effect warrants further investigations. Interestingly, a recently published report on mammalian HOX genes suggests that quantitative modulation of gene expression regulates their biological effect.³² Since transcriptional control is subject to the formation of DNA-binding complexes comprising several factors,³³ a leukaemogenic effect is presumed to be dependent not only on the level of HOX11 expression, but also on the presence of cooperating factors.

In this study, we made use of the most accurate and sensitive methodology available to measure expression of HOX11, QRT-PCR. Two recent studies reported the frequency of HOX11-expressing cases among T-ALL patients to be between 10 and 20%,^6,13 incidences similar to the percentage of patients determined to express HOX11 at high level in this study. There are many differences in the method for detection of gene expression among the three studies, and they are likely to account for the apparently higher sensitivity of our method, including QRT-PCR performed as multiplex reaction and the accurate assessment of background levels in this study. Our previous investigation documented that deregulation of HOX11 in ALL is strictly limited to T-ALL.¹⁶ Using the more sensitive method in this study, we were able to confirm that none of the specimens from B-lineage ALL patients showed expression of HOX11. The question whether or not HOX11 is expressed in normal T-cells has yielded inconsistent results.^10,24,25 To address the issue, we included 11 T-cell preparations from normal individuals and all of them were clearly negative for HOX11 expression. Our findings demonstrated unambiguously that normal T-cells do not express HOX11, confirming our previous results. The fact that HOX11 expression was not detected in normal lymphocytes excludes the possibility that the more sensitive technique simply picks up low-level background expression of the gene, rather, we have demonstrated that HOX11 expression is clearly linked to malignancy.

The identification of patients with increased risk of treatment failure is of great importance for the management of paediatric ALL patients. Modern multiagent therapy used in CCG studies showed no difference in late EFS outcome between T-ALL and B-lineage patients.³⁴ In a large study of 169 newly diagnosed T-ALL patients, chromosomal abnormalities, although frequently present, did not prove to be significant prognostic indicators.¹⁵ The present study showed that patients with leukaemia cells expressing HOX11 at high level tended to have better clinical outcome compared to the other patients in the study. Interestingly, this effect was statistically significant in a subgroup of patients treated for high-risk disease on CCG-1901. Notably, this group comprised patients whose leukaemia cells expressed HOX11 at high or at low level. In contrast, different outcome according to HOX11 status was not observed in another group of high-risk patients who were treated on CCG-1961. The New York regimen of CCG-1901 is based on the Norton–Simon principle of utilising rotating cycles of multiple noncross resistant agents to prevent the emergence of drug resistance. In particular, an induction phase based on early intensification with high-dose alkylators and a maintenance phase of cyclic pulses of a combination of eight agents is included. CCG-1961 is based on the BFM regimen utilising a standard four-drug induction, but is unique because of the introduction of a delayed reintensification phase approximately 4 months from diagnosis at the time of minimal leukaemic burden. Lastly, the maintenance phase of CCG-1961 consists of standard continuous oral antimetabolite therapy with monthly vincristine/steroid pulses. The different findings in this study for high-risk patients treated on these two therapy protocols suggest HOX11-expressing leukaemia cells to be more sensitive to certain multiagent therapies compared to HOX11-negative cells, and that prognostic indicators may lose their relevance for patients treated on different therapeutic protocols. Prominent examples have been documented and they include T-cell phenotype and unbalanced der(19)t(1;19), which historically were associated with poor outcome in childhood ALL patients. In recent years, the introduction of more intensive therapy has improved the outcome of patients whose leukaemia cells show these features.^34,35

It is of interest that a large study of 343 T-ALL patients found that patients with normal karyotype or t(10;14)(q24;q11) (involving the HOX11 locus) had a better survival rate.⁴ In agreement with the data presented here, a recent study on 58 T-ALL patients treated at St Jude Children's Research Hospital found that expression of HOX11 in leukaemic blasts was significantly associated with favourable prognosis.⁶ Taken together, HOX11 translocations or HOX11 upregulation appears to be associated with better survival; however, the effect may be dependent on the therapy used. This evidence for a delicate balance between genetic profile of cancer cells and responses to particular therapeutic protocols under-lines the general importance of developing more sophisticated approaches to matching molecular phenotype with treatment.

References

1. Heerema NA. Cytogenetics of leukemia. Cancer Invest 1998; 16(2): 127–134.
2. Raimondi SC, Behm FG, Roberson PK, Pui CH, Rivera GK, Murphy SB et al. Cytogenetics of childhood T-cell leukemia. Blood 1988; 72(5): 1560–1566. | PubMed | ISI | ChemPort |
3. Rowley JD, Reshmi S, Carlson K, Roulston D. Spectral karyotype analysis of T-cell acute leukemia. Blood 1999; 93(6): 2038–2042. | PubMed | ISI | ChemPort |
4. Schneider NR, Carroll AJ, Shuster JJ, Pullen DJ, Link MP, Borowitz MJ et al. New recurring cytogenetic abnormalities and association of blast cell karyotypes with prognosis in childhood T-cell acute lymphoblastic leukemia: a Pediatric Oncology Group report of 343 cases. Blood 2000; 96(1): 2543–2549. | PubMed | ISI | ChemPort |
5. Look AT. Oncogenic transcription factors in the human acute leukemias. Science 1997; 278(5340): 1059–1064. | Article | PubMed | ISI | ChemPort |
6. Ferrando AA, Neuberg DS, Staunton J, Loh ML, Huard C, Raimondi SC et al. Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia. Cancer Cell 2002; 1: 75–87. | Article | PubMed | ISI | ChemPort |
7. Kees UR, Lukeis R, Ford J, Garson OM. Establishment and characterization of a childhood T-cell acute lymphoblastic leukemia cell line, PER-255, with chromosome abnormalities involving 7q32-34 in association with T-cell receptor-beta gene rearrangement. Blood 1989; 74(1): 369–373. | PubMed | ChemPort |
8. Kennedy MA, Gonzalez-Sarmiento R, Kees UR, Lampert F, Dear N, Boehm T et al. HOX11, a homeobox-containing T-cell oncogene on human chromosome 10q24. Proc Nat Acad Sci USA 1991; 88(20): 8900–8904.
9. Dube ID, Kamel-Reid S, Yuan CC, Lu M, Wu X, Corpus G et al. A novel human homeobox gene lies at the chromosome 10 breakpoint in lymphoid neoplasias with chromosomal translocation t(10;14). Blood 1991; 78(11): 2996–3003. | PubMed | ISI | ChemPort |
10. Hatano M, Roberts CW, Minden M, Crist WM, Korsmeyer SJ. Deregulation of a homeobox gene, HOX11, by the t(10;14) in T cell leukemia. Science 1991; 253(5015): 79–82. | Article | PubMed | ISI | ChemPort |
11. Lu M, Gong ZY, Shen WF, Ho AD. The tcl-3 proto-oncogene altered by chromosomal translocation in T-cell leukemia codes for a homeobox protein. EMBO J 1991; 10(10): 2905–2910. | PubMed | ISI | ChemPort |
12. Bernard OA, Busson-LeConiat M, Ballerini P, Mauchauffe M, Della Valle V, Monni R et al. A new recurrent and specific cryptic translocation, t(5;14)(q35;q32), is associated with expression of the Hox11L2 gene in T acute lymphoblastic leukemia. Leukemia 2001; 15(10): 1495–1504. | Article | PubMed | ISI | ChemPort |
13. Ballerini P, Blaise A, Busson-Le Coniat M, Su XY, Zucman-Rossi J, Adam M et al. HOX11L2 expression defines a clinical subtype of pediatric T-ALL associated with poor prognosis. Blood 2002; 100(3): 991–997. | Article | PubMed | ISI | ChemPort |
14. Mauvieux L, Leymarie V, Helias C, Perrusson N, Falkenrodt A, Lioure B et al. High incidence of Hox11L2 expression in children with T-ALL. Leukemia 2002; 16(12): 2417–2422. | Article | PubMed | ISI | ChemPort |
15. Heerema NA, Sather HN, Sensel MG, Kraft P, Nachman JB, Steinherz PG et al. Frequency and clinical significance of cytogenetic abnormalities in pediatric T-lineage acute lymphoblastic leukemia: a report from the Children's Cancer Group. J Clin Oncol 1998; 16(4): 1270–1278. | PubMed | ISI | ChemPort |
16. Salvati PD, Ranford PR, Ford J, Kees UR. HOX11 expression in pediatric acute lymphoblastic leukemia is associated with T-cell phenotype. Oncogene 1995; 11(7): 1333–1338. | PubMed | ChemPort |
17. Gaynon PS, Desai AA, Bostrom BC, Hutchinson RJ, Lange BJ, Nachman JB et al. Early response to therapy and outcome in childhood acute lymphoblastic leukemia: a review. Cancer 1997; 80(9): 1717–1726. | Article | PubMed | ChemPort |
18. Holt PG, Kees UR, Shon-Hegrad MA, Rose A, Ford J, Bilyk N et al. Limiting-dilution analysis of T cells extracted from solid human lung tissue: comparison of precursor frequencies for proliferative responses and lymphokine production between lung and blood T cells from individual donors. Immunology 1988; 64(4): 649–654.
19. Kees UR, Ford J, Price PJ, Meyer BF, Herrmann RP. PER-117: a new human ALL cell line with an immature thymic phenotype. Leukemia Res 1987; 11(5): 489–498. | Article | ChemPort |
20. Hereema N, Palmer C, Baehner R. Karyotypic and clinical findings in a consecutive series of children with acute lymphoblastic leukemia. Cancer Genet Cytogenet 1985; 17: 165–179. | Article | PubMed | ChemPort |
21. Mitelman F. ISCN: an International System for Human Cytogenetic Nomenclature. Switzerland, Karger: Basel, 1995.
22. Kaplan E, Meier P. Nonparametric estimation from incomplete observations. J Am Statist Assoc 1958; 53: 457–481. | Article | ISI |
23. Peto R, Pike MC, Armitage P, Breslow NE, Cox DR, Howard SV et al. Design and analysis of randomized clinical trials requiring prolonged observation of each patient, II. analysis and examples. Br J Cancer 1977; 35(1): 1–39. | PubMed | ISI | ChemPort |
24. Zutter M, Hockett RD, Roberts CW, McGuire EA, Bloomstone J, Morton CC et al. The t(10;14)(q24;q11) of T-cell acute lymphoblastic leukemia juxtaposes the delta T-cell receptor with TCL3, a conserved and activated locus at 10q24. Proc Natl Acad Sci USA 1990; 87(8): 3161–3165. | PubMed | ChemPort |
25. Lu M, Zhang N, Ho AD. Genomic organization of the putative human homeobox proto-oncogene HOX-11 (TCL-3) and its endogenous expression in T cells. Oncogene 1992; 7(7): 1325–1330. | PubMed |
26. Smith M, Arthur D, Camitta B, Carroll AJ, Crist W, Gaynon P et al. Uniform approach to risk classification and treatment assignment for children with acute lymphoblastic leukemia. J Clin Oncol 1996; 14(1): 18–24. | PubMed | ISI | ChemPort |
27. Drexler HG. Review of alterations of the cyclin-dependent kinase inhibitor INK4 family genes p15, p16, p18 and p19 in human leukemia–lymphoma cells. Leukemia 1998; 12(6): 845–859. | Article | PubMed | ISI | ChemPort |
28. Kees UR, Burton PR, Lu C, Baker DL. Homozygous deletion of the p16/MTS1 gene in pediatric acute lymphoblastic leukemia is associated with unfavorable clinical outcome. Blood 1997; 89(11): 4161–4166. | PubMed | ISI | ChemPort |
29. Ferrando AA, Look AT. Clinical implications of recurring chromosomal and associated molecular abnormalities in acute lymphoblastic leukemia. Semin Hematol 2000; 37(4): 381–395. | Article | PubMed | ISI | ChemPort |
30. Watt PM, Kumar R, Kees UR. Promoter demethylation accompanies reactivation of the HOX11 proto-oncogene in leukemia. Genes Chromosomes Cancer 2000; 29(4): 371–377. | Article | PubMed | ISI | ChemPort |
31. Brake RL, Kees UR, Watt PM. Multiple negative elements contribute to repression of the HOX11 proto-oncogene. Oncogene 1998; 17(14): 1787–1795. | Article | PubMed | ChemPort |
32. Greer JM, Puetz J, Thomas KR, Capecchi MR. Maintenance of functional equivalence during paralogous Hox gene evolution. Nature 2000; 403(6770): 661–665. | Article | PubMed | ISI | ChemPort |
33. Mann RS, Chan SK. Extra specificity from extradenticle: the partnership between HOX and PBX/EXD homeodomain proteins. Trends Genet 1996; 12(7): 258–262. | Article | PubMed | ISI | ChemPort |
34. Uckun FM, Sensel MG, Sun L, Steinherz PG, Trigg ME, Heerema NA et al. Biology and treatment of childhood T-lineage acute lymphoblastic leukemia. Blood 1998; 91(3): 735–746. | PubMed | ISI | ChemPort |
35. Uckun FM, Sensel MG, Sather HN, Gaynon PS, Arthur DC, Lange BJ et al. Clinical significance of translocation t(1;19) in childhood acute lymphoblastic leukemia in the context of contemporary therapies: a report from the Children's Cancer Group. J Clin Oncol 1998; 16(2): 527–535. | PubMed | ISI | ChemPort |

Acknowledgements

The contributing cytogeneticists were S Schonberg, S Kerman, K Rao, J Biegel, K Theil, V Murty, D Warburton, A Murch, S Schwartz, B Hurang, M Thangavelu, R Blough, L McGavran, D Roulston, H Aviv, L McMorrow, K Richkind, S Jhanwar, B Hirsch, P Cotter, N Heerema, T Glover, S Sheldon. This work was supported by the Child Health Research Foundation and the Children's Leukaemia and Cancer Research Foundation, Western Australia, the Children's Cancer Group, Arcadia, CA, USA and partly funded by NIH Grants U10-CA79726 and CA83088.