Leukemia
SEARCH     advanced search my account e-alerts subscribe register
Journal home
Advance online publication
Current issue
Archive
Press releases
For authors
For referees
Contact editorial office
About the journal
For librarians
Subscribe
Advertising
naturereprints
Contact Springer Nature
Customer services
Site features
NPG Subject areas
Access material from all our publications in your subject area:
Biotechnology Biotechnology
Cancer Cancer
Chemistry Chemistry
Dentistry Dentistry
Development Development
Drug Discovery Drug Discovery
Earth Sciences Earth Sciences
Evolution & Ecology Evolution & Ecology
Genetics Genetics
Immunology Immunology
Materials Materials Science
Medical Research Medical Research
Microbiology Microbiology
Molecular Cell Biology Molecular Cell Biology
Neuroscience Neuroscience
Pharmacology Pharmacology
Physics Physics
Browse all publications
 
Journal home
Advance online publication
Current issue
Archive
Press releases
For authors
For referees
Contact editorial office
About the journal
For librarians
Subscribe
Advertising
naturereprints
Contact Springer Nature
Customer services
Site features
NPG Subject areas
Access material from all our publications in your subject area:
Biotechnology Biotechnology
Cancer Cancer
Chemistry Chemistry
Dentistry Dentistry
Development Development
Drug Discovery Drug Discovery
Earth Sciences Earth Sciences
Evolution & Ecology Evolution & Ecology
Genetics Genetics
Immunology Immunology
Materials Materials Science
Medical Research Medical Research
Microbiology Microbiology
Molecular Cell Biology Molecular Cell Biology
Neuroscience Neuroscience
Pharmacology Pharmacology
Physics Physics
Browse all publications
 
November 2002, Volume 16, Number 11, Pages 2275-2284
Table of contents    Previous  Article  Next   [PDF]
Original Manuscript
Brusatol-mediated induction of leukemic cell differentiation and G1 arrest is associated with down-regulation of c-myc
E Mata-Greenwood1,a,b, M Cuendet1,a, D Sher2, D Gustin2, W Stock2,c and J M Pezzuto1,3

1Department of Medicinal Chemistry and Pharmacognosy, College of Pharmacy, University of Illinois at Chicago, Chicago, IL, USA

2Division of Hematology/Oncology, University of Illinois at Chicago, Chicago, IL, USA

3Department of Surgical Oncology, College of Medicine, University of Illinois at Chicago, Chicago, IL, USA

Correspondence to: J M Pezzuto, Program for Collaborative Research in the Pharmaceutical Sciences (M/C 877), College of Pharmacy, University of Illinois at Chicago, 833 S Wood Street, Chicago, IL 60612, USA; Fax: (312) 996-2815

aE Mata-Greenwood and M Cuendet contributed equally to this work

bCurrent address: Department of Pediatrics Research, Northwestern University, Chicago, IL 60611, USA

cCurrent address: University of Chicago, Section of Hematology/Oncology, Chicago, IL 60637, USA

Abstract

Employing the natural product quassinoid brusatol, we currently report cellular and molecular events leading to cell death or terminal differentiation in a panel of leukemic cells. Brusatol and bruceantin exerted significant cytotoxic effects with several leukemic cell lines, but not with K562 or normal lymphocytic cells. Cell lines that were less sensitive to the cytotoxic effects of brusatol responded primarily through induction of terminal differentiation. The differentiated phenotype in cell lines derived from acute or chronic myeloid leukemias (HL-60, K562, Kasumi-1, NB4, U937, BV173) was characterized for producing superoxide and non-specific esterase, and some with up-regulation of CD13 (cluster of differentiation) and down-regulation of CD15. Chronic myeloid leukemic cell lines, K562 and BV173, and acute lymphoblastic cell lines, SUPB13 and RS4;11, were induced to differentiate along the erythrocytic pathway. Withdrawal studies showed that brusatol treatment for 48 h was sufficient to induce commitment towards terminal differentiation in HL-60, K562 and SUPB13. Reh cells did not undergo maturation. Analysis of c-MYC protein expression revealed that brusatol or bruceantin down-regulated expression to undetectable levels in cell lines that were most sensitive, based on cell death or terminal differentiation. Generally, c-myc RNA was reduced, but to a lower extent than c-MYC protein levels, indicating c-myc expression was regulated by quassinoids at the post-transcriptional level. Thus, regulation of c-myc expression may represent a critical event that leads to terminal differentiation. Since these responses are facilitated at clinically achievable concentrations, quassinoids may be of value for the management of hematological malignancies.

Leukemia (2002) 16, 2275-2284. doi:10.1038/sj.leu.2402696

Keywords

quassinoids; brusatol; cell differentiation; cytotoxicity; c-MYC

Introduction

The process of neoplastic cell growth can be depicted as a dysfunctional balance between control of cell proliferation, apoptosis and terminal differentiation. In normal cells, activation of specific pathways leads to cellular differentiation, which typically is accompanied by cell growth arrest followed by apoptosis. In many cancers, ie, leukemias, genetic changes (eg, chromosomal translocations, point mutations, gene amplifications or deletions) block the normal differentiation program.1 Conventional cytotoxic chemotherapy focuses on cell killing effects in order to achieve complete hematological remissions (ie, less than 5% blasts). In the past few years, however, several non-conventional selective anti-leukemic agents have been developed that function by targeting molecules involved directly in the pathogenesis of the disease. For instance, all-trans-retinoic acid (ATRA) has revolutionized the treatment of acute promyelocytic leukemia (APL); complete remissions are attained without marrow hypoplasia or exacerbation of fibrinolysis.2,3 Although the mechanism of ATRA is still under investigation, it is known that binding with its natural receptor, RARalpha, results in the induction of granulocytic differentiation followed by apoptosis in APL-derived leukemic blasts.4,5,6 Another selective agent, CGP57148B, inhibits enhanced Abelson leukemia (ABL) tyrosine kinase activity resulting from the BCR/ABL fusion gene that is characteristic of leukemias with the t(9;22); apoptosis is thereby induced selectively in these cases.7

Some genes have been shown to be important in the development or malignancy of various types of leukemia and lymphoma, by inducing blockages in differentiation or apoptosis. Among them, c-myc gene amplifications and translocations resulting in its deregulation have been noted, particularly in Burkitt's lymphoma and acute lymphoblastic leukemia (ALL).8,9 Studies using c-myc knockout cell lines and c-myc antisense RNA have shown that reducing c-myc slows cell growth and induces differentiation in various cell lines.10,11,12,13 Moreover, regulation of c-MYC protein levels has proven to be an essential mode of action for various inducers of cellular differentiation.14,15,16,17,18,19

Brusatol (Figure 1) is a quassinoid, ie, a type of degraded diterpenoid, obtained from Brucea species (Simaroubaceae). Brusatol and analogues are capable of inducing an array of biological responses including in vivo anti-inflammatory and antileukemic effects with murine models.20 The major mechanism responsible for antineoplastic activity at the molecular level has been attributed to inhibition of protein synthesis.21 Such inhibition has been shown to occur via interference at the peptidyltransferase site, thus preventing peptide bond formation.22 Other cellular targets include inhibition of phosphoribosyl pyrophosphate aminotransferase of the de novo purine synthesis pathway and inhibition of DNA/RNA synthesis.23 In order to assess toxicity, bruceantin (a structural analogue of brusatol) (Figure 1) was evaluated in three separate phase I clinical trials in patients with various types of solid tumors. Hypotension, nausea and vomiting were common side-effects at higher doses, but hematologic toxicity was moderate to insignificant and manifested mainly as thrombocytopenia.24,25 Bruceantin was then tested in two separate phase II trials including adult patients with metastatic breast cancer26 and malignant melanoma.27 No objective tumor regressions were observed and clinical trials were terminated.

In our program for the procurement of novel plant-derived chemotherapeutic/chemopreventive agents, we have used HL-60 cell differentiation activity as one marker of activity.28 This led to the identification of brusatol as a potent inducer of HL-60 cell differentiation.29 In order to test its potential efficacy as an anti-leukemic agent, we elected to evaluate the effect of brusatol with a panel of leukemic cells with representative chromosomal translocations and other gene mutations. Currently, we demonstrate that brusatol induces cell death events selectively in some cell lines, particularly those known to express wild-type p53, and induces terminal differentiation in the remaining cell lines. A significant finding was potent down-regulation of c-MYC oncoproteins; those cell lines expressing high levels of c-MYC oncoprotein were the most sensitive to brusatol-mediated effects. The decrease in c-MYC oncoprotein expression was due in part to transcriptional regulation, as shown by real-time RT-PCR, although the decrease in c-myc transcript levels was less than the decrease of c-MYC protein levels. The potent down-regulation of c-myc associated with terminal cell differentiation at physiologically achievable concentrations suggest that this compound is a strong candidate for leukemia chemotherapy.

Materials and methods

Materials

Brusatol was isolated from Brucea javanica25 and bruceantin was obtained from the NCI (Bethesda, MD, USA). 1alpha,25-Dihydroxyvitamin D3 (VD3) was supplied by Steroids (Chicago, IL, USA), and 12-O-tetradecanoylphorbol-13-acetate (TPA) was purchased from Chemsyn Science Laboratories (Lenexa, KS, USA). All other compounds were purchased from Sigma Chemical (St Louis, MO, USA). Test compounds were dissolved in DMSO (dimethylsulfoxide) and stored at -20°C. Cell culture medium was obtained from Gibco BRL (Gaithesburg, MD, USA). 3H Thymidine was obtained from Amersham Life Sciences (Arlington Heights, IL, USA). Primary antibody for c-MYC (cat. No. OP10) was purchased from Oncogene (Cambridge, MA, USA), and secondary antibody was from Amersham Life Sciences (Arlington Heights, IL, USA). Primary antibody for beta-actin was purchased from Sigma, USA and all reagents utilized for real time RT-PCR were from Applied Biosystems (Foster City, CA, USA).

Cell culture

HL-60, K562, U937, Reh and Daudi cells were obtained from the American Type Culture Collection (Rockville, MD, USA). Kasumi-1, NB4, BV173, SUPB13 and RS4;11 cells were provided by the Section of Hematology/Oncology, University of Illinois College of Medicine, Chicago, IL. All cell lines were maintained in suspension culture using RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum, 100 units of penicillin/ml and 100 mug of streptomycin/ml at 37°C in a humidified atmosphere of 5% CO2 in air. All cells were routinely tested for mycoplasma contamination.

Preparation of normal human lymphocytes

Human blood (20 ml) was collected in heparinized sterile tubes and white blood cells were separated using Ficoll reagent (8 ml/5 ml blood diluted in 15 ml Hank's buffered solution). After centrifugation at low speed (1500 r.p.m.) for 30 min, the white coat was removed and washed three-times with Hank's buffered solution. The cell pellet was resuspended in RPMI 1640 medium supplemented with 10% FBS. This preparation contained >90% lymphocytes and >5% monocytes as determined by Wright-Giemsa staining.

Cell differentiation assays

Cell lines were tested using a 4-day incubation protocol, unless otherwise specified. At the end of the incubation, cells were analyzed to determine the percentage exhibiting morphological, functional nitroblue tetrazolium (NBT) reduction, enzymatic non-specific/specific esterase (NSE/SE) and cell surface markers of differentiated cells, as described below.28

Cell morphology: Aliquots of the cell suspension (2 ´ 105 cells/ml) were used to prepare cytospin smears which were stained with Wright-Giemsa. Morphological features of cellular differentiation (change in cytoplasmic pH, decrease in size, decrease of nuclear/cytoplasm ratio (or absence of nucleus), presence of specific granules or lysosomal vacuoles, lobulated nucleus) were monitored by light microscopy.

NBT/NSE/SE: Evaluation of NBT reduction was used to assess the ability of sample-treated cells to produce superoxide when challenged with TPA. A 1:1 (v/v) mixture of a cell suspension (106 cells) and TPA/NBT solution (2 mg/ml NBT and 1 mug/ml TPA in phosphate buffer saline (PBS) ) was incubated for 1 h at 37°C. Then, cells were smeared on glass slides, and counterstained with 0.3% (w/v) safranin O in methanol. Positive cells reduce NBT yielding intracellular black-blue formazan deposits. NSE/SE are monocytic/granulocytic esterases that can be visualized by cytochemical staining using commercially available kits (alpha-Naphthyl Acetate Esterase and Naphthol As-D Chloroacetate Esterase kits, Sigma Chemical). Positive-stained cells were quantified by microscopic examination of >200 cells. Results were expressed as a percentage of positive cells.

Determination of cell surface antigen by flow cytometry: Cells (106) were washed with PBS and then incubated for 30 min at room temperature with respective monoclonal antibodies, washed with 20 volumes of diluent (PBS with 0.1% sodium azide and 1% BSA), and resuspended in 0.5 ml of fresh diluent for evaluation. Necrotic cells were excluded from the analysis by propidium iodide (PI) staining. The following mAbs (Sigma) were used to assess the maturation level of myeloid cell lines: anti-CD15 (Leu M1), anti-CD-11b (OKM1), anti-CD14 and anti-CD13.30 The following mAbs (Sigma) were used to assess the maturation level of lymphocytic cell lines: anti-CD20, anti-HLA-DR and anti-kappa light chain.

Cell growth and viability assays

Cellular viability was monitored by Trypan blue exclusion. Inhibition of 3H thymidine incorporation into DNA was determined to assess the level of cell proliferation as well as DNA synthesis inhibition. Cells were treated with test samples for 4 days and then placed into 96-well plates (100 mul) and treated with 3H thymidine (0.5 muCi/ml, 65 Ci/mmol) for 18 h at 37°C in a 5% CO2 incubator. Cells were then collected on glass fiber filters using a TOMTEC Harvester 96. The filters were counted using a Microbeta liquid scintillation counter (Wallac, Turku, Finland) with scintillation fluid. Finally, the percentage of 3H thymidine incorporation per 106 cells was calculated by dividing the d.p.m. of sample-treated cells by the d.p.m. of DMSO-treated cells.

Analysis of DNA content with flow cytometry

About 106 cells from each sample were collected and washed twice with ice-cold PBS, fixed in 70% ethanol, and stored at 4°C until analysis. The cells were stained with PI (50 mug/ml), treated with DNase-free RNase (10 mug/ml), and subjected to DNA content analysis using an EPICS Coulter flow cytometer. At least 10 000 cells were counted for each sample. The percentage of apoptotic cells was calculated by measuring the area under the subdiploid (DNA <2 N) peak in the plot of cell number against cellular DNA content.31

Immunoblotting

The expression of c-MYC was assessed by immunoblots as previously described.32 In brief, cells (106) were treated and harvested at various time intervals, and whole-cell pellets were lysed with detergent lysis buffer (1 ml/107 cells, 50 mM Tris-HCl buffer, pH 8.0, 150 mM NaCl, 1 mM DTT, 0.5 mM EDTA, 1% Nonidet P40, 0.5% sodium deoxycholate, 0.1% sodium dodecylsulfate, 100 mug/ml phenylmethylsulfonyl fluoride, 1 mug/ml aprotinin, 2 mug/ml leupeptin and 100 muM sodium vanadate) to obtain protein lysates. Protein concentrations were quantified using a bicinchoninic acid kit. Since c-MYC is a labile protein, cell lysates were not frozen, but stored at 4°C, until all protein lysates were prepared for a particular cell line, and then Western blots were performed immediately. Total protein (30 mug) was separated by 10% SDS-PAGE, electroblotted to PVDF membranes, and blocked overnight with 5% non-fat dry milk. The membrane was incubated with a solution of the primary antibody (2.5 mug/ml), prepared in 1% blocking solution, for 2 h at room temperature, washed three times for 15 min with PBS-T (PBS with 0.1%, v/v, Tween 20), and incubated with a 1:2500 dilution of horseradish peroxidase-conjugated secondary antibody for 30 min at 37°C. Blots were again washed three times for 10 min each in PBS-T and developed by enhanced chemiluminescence (Amersham). Membranes were exposed to Kodak Biomax film and the resulting film was analyzed using Kodak (Rochester, NY, USA) 1D Image Analysis software. Membranes were then stripped and reprobed for the quantification of beta-actin.

RT-PCR analysis

RNA was extracted from 106 cells using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). Following isopropanol precipitation, the pellet was washed in 75% aqueous ethanol and the RNA was dissolved in 25 mul of diethyl pyrocarbonate (DEPC)-treated distilled water. Subsequently, the samples were stored at -80°C. RNA quantitation was performed by UV measurement at 260 nm. The cDNA synthesis was performed in a total volume of 10 mul, containing 1 ´ TaqMan RT buffer, 5.5 muM MgCl2, 2 mM dNTPs mixture, 2.5 muM random hexamers, 4 U RNase inhibitor, 12.5 U MultiScribe RT (Perkin Elmer/Applied Biosystems) and 0.2 mug of RNA. The reaction was performed for 10 min at 25°C, followed by 48°C for 30 min and a 5 min incubation step at 95°C. After the reaction, 10 mul of DEPC-treated distilled water was added to each sample and 1 mul was used for each PCR.

The PCR and subsequent analyses were performed in the GeneAmp 5700 Sequence Detection System (Applied Biosystems). Real-time quantitation was performed using the TaqMan technology of Applied Biosystems. c-Myc primers and probe sequences (5' to 3') were as follows: CGTCTCCACACATCAGCACAA, TCTTGGCAGCAGGATAGTCCTT and TACGCAGCGCCTCCCTCCACTC (Applied Biosystems).

PCR reactions were performed in triplicate. The PCR reaction mixture contained 300 nM of both primers, 150 nM TaqMan probe, and 1 ´ TaqMan Universal Master Mix (Applied Biosystems). The reactions were first incubated at 50°C for 2 min, followed by 10 min at 95°C. The PCR itself consisted of 40 cycles with 15 s at 95°C and 1 min at 60°C each. The fluorescence signal was measured during the last 30 s of the annealing/extension phase. After the PCR, a fluorescence threshold value was set and threshold cycle (Ct) values were determined, ie, the fractional cycle at which the fluorescence signal reached this threshold. These values were used for further calculations.

beta-Actin (TaqMan PDAR control; Applied Biosystems) was used as an endogenous reference to correct for any differences in the amount of total RNA used for a reaction and to compensate for different levels of inhibition during reverse transcription of RNA into cDNA. c-Myc and beta-actin expression were related to a standard curve derived from a serial dilution of K562 cDNA with dH2O. Also, c-myc and beta-actin quantities were expressed in terms of ng of K562 RNA yielding the same level of expression. Subsequently, normalization was achieved by dividing the expression level of c-myc by the beta-actin expression level. Finally, results were expressed as a percentage, where the level of c-myc observed in the DMSO-treated samples was considered as 100%.

Results

Cytotoxic and antiproliferative effects of brusatol on normal human lymphocytes and leukemic cells

A panel of 11 leukemic cell lines showing various chromosomal aberrations (Table 1) was selected and the effects of brusatol and bruceantin on cell viability and proliferation were tested. Evaluation of viability using the Trypan blue exclusion method demonstrated that brusatol was preferentially cytotoxic to the NB4, U937, BV173, SUPB13, RS4;11, Daudi and DHL-6 cell lines, showing IC50 values of less than 25 ng/ml (Table 1). On the other hand, HL-60, Kasumi-1 and Reh cell lines showed increased resistance to cytotoxic effects with IC50 values in the range of 50-100 ng/ml. K562 and normal lymphocytic cells (stimulated with concanavalin A) were the least sensitive of all cells tested, demonstrating approximately 90% viability after 4 days of treatment with 100 ng/ml of brusatol (Table 1). Bruceantin (2, Figure 1), which differs from brusatol (1, Figure 1) by two methyl groups in the ester side chain at C-15, was more potent than brusatol in all cell lines tested (Table 1). There was no obvious correlation between cytotoxic activity and a particular chromosomal aberration.

We then examined the effects of brusatol on proliferation of normal human lymphocytes or leukemic cells by incorporation of 3H thymidine into DNA over an 18 h incubation period, subsequent to exposure to various concentrations of brusatol for 4 days. Brusatol inhibited the proliferation of normal human lymphocytes, HL-60, K562, Kasumi-1, SUPB13, RS4;11 and Reh cells in a dose-dependent manner (Table 1). Interestingly, these cell lines represent those that were most resistant to brusatol-mediated cytotoxicity, while the compound actually increased the amount of radioactive precursor incorporation in some cytotoxic-sensitive cell lines such as NB4, U937, BV173 and Daudi (data not shown).

In accordance with 3H thymidine incorporation data, brusatol (25 ng/ml) significantly induced G1 arrest (with concomitant decreases in S and/or G2/M phases) in asynchronious HL-60, K562, Kasumi-1, BV173, SUPB13 and Reh cells (Table 2), and the G1 block was complete at 72 h using a higher dose of 100 ng/ml (data not shown). NB4 and BV173 cells showed sub-G1 peaks characteristic of apoptosis while U937 and RS4;11 cells did not (Table 2), although loss of viability (as determined by Trypan blue exclusion) was similar for all four cell lines. Interestingly, U937 and RS4;11 cells showed a decrease in the G1 phase and a significant increase in the S phase, characteristic of metabolic arrest.

Induction of differentiation by brusatol with various myeloid and lymphoblastic cell lines

Previous studies performed in our laboratory demonstrated that brusatol was able to induce differentiation of HL-60 cells in a concentration-dependent fashion.29 In the current study, cells were treated with various concentrations of brusatol for 4 days and then harvested for evaluation of functional, enzymatic and cell membrane markers of differentiation.

Analysis of NBT reduction for evaluation of superoxide formation demonstrated myeloid maturation in five cell lines (HL-60, K562, NB4, U937 and BV173). The effect was dose-dependent, as shown in Figure 2a. Peak inductions of 75% were observed in HL-60 and K562 cells. In addition, brusatol up-regulated the expression of NSE (a monocytic marker) in K562, Kasumi-1 and NB4 by approximately 50%, and in BV173 cells by approximately 35% (Figure 2b).

We also analyzed membrane phenotype using flow cytometry with a set of four myeloid markers (CD11b, CD13, CD14 and CD15). Brusatol up-regulated CD11b in HL-60 and U937 cells, CD13 in HL-60, NB4 and U937 cells, and CD14 only in U937 cells, and down-regulated CD15 in HL-60, K562, NB4, U937 and RS4;11 cells (Table 3). Thus, it was noted that brusatol induced a pattern of expression similar to that produced by macrophage inducers, with down-regulation of CD15 (granulocytic marker) and up-regulation of CD13 and CD11b (granulocytic/monocytic markers) in HL-60 and U937 cells (Table 3).

It was of interest to note morphological changes characteristic of erythroid differentiation in two lymphoblastic cell lines (SUPB13 and RS4;11) as was shown for CML cell lines K562 and BV173 (ie, smaller cells devoid of nuclei with a pinkish-bluish cytoplasm, Figure 3a). Erythrophagocytosis by adjacent cells is also evident in some of the cell lines undergoing erythroid differentiation (Figure 3a). This finding was supported by the production of hemoglobin in these cells, as shown by benzidine staining (Figure 3b). Hemoglobin was up-regulated dose dependently in SUPB13 and RS4;11 cells, as well as the CML cell lines K562 and BV173 (Figure 3b).

Finally, we analyzed various membrane markers of B lymphocyte maturation (ie, CD20, superficial light chain kappa and HLA-DR) in SUPB13, RS4;11, Reh, Daudi and DHL-6. Few changes were observed, but brusatol induced a small increase in CD20 with DHL-6 cells [197.5 control vs 225.3 brusatol (5 ng/ml), specific mean fluorescence intensity], and a larger increase of HLA-DR in Daudi cells [92.5 control vs 244.9 brusatol (10 ng/ml), specific mean fluorescence intensity]. These preliminary data suggest brusatol enhances B cell maturation.

Irreversibility of brusatol effects on differentiation or cell death of leukemic cells

The irreversibility of brusatol effects on growth and differentiation of HL-60 cells was tested using withdrawal assays during a 4 day experiment. Withdrawal of brusatol after 48 h of exposure resulted in the induction of 41% of cells to differentiate (compared to 46% without withdrawal), while maintaining cellular viability higher than 80% and the same cell density (0.21 ´ 106) as time zero (Figure 4). The percentage of cells induced to mature is similar for time exposures of 48, 72 or 96 h, indicating that there is no further need for the presence of the compound after 48 h, where cells have become committed to differentiate. However, the viability percentages were greatly reduced with increasing time of exposure to the drug (82% at 48 h; 56% at 72 h; 45% at 96 h), indicating the cytotoxic effect is cumulative (Figure 4). Therefore, when comparing the concentration required to induce 50% of cells to differentiate with the concentration needed to kill 50% of cells using 4-day or 2-day exposure protocols, a 10-fold increase in selectivity was observed when the 2-day protocol was used (differentiation induction ED50 = 17.5 ng/ml for both protocols; cytotoxic IC50 = 25 ng/ml for a 4-day protocol and 250 ng/ml for a 2-day protocol). Similar effects of withdrawing brusatol were observed in other cell lines, such as K562 and SUPB13, where commitment toward differentiation was obtained with 48 h of exposure to brusatol (data not shown). Withdrawal studies also demonstrated that 48 h of brusatol (25 ng/ml) treatment is sufficient to induce 100% cytotoxicity in NB4, Daudi and DHL-6 cells, but not in the remaining cell lines (data not shown).

Brusatol down-regulates c-myc

Since c-myc deregulation is involved in blockage of differentiation and proliferation, we analyzed the status of c-myc in 10 cell lines after a short exposure (4 or 24 h) to brusatol (25 ng/ml) or bruceantin (10 ng/ml). The level of c-MYC protein was high in control samples of HL-60, K562, Kasumi-1, SUPB13, Reh and Daudi cells (Figure 5). Moderate levels of c-MYC protein were observed in NB4, U937, BV173 and RS4;11 cells. Brusatol and bruceantin induced down-regulation of c-MYC protein levels in all cell lines, but greatest reduction occurred in HL-60, K562, NB4, U937, BV173, RS4;11 and Daudi cells (Figures 5 and 6, Table 4). In contrast, c-MYC protein levels in Kasumi-1, SUPB13 and Reh cells were reduced to a lesser extent when treated with brusatol (Figures 5 and 6, Table 4). Cytotoxic-sensitive cell lines NB4, U937, BV173, RS4;11 and Daudi cells showed marked decreases of c-MYC at 24 h, while those cell lines that manifested terminal differentiation (HL-60, K562 and SUPB13) showed the lowest levels of c-MYC protein at 4 h. Interestingly, brusatol also down-regulated c-MYC expression in normal human lymphocytes, although control levels were low (data not shown).

Analysis of c-myc mRNA using real time RT-PCR revealed that brusatol and bruceantin produced minor effects on the transcriptional regulation of c-myc in those cell lines where protein expression was markedly reduced (Figure 6, Tables 4 and 5). For example, a 4 h treatment with brusatol induced a decrease in c-myc mRNA levels by ~40 and ~50% in K562 and HL-60 cells, respectively. However, c-MYC protein levels were decreased by 94 and 100%, respectively. It is important to note that both protein and mRNA evaluations were performed in a parallel fashion, therefore avoiding experimental errors due to compound stability and cell line senescence. These data suggest that brusatol and bruceantin are affecting translational regulation of c-myc expression. Interestingly, the opposite effect was observed in Kasumi-1 and SUPB13 cells, where c-myc transcript levels were significantly reduced, but c-MYC protein expression was similar to control (solvent-treated) samples (Figure 6, Tables 4 and 5).

Discussion

We currently demonstrate the potential of brusatol and bruceantin to induce differentiation, antiproliferative and differential cytotoxic effects in a panel of 11 leukemic cell lines. Cell growth and differentiation studies with this panel revealed two patterns of activity. One group of cell lines, namely HL-60, K562, Kasumi-1 and Reh, were less responsive to brusatol- or bruceantin-mediated cytotoxicity, but their growth was arrested at the G1 phase. Furthermore, these cells (with the exception of Reh) demonstrated some degree of differentiation, based on one or more markers of this process. The second group, comprised of NB4, U937, BV173, SUPB13, RS4;11, Daudi and DHL-6 cells, were extremely sensitive to brusatol or bruceantin, as shown by marked cytotoxic effects, but with little induction of differentiation. Cell cycle analyses demonstrated apoptotic peaks with NB4 and BV173, an arrest in G1 phase with SUPB13, and an arrest in S phase with U937 and RS4;11, suggesting different cytotoxic mechanisms may be triggered. Although the reason for the difference in the response of the various cell lines is unknown, it was observed that brusatol exerted strong cytotoxicity in those cell lines reported to express wild-type p53, including NB4, U937, BV173 and Daudi,43,44,45 while some of the less sensitive cell lines have been reported to be p53-null or mutant p53-expressing cell lines, eg, HL-60, K562, Kasumi-1 and Reh.43,44,45,46,47

The mechanism of action of various differentiation and apoptosis inducers remains largely unknown, but the participation of certain key genes have been demonstrated for some active compounds, such as ATRA and CGP 57148.6,7 Evaluation of c-myc mRNA and protein expression in our panel of leukemic cell lines revealed brusatol- and bruceantin-induced marked decreases. However, with the exceptions of Kasumi-1, SUPB13 and Reh cells, down-regulation of c-myc mRNA was less intense than the decrease observed with c-MYC protein levels. These data suggest translational (eg, regulation of the internal ribosome entry segment of c-myc mRNA) and/or post-translational (eg, ubiquitination by proteasome complexes) regulation of this oncogene. Brusatol- and bruceantin-mediated early down-regulation of c-MYC correlated with induced differentiation in various cell lines, including monocytic differentiation in HL-60, K562, NB4 and U937, and moderate erythrocytic differentiation in BV173, K562, SUPB13, and RS4;11.

The biological consequences of down-regulating c-myc are numerous. In the hematopoietic system, this gene inhibits differentiation11,12,13 and functions as a leukemogenic protein in various lymphomas and leukemias.8,48 Moreover, it is known that deregulation of c-myc, in conjunction with p53 and bcl-2 mutations, is associated with a malignant phenotype.49 For instance, chronic myelogenous leukemia cell lines possessing negligible levels of wild-type p53 (like K562) also expressed high levels of c-myc,43 while the reverse phenomenon was observed in CML cell lines that express high levels of wild-type p53 (such as BV173). These and other studies have led to the hypothesis that myc deregulation decreases the probability of maturation, while p53 and bcl-2 mutations enhance cell survival, therefore favoring leukemic cell renewal.49 Some studies, using c-myc knockout cells or mice, support the idea that c-myc down-regulation results in withdrawal from the cell cycle with a G1 arrest. Therefore, c-MYC functions as a switch that promotes entry into and prevents exit from the cell division cycle; it is not essential for cellular growth, but controls the commitment of cells to divide or not to divide.50,51,52 In this study, cell growth arrest at the G1 or S phases correlated with decreases of c-MYC in HL-60, K562, U937, BV173, RS4;11 and Reh cells. Thus, we speculate that brusatol triggered cell death mechanisms preferentially in those cell lines with wild-type p53 protein expression, while terminal differentiation was triggered in cell lines without wild-type p53 or with mutant p53.

In summary, we have shown that quassinoids mediate strong cytotoxic effects in various cell lines while sparing normal human lymphocytes, and inhibit proliferation primarily by producing a G0/G1 arrest. This arrest is associated with subsequent expression of various markers of differentiation, and differentiation effects are irreversible following 48 h drug exposures. In addition, cell lines that were most sensitive to brusatol-mediated cytotoxicity were eliminated with only 48 h of exposure. Notably, cytotoxic or differentiating effects were observed in the concentration range of 10 to 100 ng/ml, and 25 ng/ml seemed to be a sufficient in vitro concentration (10 ng/ml for bruceantin) to mediate these growth inhibitory responses. This is of importance since pharmacokinetic studies with human beings have demonstrated that a single intravenous injection of 3 mg/m2 bruceantin can yield a blood level of 22 ng/ml.20 Moreover, this dose was well tolerated with few side-effects, including a lack of hematologic toxicity,24 and normal lymphocytes were considerably less sensitive to the cytotoxic effects of brusatol or bruceantin. These observations suggest that a non-toxic concentration of brusatol administered for a short exposure time is sufficient to induce differentiation followed by cell death without the necessity of prolonged treatments. Biological responses correlate with potent down-regulation of c-MYC. Presently, studies are underway with animal models of leukemia to access the in vivo activity of these quassinoids. For example, activity has been demonstrated with the in vivo hollow fiber model53 with HL-60 cells (data not shown). If similar mechanisms are found to apply in these models, a compelling argument would exist for evaluating clinical usefulness in patients with hematological malignancies.

Acknowledgements

Some of the data described in this manuscript were presented at the 91st Annual AACR Meeting, San Francisco, CA, April 1-5, 2000. The authors are grateful to the Drug Synthesis and Chemistry Branch, Developmental Therapeutics Program, Division of Treatment, National Cancer Institute, for the provision of bruceantin and to Dr K Hagen of the Research Resources Center (UIC) for analysis of samples by flow cytometry. Support for this work was provided by grant P01 CA48112 awarded by the National Cancer Institute.

References

1 Sachs L. Constitutive uncoupling of pathways of gene expression that control growth and differentiation in myeloid leukemia: a model for the origin and progression of malignancy. Proc Natl Acad Sci USA 1980; 77: 6152-6156. MEDLINE

2 Huang M-E, Ye Y-C, Chen S-R, Chai J-R, Lu J-X, Lin Z, Gu L-J, Wang Z-Y. Use of all-trans retinoic acid in the treatment of acute promyelocytic leukemia. Blood 1988; 72: 567-572. MEDLINE

3 Warrell RP, de Thé H, Wang Z-Y, Degos L. Acute promyelocytic leukemia. N Engl J Med 1993; 329: 177-189. Article MEDLINE

4 Weis K, Rambaud S, Lavau C, Jansen J, Carvalho T, Carmo-Fonseca M, Lamond A, Dejean A. Retinoic acid regulates aberrant nuclear localization of PML-RARalpha in acute promyelocytic leukemia cells. Cell 1994; 76: 345-356. MEDLINE

5 Daniel MT, Koken M, Romagné O, Barbey S, Bazarbachi A, Stadler M, Guilemin MC, Degos L, Chomienne C, de Thé H. PML protein expression in hematopoietic and acute promyelocytic leukemia cells. Blood 1993; 82: 1858-1867. MEDLINE

6 Dyck JA, Maul GG, Miller WH Jr, Chen JD, Kakizuka A, Evans RM. A novel macromolecular structure is a target of the promyelocyte-retinoic acid receptor oncoprotein. Cell 1994; 76: 333-343. MEDLINE

7 Dan S, Naito M, Tsuruo T. Selective induction of apoptosis in Philadelphia chromosome-positive chronic myelogenous leukemia cells by an inhibitor of BCR-ABL tyrosine kinase, CGP 57148. Cell Death Differ 1998; 5: 710-715.

8 Dalla Favera R, Bregni M, Erikson J, Patterson D, Gallo RC, Croce CM. Assignment of the human c-myc oncogene to the region of chromosome 8 which is translocated in Burkitt lymphoma cells. Proc Natl Acad Sci USA 1982; 79: 7824-7827. MEDLINE

9 Ar-Rushdi A, Nishikura K, Erikson J, Watt R, Rovera G, Croce CM. Differential expression of the translocated and of the untranslocated c-myc oncogene in Burkitt lymphoma. Science 1983; 222: 390-393. MEDLINE

10 Ryan KM, Birnie GD. Myc oncogenes: the enigmatic family. Biochem J 1996; 314: 713-721. MEDLINE

11 Collins JF, Herman P, Schuch C, Bagby GC Jr. c-Myc antisense oligonucleotides inhibit the colony-forming capacity of Colo320 colonic carcinoma cells. J Clin Invest 1992; 9: 1523-1527.

12 Negroni A, Scarpa S, Romeo A, Ferrari S, Modesti A, Raschella G. Decrease of proliferation rate and induction of differentiation by a MYCN antisense DNA oligomer in a human neuroblastoma cell line. Cell Growth Differ 1991; 2: 511-518.

13 Nguyen HQ, Selvakumaran M, Liebermann DA, Hoffman B. Blocking c-Myc and Max expression inhibits proliferation and induces differentiation of normal and leukemic myeloid cells. Oncogene 1995; 11: 2439-2444.

14 Stöcker U, Schaefer A, Marquardt H. DMSO-like rapid decrease in c-myc and c-myb mRNA levels and induction of differentiation in HL-60 cells by the anthracycline antitumor antibiotic aclarubicin. Leukemia 1995; 9: 146-154. MEDLINE

15 Kharbanda SM, Sherman ML, Spriggs DR, Kufe DW. Effects of tiazofurin on protooncogene expression during HL-60 cell differentiation. Cancer Res 1988; 48: 5965-5968.

16 Baker SJ, Pawlita M, Leutz A, Hoelzer D. Essential role of c-myc in ara-C induced differentiation of human erythroleukemia cells. Leukemia 1994; 8: 1309-1317. MEDLINE

17 Linevsky J, Cohen MB, Hartman KD, Knode MC, Glazer RI. Effect of neplanocin A on differentiation, nucleic acid methylation, and c-myc mRNA expression in human promyelocytic leukemia cells. Mol Pharmacol 1985; 28: 45-50.

18 Rabbits A, Watson JV, Lamond A, Forster A, Stinson A, Evan G, Fischer W, Atherton E, Sheppard E, Rabbitts TH. Metabolism of c-myc gene products: c-myc mRNA and protein expression in the cell cycle. EMBO J 1985; 4: 2009-2015. MEDLINE

19 Spotts GD, Hann SR. Enhanced translation and increased turnover of c-myc proteins occur during differentiation of murine erythroleukemia cells. Mol Cell Biol 1990; 8: 3952-3964.

20 Tang W, Eisenbrand G. Brucea javanica (L.) Merr. In: W Tang, Eisenbrand G (eds). Chinese Drugs of Plant Origin: Chemistry, Pharmacology, and Use in Traditional and Modern Medicine Springer-Verlag: Berlin, 1992, 207-222.

21 Liao LL, Kupchan SM, Horwitz SB. Mode of action of the antitumor compound bruceantin, an inhibitor of protein synthesis. Mol Pharmacol 1976; 12: 167-176.

22 Fresno M, Gonzales A, Vazquez D, Jimenez A. Bruceantin, a novel inhibitor of peptide bond formation. Biochim Biophys Acta 1978; 518: 104-112.

23 Hall IH, Lee KH, Eigebaly SA, Imakura Y, Sumida Y, Wu RY. Antitumor agents XXXIV: mechanism of action of bruceoside A and brusatol on nucleic acid metabolism of P-388 lymphocytic leukemia cells. J Pharm Sci 1979; 68: 883-887.

24 Liesmann J, Belt RJ, Haas CD, Hoogstraten B. Phase I study on bruceantin administered on a weekly schedule. Cancer Treat Rep 1981; 65: 883-885.

25 Bedikian AY, Valdivieso M, Bodey GP, Murphy WK, Freireich EJ. Initial clinical studies with bruceantin. Cancer Treat Rep 1979; 63: 1843-1847.

26 Wiseman CL, Yap HY, Bedikian AY, Bodey GP, Blumenschein GR. Phase II trial of bruceantin in metastatic breast carcinoma. Am J Clin Oncol 1982; 5: 389-391.

27 Arsenau JC, Wolter JM, Kuperminc M, Ruckdeschel JC. A Phase II study of bruceantin (NSC 165563) in advanced malignant melanoma. Invest New Drugs 1983; 1: 239-242.

28 Suh N, Luyengi L, Fong HHS, Kinghorn AD, Pezzuto JM. Discovery of natural product chemopreventive agents utilizing HL-60 cell differentiation as a model. Anticancer Res 1995; 15: 233-240.

29 Luyengi L, Suh N, Fong HHS, Pezzuto JM, Kinghorn AD. A lignan and four terpenoids from Brucea javanica that induce differentiation with cultured HL-60 promyelocytic leukemia cells. Phytochemistry 1996; 43: 409-412.

30 Trayner ID, Bustorff T, Etches AE, Mufti GJ, Foss Y, Farzaneh F. Changes in antigen expression on differentiating HL-60 cells treated with dimethylsulfoxide, all-trans retinoic acid, 1alpha,25-dihydroxyvitamin D3 or 12-O-tetradecanoyl phorbol 13-acetate. Leuk Res 1998; 22: 537-547. MEDLINE

31 Vindeløv LL, Christensen IJ, Nissen NI. A detergent-trypsin method for the preparation of nuclei for flow cytometric DNA analysis. Cytometry 1983; 3: 323-327. MEDLINE

32 Richon VM, Webb Y, Merger R, Sheppard T, Jursic B, Ngo L, Civoli F, Breslow R, Rifkind RA, Marks PA. Second generation hybrid polar compounds are potent inducers of transformed cell differentiation. Proc Natl Acad Sci USA 1996; 93: 5705-5708. Article MEDLINE

33 Collins SJ. The HL-60 promyelocytic leukemia cell line: proliferation, differentiation, and cellular oncogene expression. Blood 1987; 70: 1233-1244. MEDLINE

34 Lozzio CB, Lozzio BB. Human chronic myelogenous leukemia cell-line with positive Philadelphia chromosome. Blood 1975; 45: 321-334. MEDLINE

35 Asou H, Tashiro S, Hamamoto K, Otsuji A, Kita K, Kamada N. Establishment of a human acute myeloid leukemia cell line (Kasumi-1) with 8;21 chromosome translocation. Blood 1991; 77: 2031-2036. MEDLINE

36 Lanotte M, Martin-Thouvenin V, Najman S, Balerini P, Valensi F, Berger R. NB4, a maturation inducible cell line with t(15;17) marker isolated from a human acute promyelocytic leukemia (M3). Blood 1992; 77: 1080-1085.

37 Sundström C, Nilsson K. Establishment and characterization of a human histiocytic lymphoma cell line (U-937). Int J Cancer 1976; 17: 565-577. MEDLINE

38 Pegoraro L, Matera L, Ritz J, Levis A, Palumbo A, Biagini G. Establishment of a Ph1-positive human cell line (BV173). J Natl Cancer Inst 1983; 70: 447-453. MEDLINE

39 Naumovski L, Morgan R, Hecht F, Link MP, Glader BE, Smith SD. Philadelphia chromosome-positive acute lymphoblastic leukemia cell lines without classical breakpoint cluster region rearrangement. Cancer Res 1988; 48: 2876-2879. MEDLINE

40 Abe R, Sandberg A. Significance of abnormalities involving chromosomal segment 11q23-25 in acute leukemia. Cancer Genet Cytogenet 1984; 13: 121-126. MEDLINE

41 Shurtleff SA, Buijs A, Behm FG, Rubnitz JE, Raimondi SC, Hancock ML, Chan G-F, Pui C-H, Grosveld G, Downing JR. TEL/AML1 fusion resulting from a cryptic t(12;21) is the most common genetic lesion in pediatric ALL and defines a subgroup of patients with an excellent prognosis. Leukemia 1995; 9: 1985-1989. MEDLINE

42 Epstein AL, Levy R, Kim H, Henle W, Henle G, Kaplan HS. Biology of the human malignant lymphomas. Cancer 1978; 42: 2379-2391. MEDLINE

43 Bocchia M, Xu Q, Wesley U, Xu Y, Korontsvit T, Loganzo F, Albino AP, Scheinberg DA. Modulation of p53, WAF1/p21 and BCL-2 expression during retinoic acid-induced differentiation of NB4 promyelocytic cells. Leuk Res 1997; 21: 439-447. MEDLINE

44 Lbbert M, Miller CW, Crawford L, Koeffler HP. p53 in chronic myelogenous leukemia. J Exp Med 1988; 167: 873-886. MEDLINE

45 Hendrikse AS, Hunter AJ, Keraan M, Blekkenhorst GH. Effects of low dose irradiation on TK6 and U937 cells: induction of p53 and its role in cell-cycle delay and the adaptive response. Int J Radiat Biol 2000; 76: 11-21.

46 Furuwatari C, Yagi A, Yamagami O, Ishikawa M, Hidaka E, Ueno I, Furihata K, Ogiso Y, Katsuyama T. A comprehensive system to explore p53 mutations. Am J Clin Pathol 1998; 110: 368-373. MEDLINE

47 Aldridge DR, Radford IR. Explaining differences in sensitivity to killing by ionizing radiation between human lymphoid cell lines. Cancer Res 1998; 58: 2817-2824. MEDLINE

48 Boxer LM, Dang CV. Translocations involving c-myc and c-myc function. Oncogene 2001; 20: 5595-5610. Article MEDLINE

49 Adams JM, Cory S. The Bcl-2 protein family: arbiters of cell survival. Science 1991; 254: 1161-1167. MEDLINE

50 de Alboran IM, O'Hagan RC, Gaertner F, Malynn B, Davidson L, Rickert R, Rajewsky K, DePinho RA, Alt FW. Analysis of c-MYC function in normal cells via conditional gene-targeted mutation. Immunity 2001; 14: 45-55. MEDLINE

51 Trumpp A, Refaeli Y, Oskarsson T, Gasser S, Murphy M, Matin GR, Bishop JM. C-Myc regulated mammalian body size by controlling cell number but not cell size. Nature 2001; 414: 768-773.

52 Adachi S, Obaya AJ, Han Z, Ramos-Desimone N, Wyche JH, Sedivy JM. C-Myc is necessary for DNA damage-induced apoptosis in the G2 phase of the cells cycle. Mol Cell Biol 2001; 21: 4929-4937.

53 Hollingshead MG, Alley MC, Camalier RF, Abbott BJ, Mayo JG, Malspeis L, Grever MR. In vivo cultivation of tumor cells in hollow fibers. Life Sci 1995; 57: 131-141. MEDLINE

Figures

Figure 1 Chemical structures of brusatol and bruceantin.

Figure 2 Brusatol induces monocyte-like characteristics in various acute and chronic myeloid leukemic cells. Concentration-dependent effect of brusatol on (a) NBT reduction (monocyte/granulocyte marker) of HL-60, K562, NB4, U937 and BV173 and (b) NSE expression (monocyte marker) in K562, Kasumi-1, NB4 and BV173 cells, respectively. Data points are the mean of duplicate samples.

Figure 3 Brusatol induces erythrocytic differentiation in chronic myeloid cell lines K562 and BV173 and acute lymphoblastic SUPB13 and RS4;11 cell lines. (a) Morphological changes characteristic of erythroid differentiation were visualized by Wright-Giemsa staining for K562, BV173, SUPB13 and RS4;11 cells. Control cells and brusatol (25 ng/ml for K562 and SUPB13 and 5 ng/ml for BV173 and RS4;11)-treated cells were harvested at day 4 of incubation; differentiated cells are shown with an arrow. (b) Concentration-dependent effect of brusatol on hemoglobin expression of CML and ALL cell lines. K562, BV173, SUPB13 and RS4;11 cells were incubated with varying concentrations of brusatol for 4 days and then analyzed for expression of hemoglobin using the benzidine staining method. Data points are the mean of duplicate samples.

Figure 4 Commitment toward differentiation of HL-60 cells is obtained at 48 h of exposure to brusatol. The assay lasted for 4 days (96 h) and then cells were analyzed for viability and differentiation markers. HL-60 cells were treated with 25 ng/ml of brusatol which was withdrawn after the indicated time intervals, and cells were resuspended in fresh complete media for the remaining time. Results are shown as the mean of duplicate samples (± standard deviation).

Figure 5 Brusatol down-regulates c-myc expression. Cells were treated with solvent (0.1% v/v DMSO, control), brusatol (25 ng/ml) or bruceantin (10 ng/ml) for 4 or 24 h, and then analyzed by Western blotting. Membranes were probed for c-MYC, and then stripped and probed for beta-actin as an internal control. Densitometric analyses are summarized in Table 4.

Figure 6 Cells were treated with brusatol (25 ng/ml) or bruceantin (10 ng/ml) for 4 or 24 h, and then analyzed for c-myc mRNA and protein expression (Tables 4 and 5). Results are shown as a percentage of c-myc mRNA or protein expression, relative to levels observed in cells treated with solvent (0.1%, v/v, DMSO) only.

Tables

Table 4 Effect of brusatol and bruceantin on c-MYC oncoprotein expression in various leukemic cell lines

Table 1 In vitro effects of brusatol and bruceantin on cell growth and proliferation of various established leukemic cell lines and peripheral human lymphocytes

Table 2 Cell cycle effects of brusatol with various leukemic cell lines

Table 3 Effect of brusatol on the membrane phenotype of myeloid cell lines

Table 5 Effect of brusatol and bruceantin on c-myc mRNA levels in various leukemic cell lines

Received 27 June 2001; accepted 30 May 2002
November 2002, Volume 16, Number 11, Pages 2275-2284
Table of contents    Previous  Article  Next    [PDF]