Nature Publishing Group, publisher of Nature, and other science journals and reference works NATURE.COM NATURE NEWS NATUREJOBS NATUREEVENTS ABOUT NPG
Help Nature.com site index  
Leukemia
SEARCH     advanced search my account e-alerts subscribe register
Journal home
Advance online publication
Current issue
Archive
Press releases
For authors
For referees
Contact editorial office
About the journal
For librarians
Subscribe
Advertising
naturereprints
Contact NPG
Customer services
Site features
NPG Subject areas
Access material from all our publications in your subject area:
Biotechnology Biotechnology
Cancer Cancer
Chemistry Chemistry
Dentistry Dentistry
Development Development
Drug Discovery Drug Discovery
Earth Sciences Earth Sciences
Evolution & Ecology Evolution & Ecology
Genetics Genetics
Immunology Immunology
Materials Materials Science
Medical Research Medical Research
Microbiology Microbiology
Molecular Cell Biology Molecular Cell Biology
Neuroscience Neuroscience
Pharmacology Pharmacology
Physics Physics
Browse all publications
 
December 2001, Volume 15, Number 12, Pages 1868-1877
Table of contents    Previous  Article  Next   [PDF]
Original Manuscript
Sensitization to TRAIL-induced apoptosis and modulation of FLICE-inhibitory protein in B chronic lymphocytic leukemia by actinomycin D
A Olsson1, T Diaz1, M Aguilar-Santelises2, A Österborg3, F Celsing3, M Jondal1 and L M Osorio1

1Microbiology and Tumor Biology Center, Karolinska Institutet, Stockholm, Sweden

2Women's Hospital, ENH Research Institute, Evanston, USA

3Department of Hematology and Infectious Diseases, Karolinska Hospital, Stockholm, Sweden

Correspondence to: L M Osorio, Microbiology and Tumorbiology Center (MTC), S-171 77, Box 280, Karolinska Institutet, Stockholm, Sweden; Fax: +46 8 302258

Abstract

Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a potent activator of the cell death pathway and exerts tumoricidal activity in vivo with minimal toxicity. In order to investigate the therapeutic potential of TRAIL in B chronic lymphocytic leukemia (B-CLL) we have analyzed the expression of TRAIL receptors (TRAIL-Rs) in leukemic cells from B-CLL patients and their in vitro sensitivity to apoptosis induced by recombinant human TRAIL. We have found TRAIL-R1 and -R2 death receptor, and TRAIL-R3 and -R4 decoy receptor mRNA expression in most of the 57 B-CLL patients studied (R1 82%, R2 100%, R3 96% and R4 82%). TRAIL-R1 and R2 proteins were expressed on the surface and within the cells, whereas R3 and R4 decoy receptors were almost exclusively expressed in the cytoplasm. Despite TRAIL death receptor expression, B-CLL cells were relatively resistant to induction of apoptosis by recombinant human TRAIL (300 ng/ml). However, the susceptibility to TRAIL-induced apoptosis was increased by treatment of B-CLL cells with actinomycin D (Act D). Western blot analysis showed higher constitutive expression of the long form of FLICE-inhibitory protein (FLIPL) in B-CLL as compared to normal tonsillar B cells. Act D treatment down-regulated both long and short FLIP expression, which was correlated with the increase in B-CLL sensitivity to TRAIL. Although the surface TRAIL death receptor expression was up-regulated both by cell culture and by Act D treatment, the changes were not correlated with a gain in susceptibility to TRAIL. In addition, neither decoy receptors nor Bcl-2 expression were affected by Act D. Our findings suggest the possible involvement of FLIP in regulating TRAIL-mediated apoptosis in B-CLL. Leukemia (2001) 15, 1868-1877.

Keywords

B-CLL; progression; apoptosis; TRAIL

Introduction

The TNF-related apoptosis-inducing ligand (TRAIL) is a type II membrane protein belonging to the TNF superfamily, capable of inducing apoptotic cell death in a variety of cell types.1 Four distinct cell surface TRAIL receptors (TRAIL-Rs) have been identified, including TRAIL-R1/DR4,2 TRAIL-R2/DR5/TRICK2,3,4,5 TRAIL-R3/DcR1/TRID3,5,6,7 and TRAIL-R4/DcR2.8,9 TRAIL-R1 and -R2 contain a cytoplasmic death domain and signal for apoptotic cell death upon receptor cross-linking. In contrast, neither TRAIL-R3 nor -R4 contains a complete cytoplasmic death domain, which makes them unable to signal for cell death. TRAIL-R3 and TRAIL-R4 are believed to inhibit TRAIL-induced apoptosis either by acting as decoy receptors or by providing inhibitory signals such as activation of the transcription factor NF-kappaB.2,5,6,8,9,10

Recombinant soluble forms of TRAIL are potent mediators of tumor cell apoptosis, but exert minimal cytotoxicity toward normal tissues.11,12 TRAIL and TRAIL-Rs are constitutively expressed in various normal human tissues, but the expression of the decoy receptors is minimal in malignant cells.4,5,8 Therefore, it has been proposed that the expression of these receptors may determine the cell susceptibility to TRAIL-mediated apoptosis.2,5,6,8,9 In addition to levels of expression and function of TRAIL-Rs, intracellular proteins that inhibit activation of caspases may be relevant for susceptibility to TRAIL-induced apoptosis.10,11,13 Among them are viral FLICE-inhibitory proteins (v-FLIP) and the human homologue called c-FLIP/Casper/I-FLICE/FLAME-1/CASH/MRIT/CLARP/Usurpin, which belong to the group of apoptosis inhibitory molecules.14,15 Several c-FLIP splice variants exist at the mRNA level, but only two endogenous forms, FLIPL and FLIPS, have been detected at the protein level.15 FLIPL is structurally similar to procaspase-8, containing two death effector domains (DED) and a caspase-like domain, but lacks residues necessary for catalytic activity. FLIPS possesses two DEDs but no caspase-like domain.15 Both FLIP variants are able to block procaspase-8 activation at the death-inducing signaling complex (DISC) and protect cells from death receptor-mediated apoptosis.15,16,17 FLIP has been demonstrated to play a role in protection from apoptosis in a number of systems, especially those involving lymphoid cells. High expression of FLIP promotes tumor growth and facilitates immune escape of tumors.18,19 Constitutive, increased FLIP expression has also been correlated with resistance to TRAIL in primary and transformed cells.11,20,21 In addition to FLIP, other intracellular anti-apoptotic proteins, such as Bcl-2, Bcl-xL and IAP caspase inhibitors, may be important to determine tumor susceptibility to TRAIL-induced apoptosis.22,23

A high proportion of hematopoietic and non-hematopoietic tumor cell lines is sensitive to cytotoxic effects of TRAIL in vitro.10 Systemic administration of TRAIL can reduce tumor growth and induce regression of tumor cell xenografts, without the toxic side-effects seen after administration of FasL or TNF.12,24 B chronic lymphocytic leukemia (B-CLL) is characterized by the progressive accumulation of monoclonal CD5+ B lymphocytes in peripheral blood, bone marrow and lymphoid tissues.25 The clinical course of B-CLL is highly variable, ranging from a long-term stable disease, requiring no therapy, to a rapidly progressing condition with significant morbidity and mortality.26 It has been suggested that the accumulation of leukemic B cells results from uncharacterized defects in the apoptotic process, leading to a decreased rate of cell death.27 B-CLL cells are relatively resistant to Fas-mediated apoptosis28,29 and show a variable sensitivity to drug-induced apoptosis.30,31 The overall Bcl-2/Bax ratio may determine chemosensitivity of B-CLL cells30,31,32 and our previous studies support a regulatory role of Bcl-2/Bax in the survival of B-CLL cells.33,34 However, the mechanisms behind the resistance of B-CLL cells to apoptosis are largely still undefined. In the present study, we have investigated the sensitivity of B-CLL to TRAIL-mediated apoptosis. We found that, despite the expression of TRAIL death receptors, B-CLL cells are relatively resistant to TRAIL-induced apoptosis. However, inhibition of RNA synthesis by actinomycin D (Act D) increased the sensitivity of the leukemic cells to TRAIL, which correlated with a down-regulation of both long and short FLIP protein expression.

Materials and methods

Reagents

Actinomycin D and pronase E were purchased from Sigma Chemical (St Louis, MO, USA). Primers for TRAIL-R1, -2, -3, and -4 PCR amplification were synthesized by Eurogentec Bel (Seraing, Belgium). G3PDH primers were synthesized by Biosource Europe (Fleurus, Belgium). 3,3'- dihexyloxacarbocyanine iodide (DiOC6(3)) was from Molecular Probes (Eugene, OR, USA). Annexin-V-Fluos was from Roche Molecular Biochemicals (Mannheim, Germany). RNAzol B was from Biotecx Laboratories (Houston, TX, USA). Recombinant human TRAIL (LZ-TRAIL) was kindly supplied by Immunex (Seattle, WA, USA) as a leucine zipper fusion protein, which required no further cross-linking for maximal activity. Recombinant human soluble TRAIL (rhsTRAIL) from Alexis (Läufelfingen, Switzerland) was also used, in conjunction with an enhancer antibody (Alexis) to increase its activity.

Antibodies

Peroxidase-conjugated rabbit anti-goat Ig, fluorescein isothiocyanate (FITC)-conjugated F(ab')2 fragment of rabbit anti-mouse Ig, FITC-F(ab')2 fragment of rabbit anti-human IgM, phycoerythrin (PE)-conjugated anti-CD19, anti-CD3-PE, and anti-CD25-PE were from Dakopatts (Copenhagen, Denmark). Anti-CD5-PE and IgG1-FITC/IgG2a-PE simultest were from Becton Dickinson (Mountain View, CA, USA). Goat polyclonal antibody to human TRAIL-R2 and rat monoclonal antibody to human FLIP were from Alexis. Mouse monoclonal antibody to Bcl-2 (clone 124) was from Upstate Biotechnology (Lake Placid, NY, USA). Actin (1-19) goat polyclonal antibody was from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The mAbs against human TRAIL-R1 (IgG2a, huTRAILR1-M271), TRAIL-R2 (IgG1, huTRAILR2-M413), TRAIL-R3 (IgG1, huTRAILR3-M430) and TRAIL-R4 (IgG1, huTRAILR4-M445) were supplied by Immunex.13 Purified mouse IgG2a and IgG1 isotype control immunoglobulins were from Pharmingen (San Diego, CA, USA).

Patients

Fifty-seven B-CLL patients, 24 women and 33 men, with a mean age of 73 years (range 54 to 89 years) were included in this study. All patients had a monoclonal B cell fraction (kappa or lambda light chains) and were staged according to Rai.35 Patients were considered to have progressive disease, according to a modification of the criteria by the NCI Committee,36 if there was progression during the preceding 3 months in disease-related anemia (Hb <100 g/l), in thrombocytopenia (platelet count <100 ´ 109/1) and/or in spleen/liver/lymph node size (evaluated by both clinical examination and computer tomography of the abdomen) and/or in more than a doubling of the blood lymphocyte counts and/or appearance of constitutional symptoms. When these criteria were not fulfilled, B-CLL patients were defined as having non-progressive disease.

Cell lines and cell separation

The Jurkat T cell line, and the K562 cell line were purchased from American Tissue Culture Collection (Manassas, VA, USA). Murine B lymphoma A20 cell lines transfected with human FLIPL, human FLIPS or with an empty vector were kindly provided by Prof A Grandien (Stockholm University, Sweden). Cell lines were cultured in RPMI 1640 medium supplemented with 2 mM glutamine, 100 U/ml penicillin, 100 mug/ml streptomycin and 10% FCS. Murine B lymphoma A20 cell lines were cultured in the presence of 50 muM 2-mercaptoethanol. Leukemic B cells and unfractionated normal B cells were isolated from heparinized blood of B-CLL patients after informed consent and from tonsil tissue, respectively. Lymphocytes were obtained after carbonyl iron treatment and Lymphoprep centrifugation, and T cells depleted by rosetting with sheep erythrocytes. Isolated cells were kept frozen in aliquots. Isolated non-rosetting, leukemic B cells contained less than 0.2% CD3+ cells as estimated by flow cytometry.

Cell phenotype

Isolated cells from all B-CLL patients were phenotyped by immunofluorescence and flow cytometry. Cells (1 ´ 106) were incubated for 30 min at 4°C with anti-CD5-PE, anti-CD19-PE, anti-CD25-PE, anti-CD3-PE, or FITC-F(ab')2 anti-human IgM. FITC/PE-conjugated simultest was used as control. All samples were analyzed in a Becton Dickinson FACScan system equipped with an argon laser, using 10 000 cells for each determination. B-CLL cells were positively stained as follows: 95 ± 5.4% CD5, 97.8 ± 3% CD19, 59.2 ± 34% CD25 and 59 ± 32% IgM.

Flow cytometry analysis for TRAIL-R

Cells (1 ´ 106) were incubated for 30 min at 4°C with appropriate concentrations of TRAIL-R mAbs in 100 mul of PBS with 1% bovine serum albumin (BSA). Cells were washed twice with PBS plus 1% BSA and then incubated with FITC-F(ab')2 fragment of rabbit anti-mouse Ig for 30 min at 4°C. Intracellular staining was done as described elsewhere.37 Briefly, cells were fixed with 4% paraformaldehyde for 10 min, permeabilized with 0.1% saponin in PBS with 0.1% BSA and stained for 30 min at 4°C with TRAIL-R mAbs. The cells were washed and stained with FITC-F(ab')2 fragment of rabbit anti-mouse Ig for 30 min at 4°C. Cells incubated with irrelevant mouse IgG1 or IgG2a Ig were used as negative controls. After washing, the cells were analyzed by flow cytometry. Forward and side scatter gates were set to exclude dead cells.

In order to distinguish between membrane bound and intracellular TRAIL receptors, we performed TRAIL-R1 staining in both permeabilized and non-permeabilized B-CLL cells, as described above, following treatment with pronase enzyme (8 mg/ml) for 2 h at 8°C. Pronase treatment completely eliminated TRAIL-R1 expression on the cell surface in non-permeabilized cells, as compared to non-treated cells. However, TRAIL-R1 was detected in both pronase-treated and non-treated cells, fixed and permeabilized cells (data not shown). Thus, the procedure discriminated between intracellular and membrane expression.

Apoptosis

Tumor sensitivity to TRAIL was assayed by incubating Jurkat cells or isolated B cells in 96-well plates (0.4 ´ 106 cells/well) with LZ-TRAIL (1-300 ng/ml) or with rhsTRAIL plus the enhancer (2 mug/ml) for 24 and 48 h. In some experiments nontoxic concentrations of Act D were added to the culture medium immediately before addition of TRAIL. Apoptosis was determined by annexin-V staining. Cells were washed with PBS and incubated for 10 min in 100 mul of binding buffer (10 mM Hepes/NaOH, pH 7.4, 140 mM NaCl, 5 mM CaCl2) containing annexin V-Fluos solution and 2 mug/ml propidium iodide. Without washing, 300 mul of binding buffer were added and cells were analyzed with FACScan. Apoptosis was also determined by evaluating loss in the mitochondrial transmembrane potential (DeltaPsim) with DiOC6(3) staining.38 Cells were incubated with DiOC6(3) (40 nM in PBS) for 30 min at 37°C, washed with cold PBS and directly analyzed with cytofluorometer.

Western blot analysis

Cells were lysed at 4°C in lysis buffer (5 M NaCl, 1 M Tris pH 8, 0.5% Triton X-100, 2 mM PMSF and 10 mug/ml leupeptin for TRAIL-R2 blots and 1.2% NP-40, 150 mM NaCl, 25 mM Hepes, 0.5% deoxycholat, 5 mM NaF, 2 mM PMSF and 10 mug/ml leupeptin for FLIP blots), followed by high-speed centrifugation to remove cellular debris. Protein concentration was determined using the Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA, USA). Equal amounts of protein were separated on SDS-PAGE and electroblotted on to nitrocellulose (Bio-Rad) or PVDF (Amersham Pharmacia Biotech, Piscataway, NJ, USA) membranes for probing against TRAIL-R2 and FLIP, respectively. Ponceau S (Sigma) staining was used to control equal protein loading. After blocking for 1 h in 5% nonfat dry milk in PBS-Tween-20 (0.05%, v/v) immunodetection of TRAIL-R2 or FLIP was done using goat anti-human TRAIL-R2 antibody (1:500) or rat anti-human FLIP monoclonal antibody (1:1000), followed by horseradish peroxidase-conjugated rabbit anti-goat Ig (1:1000) or rabbit anti-rat Ig (1:1000). Anti-actin goat polyclonal antibody was used to control protein loading. The membranes used for detection of FLIP were sequentially probed with anti-actin antibody and mouse anti-Bcl-2 followed by peroxidase-conjugated anti-goat and anti-mouse antibodies, respectively, stripping between each detection with 2% SDS in PBS containing 2 muM 2-mercaptoethanol. Blots were washed and developed by chemiluminescence according to the manufacturer's protocol (ECL; Amersham Pharmacia Biotech). For quantification, the blots were subjected to Multi-Imager analysis using the Image Quant software (Molecular Dynamics, Sunnyvale, CA, USA).

RT-PCR for human TRAIL receptors

Total RNA was extracted from 10 ´ 106 isolated B cells with RNAzol B and quantified by spectrophotometry. Three micrograms of total RNA were denatured and reverse transcribed using random hexanucleotides. Thereafter, 1 mul (75 ng) of cDNA was amplified in a 20 mul PCR reaction mixture. The PCR was performed using the following sense and antisense primers: G3PDH (983 bp), 5'TGAAGGTCGGAG TCAACGGATTTGGT3' and 5'CATGTGGGCCATGAGGT CCACCAC3'; TRAIL-R1 (506 bp), 5'CTGAGCAACGCAGAC TCGCTGTCCAC3' and 5'TCCAAGGACACGGCAGAGCCT GTGCCAT3'; TRAIL-R2 (512 bp), 5'GCCTCATGGACAATGA GATAAAGGTGGCT3' and 5'CCAAATCTCAAAGTACGCA CAAACGG3'; TRAIL-R3 (612 bp), 5'GAAGAATTTGGT GCCAATGCCACTG3' and 5'CTCTTGGACTTGGCTGGGA GATGTG3'; TRAIL-R4 (464 bp), 5'CTTTTCCGGCGGCGTTC ATGTCCTTC3' and 5'GTTTCTTCCAGGCTGCTTCCCTTT GTAG3'. PCR was performed for 38 cycles, 1 min 94°C, 1 min 60°C and 1 min 72°C for G3PDH; 30 cycles, 1 min at 94°C, 1 min at 55°C and 1 min at 72°C for TRAIL-R1 and -R2 and 39 cycles, 1 min at 95°C, 1 min 57°C and 1 min 72°C for TRAIL-R3. TRAIL-R4 cycle conditions were 95°C for 4 min 15 s, followed by 30 cycles of 95°C for 45 s, 60°C for 45 s, and 72°C for 45 s. The samples were then resolved on a 2% agarose gel with 1 mug/ml of ethidium bromide and photographed. Densitometric analysis was performed using Image Quant software (Molecular Dynamics) and mRNA levels were normalized to G3PDH mRNA expression.

Statistical analysis

Estimation of statistical differences was done with the Wilcoxon signed rank test for paired samples. Pearson's coefficient of correlation was used to analyze correlations between independent observations and two-tailed statistical significances were determined.

Results

TRAIL receptor mRNA expression in B-CLL cells

mRNA expression of TRAIL-R1 and -R2 death receptors, and TRAIL-R3 and -R4 decoy receptors was analyzed in 57 B-CLL patients (28 progressive and 29 non-progressive) by RT-PCR, using oligonucleotide primers derived from unique regions in each TRAIL receptor sequence.11 Upon this analysis the following mRNA expression patterns were observed: 82% of the patients (47/57) expressed TRAIL-R1, 100% expressed TRAIL-R2, 96% (55/57) expressed TRAIL-R3 and 82% (47/57) expressed TRAIL-R4. There was no correlation between overall TRAIL-R1 or -R4 mRNA expression and progression of the disease. However, semiquantitative analysis showed significantly higher levels of TRAIL-R1 and -R4 mRNA in progressive patients in comparison to non-progressive B-CLL patients (mean; s.d.: 0.95; 0.9 vs 0.51; 0.6 for TRAIL-R1; 1.02; 0.8 vs 0.54; 0.6 for TRAIL-R4, P < 0.03; Figure 1). Significant differences were also observed in mRNA levels of TRAIL-R1 and -R4 between patients in stage 0 and stage III (mean; s.d.: 0.4; 0.7, n = 15 vs 1.16; 1.1, n = 8 for TRAIL-R1, P < 0.01; 0.6; 0.6, n = 15 vs 1.2; 0.6, n = 8 for TRAIL-R4, P < 0.03).

B-CLL cells express TRAIL receptor proteins but are resistant to TRAIL-induced apoptosis

Signals transduced through either TRAIL-R1 or TRAIL-R2 are necessary and sufficient to induce TRAIL-mediated cell death.13 It has been postulated that TRAIL interaction with the decoy receptors, TRAIL-R3 and -R4 results in inhibition of TRAIL-induced cell death.5 We first examined TRAIL receptor protein expression by flow cytometry in permeabilized and non-permeabilized B-CLL cells. Representative flow cytometry histograms from four patients are shown in Figure 2 and a summary from 15 B-CLL patients is shown in Table 1. All the B-CLL cells expressed TRAIL-R1 and -R2 on the cell surface and most of them also within their cytoplasm, which was correlated with mRNA expression. Cells from 10 B-CLL patients previously studied by flow cytometry and from an additional three B-CLL patients (L-244, L-243 and L-249) were also positive for TRAIL-R2 protein by Western blot analysis (Figure 3). Results on decoy receptor protein expression by flow cytometry showed low or no expression of TRAIL-R4 in both permeabilized and non-permeabilized B-CLL cells (Figure 2 and Table 1). B-CLL cells were also negative or weakly positive for TRAIL-R3 protein on the cell surface, but TRAIL-R3 was detected at high levels in permeabilized cells (Figure 2 and Table 1).

We next analyzed the susceptibility of B-CLL cells to TRAIL-induced apoptosis by using annexin-V staining in B-CLL cells treated for 24 and 48 h with a range of concentrations (1-300 ng/ml) of LZ-TRAIL. TRAIL-sensitive Jurkat cells39 were used as positive controls. B-CLL cells were found to be relatively resistant to apoptosis even at 300 ng/ml of LZ-TRAIL (Table 1, Figure 4 and data not shown), which was chosen for further experiments. Only 3/8 patients (L-252, L-233 and L-263) showed more than 25% increase in percentage of apoptotic cells after TRAIL treatment, as compared to their controls (Table 1 and Figure 4). Treatment of B-CLL cells with rhsTRAIL added with an enhancer to cross-link TRAIL, yielded similar results (not shown). Apoptosis was also analyzed by DiOC6(3) staining, which produced similar results (not shown). Regression analyses of the data from the patients in Table 1 showed a correlation between the surface protein expression of TRAIL-R2 and TRAIL-induced apoptosis (r = 0.56, P = 0.043; r = 0.64, P = 0.023, for 24 and 48 h, respectively). Our results demonstrate that B-CLL resistance to TRAIL-induced apoptosis is not due to absence of TRAIL death receptors.

Actinomycin D increases B-CLL cell sensitivity to TRAIL-induced apoptosis

Sub-toxic concentrations of the RNA synthesis inhibitor Act D are known to increase the level of sensitivity of some cell types to Fas-, TNFalpha- or TRAIL-mediated cytotoxicity.11,40 Therefore, we examined the effect of Act D on TRAIL-mediated apoptosis in B-CLL cells by treating them with a non-toxic concentration of Act D, followed by 300 ng/ml of LZ-TRAIL and measuring apoptosis by annexin-V staining after 24 and 48 h. A significant increase in TRAIL-induced apoptosis was observed after 24 h (P < 0.006, Figure 4a), and more evidently after 48 h (P < 0.001, Figure 4b), of Act D treatment in comparison to cells treated with TRAIL or Act D alone. The treatment of B-CLL cells with Act D alone induced a statistically significant increase in the percentage of apoptotic cells as compared with the control, after both 24 h and 48 h (P < 0.01, Figure 4). These results suggest that TRAIL-death receptors expressed in B-CLL cells are functional and Act D sensitizes B-CLL cells to TRAIL-induced apoptosis.

Act D down-regulates the expression of FLIPL and FLIPS, but not TRAIL-Rs or Bcl-2 in B-CLL cells

To investigate the mechanism of sensitization of B-CLL cells to TRAIL by Act D, we examined the effect of Act D on the expression of TRAIL-Rs, and the anti-apoptotic proteins, FLIP and Bcl-2. Surface and intracellular TRAIL-R expression was examined by FACS analysis. Surprisingly, the expression of TRAIL-R1 and TRAIL-R2 was increased after 18 h culture of the cells in medium alone, as compared to constitutive basal expression, and TRAIL-R2 was further slightly increased after 18 h of Act D treatment. However, these changes were not correlated with the Act D-induced gain in the susceptibility of B-CLL cells to TRAIL-mediated apoptosis (not shown). The expression of TRAIL-R3 and -R4 was not affected by cell culture or by Act D treatment (not shown). Thus, modulation of TRAIL-Rs expression does not seem to be one mechanism associated with the Act D-induced increase in the B-CLL susceptibility to TRAIL-mediated apoptosis.

FLIP and Bcl-2 proteins have been reported to confer resistance to TRAIL-mediated apoptosis in some cell types.11,21,41,42 Therefore, we used Western blot analysis to examine first the constitutive expression of the long (55 kDa) and the short (28 kDa) forms of FLIP in B-CLL cells and then the effect of Act D on FLIPL, FLIPS and Bcl-2 expression in B-CLL sensitized to TRAIL by Act D treatment. All the B-CLL cells examined expressed constitutive levels of FLIPL, which were higher in 10/11 cases than in the normal tonsillar B cells used as control (Figure 5). FLIPS was instead found undetectable or at very low levels both in B normal and in B-CLL cells, with only 4/11 B-CLL showing evident expression (L-241, L-260, L-251 and L-252). Regression analysis using FLIP relative intensities (FLIP/beta-actin ratio) revealed no correlation between FLIP expression in B-CLL cells and sensitivity to TRAIL, or spontaneous apoptosis.

To further investigate the role of FLIP in TRAIL-induced apoptosis and in the sensitization to TRAIL by Act D, lysates from L-263, L-239, L-260 and L-241 B-CLL cells cultured in medium alone or in the presence of Act D for various periods of time, were subjected to Western blot analysis. Apoptosis induced by TRAIL was examined simultaneously by annexin-V staining. Both FLIPL and FLIPS were spontaneously up-regulated during in vitro culture of all B-CLL cells (Figure 6). A decrease in FLIPL expression was observed in L-263 and L-239 after 24 h, and more evidently after 48 h of Act D treatment (Figure 6a and 6b). Down-regulation of FLIPL was observed after 48 h of Act D treatment in L-260 and L-241 cells (Figure 6c and 6d), which correlated with the kinetics of Act D sensitization to TRAIL-induced apoptosis (Figure 4). Act D did not show any substantial effect on FLIPL expression and TRAIL-induced apoptosis during early time points or at 18 h (Figure 6 and not shown). FLIPS was decreased after 6-18 h of Act D treatment, and almost disappeared after 48 h, which is clearly observed in L-263 cells (Figure 6). A band with approximately 43 kDa of size was observed in the B-CLL cell blotting (Figure 5) and in some cell lysates from Act D and TRAIL-treated cells (Figure 6). This band could represent the p43 cleaved form of FLIPL15,16,17 or nonspecific staining. Western blot analysis did not indicate differences in Bcl-2 expression between non-treated and Act D-treated B-CLL cells (not shown). Our results demonstrate that Act D down-regulates FLIPL and FLIPS expression and increases TRAIL-induced apoptosis. The correlation between these two effects further suggests that modulation of FLIP could be one of the mechanisms associated with the sensitization to TRAIL-mediated apoptosis induced by Act D.

Discussion

We have studied TRAIL-mediated cell death in B-CLL and demonstrated that although B-CLL cells express TRAIL death receptors, they are relatively resistant to TRAIL-induced apoptosis. We also showed that B-CLL cells become more susceptible to TRAIL after Act D treatment. Previous studies suggested that the sensitivity to TRAIL-induced apoptosis is regulated by the presence or absence of the TRAIL death and decoy receptors.5,10 We studied the TRAIL-R mRNA expression by RT-PCR in 57 B-CLL patients. B-CLL cells from all the patients were positive for TRAIL-R2 mRNA and most of them were also positive for TRAIL-R1 mRNA. TRAIL-R1 and TRAIL-R2 protein were detected both on the cell surface and in the cytoplasm. In contrast, although B-CLL cells expressed TRAIL-R3 and -R4 mRNA, they were negative or weakly positive for cell surface expression. However, they expressed significant levels of intracellular TRAIL-R3. Zhang et al37 reported similar results on melanoma cell lines. Their confocal microscopy studies indicated that TRAIL-R2 is clustered in organelles, similar to the Golgi apparatus, whereas TRAIL-R3 and -R4 are located in the nucleus.37,43 Our results show that despite the expression of TRAIL-R1 and -R2 on B-CLL cells, they were relatively resistant to in vitro induction of apoptosis by recombinant human TRAIL. The fact that Act D treatment sensitizes B-CLL cells to TRAIL-mediated apoptosis, also indicates that the relative resistance of B-CLL to TRAIL is not due to functional defects of the death receptors.

Some of the B-CLL patients were more sensitive to TRAIL and they had higher levels of TRAIL-R2 protein on the cell surface. TRAIL-R1 and TRAIL-R2 were spontaneously up-regulated in cells cultured in medium alone and TRAIL-R2 was also up-regulated on the surface of Act D pretreated cells. However, there was no correlation between the protein expression level of TRAIL-death receptors and decoy receptors, and the B-CLL sensitivity to TRAIL. All together, these results suggest that modulation of TRAIL-Rs expression is not the mechanism by which Act D sensitizes B-CLL cells to TRAIL, and that other factors may determine the TRAIL resistance of B-CLL.

Other authors have also found no correlation between levels of decoy receptors and resistance to TRAIL in various tumors tissues and cell lines.5,11,44,45,46 Conflicting reports have not been able to clarify which levels of TRAIL-R3 or -R4, or which ratio between decoy receptors and death receptors is required for an inhibitory effect on TRAIL-induced apoptosis.2,5,6,8,9 Furthermore, it has been suggested that the ability of TRAIL-R3 or -R4 to inhibit TRAIL-mediated killing might result from signaling activities other than apoptosis, associated with these receptors.47 TRAIL-R4 is capable of NF-kappaB activation8 and TRAIL-R3 may signal via the GPI (glycosyl-phosphatidylinositol) anchors.47 Thus, since TRAIL-R3 receptors were found within B-CLL cells, their role in regulating B-CLL sensitivity to TRAIL-induced apoptosis requires further investigation.

In agreement with our results, previous reports have also shown the increase in the sensitivity of tumor cells to TRAIL by protein or nucleic acid synthesis inhibitors.11,40,48 The fact that Act D can sensitize some tumors to TRAIL suggests the presence of one or more short-lived anti-apoptotic proteins, which are able to block TRAIL-induced apoptosis signaling. Although the signaling pathway used by TRAIL to induce apoptosis has yet to be fully elucidated, it has already been shown that FADD and caspase-8 are components of the TRAIL-DISC.1,49,50 FLIP possesses DEDs through which it interrupts FADD and caspase-8 binding, preventing DISC formation and apoptosis.15 Since ligand-dependent association of the TRAIL-R2 death domain and FLIP have been found,51 FLIP is a prime candidate for intracellular regulation of caspase activation by TRAIL. Accordingly, FLIP expression has been correlated with TRAIL resistance in tumor and normal cells lines.11,15,20,21 In addition, Act D treatment of melanoma11 and other cell types52 sensitizes them to TRAIL by down- regulation FLIP.

Here, we have shown that Act D decreased FLIPL expression in B-CLL cells at the same concentration and time that induced a gain in susceptibility to TRAIL-induced apoptosis. Act D treatment also induced a down-regulation of FLIPS, which occurred some hours before the increase in TRAIL-mediated apoptosis was observed. It has been shown that both FLIP forms coexist in the same DISC upon Fas triggering, and both molecules inhibit procaspase-8 activation and apoptosis upon overexpression.16,17 Some differences have been described regarding the molecular mechanism of action of the two FLIP proteins and in their capacity to activate various signaling pathways. FLIPS completely inhibits cleavage of procaspase-8, and FLIPL allows partial but not complete proteolytical processing of caspase-8.16 FLIPL preferentially activated NF-kappaB and FLIPS more strongly activated Erk.53 Although we found FLIPL and FLIPS down-regulated by Act D, the precise contribution of these two forms of FLIP in the sensitivity to TRAIL-mediated apoptosis in B-CLL requires further investigation. Surprisingly, FLIPL and FLIPS were spontaneously up-regulated in cells cultured in medium alone. Although FLIPL levels were down-regulated by Act D treatment, they were not lower than the constitutive expression levels, but still the cells were sensitized to TRAIL. These findings indicate that the availability, relative local concentrations of FADD, caspase-8, FLIPL, FLIPS and TRAIL-Rs as well as their affinities for each other are critical parameters that need to be studied to define the role of FLIP in TRAIL-mediated apoptosis in B-CLL.

In conclusion, here we present evidence that suggests that FLIP may be an important determinant in TRAIL resistance of B-CLL. First, B-CLL cells have a high constitutive expression of FLIP. Second, in vitro treatment of B-CLL cells with the RNA synthesis inhibitor, Act D, induces down-regulation of FLIPL and FLIPS, which is correlated with a gain in sensitivity to TRAIL-induced apoptosis. Kitada et al54 reported a reduced spontaneous, drug- and Fas-induced apoptosis in CD40L-treated B-CLL cells with up-regulated FLIPL and FLIPS, which supports the role of FLIP in B-CLL apoptosis. Ongoing experiments in our laboratory, examining the effect of antisense oligonucleotide to FLIP on the B-CLL sensitivity to TRAIL, would confirm this hypothesis. We do not exclude the possibility that anti-apoptotic molecules other than FLIP, such as Bcl-xL and IAP family members might also contribute to the resistance of B-CLL to TRAIL. Our results could have important implications for effective combined treatment regimens that enhance the apoptotic response of B-CLL to TRAIL. Further studies of the mechanisms involved in TRAIL-mediated cytotoxicity are required to assess the potential use of TRAIL as an anti-cancer agent in vivo.

Acknowledgements

We are indebted to Dr Stewart D Lyman and Dr Tony Troutt (Immunex, Seattle, WA, USA) for their generous gift of the TRAIL reagents, and to Prof Alf Grandien (Stockholm University, Sweden) for the FLIP transfected murine B lymphoma A20 cell lines. This work was supported by funds from the Swedish Cancer Association, the Swedish Medical Association and the Karolinska Institutet.

References

1 Daniel PT, Wieder T, Sturm I, Schulze-Osthoff K. The kiss of death: promises and failures of death receptors and ligands in cancer therapy. Leukemia 2001; 15: 1022-1032, MEDLINE

2 Pan G, Ni J, Wei Y-F, Yu G-L, Gentz R, Dixit VM. An antagonist decoy receptor and a death domain-containing receptor for TRAIL. Science 1997; 277: 815-818, Article MEDLINE

3 Pan G, O'Rourke K, Chinnaiyan AM, Gentz R, Ebner R, Ni J, Dixit VM. The receptor for the cytotoxic ligand TRAIL. Science 1997; 276: 111-113, Article MEDLINE

4 Walczak H, Degli-Esposti MA, Johnson RS, Smolak PJ, Waugh JY, Boiani N, Timour MS, Gerhart MJ, Schooley KA, Smith CA, Goodwin RG, Rauch CT. TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J 1997; 16: 5386-5397, Article MEDLINE

5 Sheridan JP, Marsters SA, Pitti RM, Gurney A, Skubatch M, Baldwin D, Ramakrishnan L, Gray CL, Baker K, Wood WI, Goddard AD, Godowski P, Ashkenazi A. Control of TRAIL-induced apoptosis by a family of signaling and decoy receptors. Science 1997; 277: 818-821, Article MEDLINE

6 Degli-Esposti MA, Smolak PJ, Walczak H, Waugh J, Huang C-P, DuBose RF, Goodwin RG, Smith CA. Cloning and characterization of TRAIL-R3, a novel member of the emerging TRAIL receptor family. J Exp Med 1997; 186: 1165-1170, MEDLINE

7 MacFarlane M, Ahmad M, Srinivasula SM, Fernandes-Alnemri T, Cohen GM, Alnemri ES. Identification and molecular cloning of two novel receptors for the cytotoxic ligand TRAIL. J Biol Chem 1997; 272: 25417-25420, Article MEDLINE

8 Degli-Esposti MA, Dougall WC, Smolak PJ, Waugh JY, Smith CA, Goodwin RG. The novel receptor TRAIL-R4 induces NF-kappaB and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity 1997; 7: 813-820, MEDLINE

9 Marsters SA, Sheridan JP, Pitti RM, Huang A, Skubatch M, Baldwin D, Yuan J, Gurney A, Goddard AD, Godowski P, Ashkenazi A. A novel receptor for Apo2L/TRAIL contains a truncated death domain. Curr Biol 1997; 7: 1003-1006, MEDLINE

10 Griffith TS, Lynch DH. TRAIL: a molecule with multiple receptors and control mechanisms. Curr Opin Immunol 1998; 10: 559-563, MEDLINE

11 Griffith TS, Chin WA, Jackson GC, Lynch DH, Kubin MZ. Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells. J Immunol 1998; 161: 2833-2840, MEDLINE

12 Walczak H, Miller RE, Ariail K, Gliniak B, Griffith TS, Kubin M, Chin W, Jones J, Woodward A, Le T, Smith C, Smolak P, Goodwin RG, Rauch CT, Schuh JCL, Lynch DH. Tumoricidal activity of tumor necrosis factor-related apoptosis-inducing ligand in vivo. Nat Med 1999; 5: 157-163, Article MEDLINE

13 Griffith TS, Rauch CT, Smolak PJ, Waugh JY, Boiani N, Lynch DH, Smith CA, Goodwin RG, Kubin MZ. Functional analysis of TRAIL receptors using monoclonal antibodies. J Immunol 1999; 162: 2597-2605, MEDLINE

14 Thome M, Schneider P, Hofmann K, Fickenscher H, Meinl E, Neipel F, Mattmann C, Burns K, Bodmer J-L, Schroter M, Scaffidi C, Krammer PH, Peter ME, Tschopp J. Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors. Nature 1997; 386: 517-521, MEDLINE

15 Irmler M, Thome M, Hahne M, Schneider P, Hofmann K, Steiner V, Bodmer J-L Schröter M, Burns K, Mattmann C, Rimoldi D, French LE, Tschopp J. Inhibition of death receptor signals by cellular FLIP. Nature 1997; 388: 190-195, Article MEDLINE

16 Krueger A, Schmitz I, Baumann S, Krammer PH, Kirchhoff S. Cellular FLICE-inhibitory protein splice variants inhibit different steps of caspase-8 activation at the CD95 death-inducing signaling complex. J Biol Chem 2001; 276: 20633-20640, MEDLINE

17 Scaffidi C, Schmitz I, Krammer PH, Peter ME. The role of c-FLIP in modulation of CD95-induced apoptosis. J Biol Chem 1999; 274: 1541-1548, Article MEDLINE

18 Medema JP, de Jong J, van Hall T, Melief CJ, Offringa R. Immune escape of tumors in vivo by expression of cellular FLICE-inhibitory protein. J Exp Med 1999; 190: 1033-1038, MEDLINE

19 Djerbi M, Screpanti V, Catrina AI, Bogen B, Biberfeld P, Grandien A. The inhibitor of death receptor signaling, FLICE-inhibitory protein defines a new class of tumor progression factors. J Exp Med 1999; 190: 1025-1032, MEDLINE

20 Kim K, Fisher MJ, Xu SQ, El-Deiry WS. Molecular determinants of response to TRAIL in killing of normal and cancer cells. Clin Cancer Res 2000; 6: 335-346, MEDLINE

21 Leverkus M, Neumann M, Mengling T, Rauch CT, Brocker EB, Krammer PH, Walczak H. Regulation of tumor necrosis factor-related apoptosis-inducing ligand sensitivity in primary and transformed human keratinocytes. Cancer Res 2000; 60: 553-559, MEDLINE

22 Deveraux QL, Reed JC. IAP family proteins - suppressors of apoptosis. Genes Dev 1999; 13: 239-252, MEDLINE

23 Strasser A, Harris AW, Huang DC, Krammer PH, Cory S. Bcl-2 and Fas/APO-1 regulate distinct pathways to lymphocyte apoptosis. EMBO J 1995; 14: 6136-6147, MEDLINE

24 Ashkenazi A, Pai RC, Fong S, Leung S, Lawrence DA, Marsters SA, Blackie C, Chang L, McMurtrey AE, Hebert A, DeForge L, Koumenis IL, Lewis D, Harris L, Bussiere J, Koeppen H, Shahrokh Z, Schwall RH. Safety and antitumor activity of recombinant soluble Apo2 ligand. J Clin Invest 1999; 104: 155-162, MEDLINE

25 Jurlander J. The cellular biology of B-cell chronic lymphocytic leukemia. Crit Rev Oncol Hematol 1998; 27: 29-52, MEDLINE

26 O'Brien S, del Giglio A, Keating M. Advances in the biology and treatment of B-cell chronic lymphocytic leukemia. Blood 1995; 85: 307-318, MEDLINE

27 Binet JL, Plunkett W, Robertson B, Merle-Beral H, Mentz F, Hoffbrand AV, Panayiotidis P. What does apoptosis mean in CLL? Leuk Lymphoma 1996; 22: 47-52, MEDLINE

28 Wang D, Freeman GJ, Levine H, Ritz J, Robertson MJ. Role of the CD40 and CD95 (APO-1/Fas) antigens in the apoptosis of human B-cell malignancies. Br J Haematol 1997; 97: 409-417, MEDLINE

29 Tinhofer I, Marschitz I, Kos M, Henn T, Egle A, Villunger A, Greil R. Differential sensitivity of CD4+ and CD8+ T lymphocytes to the killing efficacy of Fas (APO-1/CD95) ligand+ tumor cells in B chronic lymphocytic leukemia. Blood 1998; 91: 4273-4281, MEDLINE

30 McConkey DJ, Chandra J, Wright S, Plunkett W, McDonnell TJ, Reed JC, Keating M. Apoptosis sensitivity in chronic lymphocytic leukemia is determined by endogenous endonuclease content and relative expression of BCL-2 and BAX. J Immunol 1996; 156: 2624-2630, MEDLINE

31 Thomas A, El Rouby S, Reed JC, Krajewski S, Silber R, Potmesil M, Newcomb EW. Drug-induced apoptosis in B-cell chronic lymphocytic leukemia: relationship between p53 gene mutation and bcl-2/bax proteins in drug resistance. Oncogene 1996; 12: 1055-1062, MEDLINE

32 Pepper C, Bentley P, Hoy T. Regulation of clinical chemoresistance by bcl-2 and bax oncoproteins in B-cell chronic lymphocytic leukaemia. Br J Haematol 1996; 95: 513-517, MEDLINE

33 Aguilar-Santelises M, Rottenberg ME, Lewin N, Mellstedt H, Jondal M. Bcl-2, Bax and p53 expression in B-CLL in relation to in vitro survival and clinical progression. Int J Cancer 1996; 69: 114-119, Article MEDLINE

34 Osorio LM, De Santiago A, Aguilar-Santelises M, Mellstedt H, Jondal M. CD6 ligation modulates the Bcl-2/Bax ratio and protects chronic lymphocytic leukemia B cells from apoptosis induced by anti-IgM. Blood 1997; 89: 2833-2841, MEDLINE

35 Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS. Clinical staging of chronic lymphocytic leukemia. Blood 1975; 46: 219-234, MEDLINE

36 Silver RT, Sawitsky A, Rai K, Holland JF, Glidewell O. Guidelines for protocol studies in chronic lymphocytic leukemia. Am J Hematol 1978; 4: 343-358, MEDLINE

37 Zhang XD, Franco A, Myers K, Gray C, Nguyen T, Hersey P. Relation of TNF-related apoptosis-inducing ligand (TRAIL) receptor and FLICE-inhibitory protein expression to TRAIL-induced apoptosis of melanoma. Cancer Res 1999; 59: 2747-2753, MEDLINE

38 Zamzami N, Marchetti P, Castedo M, Zanin C, Vayssiere J-L, Petit PX, Kroemer G. Reduction in mitochondrial potential constitutes an early irreversible step of programmed lymphocyte death in vivo. J Exp Med 1995; 181: 1661-1672, MEDLINE

39 Martinez-Lorenzo MJ, Alava MA, Gamen S, Kim KJ, Chuntharapai A, Pineiro A, Naval J, Anel A. Involvement of APO2 ligand/TRAIL in activation-induced death of Jurkat and human peripheral blood T cells. Eur J Immunol 1998; 28: 2714-2725, MEDLINE

40 Mori S, Murakami-Mori K, Nakamura S, Ashkenazi A, Bonavida B. Sensitization of AIDS-Kaposi's sarcoma cells to Apo-2 ligand-induced apoptosis by actinomycin D. J Immunol 1999; 162: 5616-5623, MEDLINE

41 Suliman A, Lam A, Datta R, Srivastava RK. Intracellular mechanisms of TRAIL: apoptosis through mitochondrial-dependent and -independent pathways. Oncogene 2001; 20: 2122-2133, MEDLINE

42 Wen J, Ramadevi N, Nguyen D, Perkins C, Worthington E, Bhalla K. Antileukemic drugs increase death receptor 5 levels and enhance Apo-2L-induced apoptosis of human acute leukemia cells. Blood 2000; 96: 3900-3906, MEDLINE

43 Zhang XD, Franco AV, Nguyen T, Gray CP, Hersey P. Differential localization and regulation of death and decoy receptors for TNF-related apoptosis-inducing ligand (TRAIL) in human melanoma cells. J Immunol 2000; 164: 3961-3970, MEDLINE

44 Nguyen T, Zhang XD, Hersey P. Relative resistance of fresh isolates of melanoma to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis. Clin Cancer Res 2001; 7: 966s-973s, MEDLINE

45 Keane MM, Ettenberg SA, Nau MM, Russell EK, Lipkowitz S. Chemotherapy augments TRAIL-induced apoptosis in breast cell lines. Cancer Res 1999; 59: 734-741, MEDLINE

46 Frank S, Kohler U, Schackert G, Schackert HK. Expression of TRAIL and its receptors in human brain tumors. Biochem Biophys Res Commun 1999; 257: 454-459, MEDLINE

47 Degli-Esposti M. To die or not to die - the quest of the TRAIL receptors. J Leukoc Biol 1999; 65: 535-542, MEDLINE

48 Bonavida B, Ng C-P, Jazirehi A, Schiller G, Mizutani Y. Selectivity of TRAIL-mediated apoptosis of cancer cells and synergy with drugs: the trail to non-toxic cancer therapeutics. Int J Oncol 1999; 15: 793-802, MEDLINE

49 Kischkel FC, Lawrence DA, Chuntharapai A, Schow P, Kim KJ, Ashkenazi A. Apo2L/TRAIL-dependent recruitment of endogenous FADD and caspase-8 to death receptors 4 and 5. Immunity 2000; 12: 611-620, MEDLINE

50 Sprick MR, Weigand MA, Rieser E, Rauch CT, Juo P, Blenis J, Krammer PH, Walczak H. FADD/MORT1 and caspase-8 are recruited to TRAIL receptors 1 and 2 and are essential for apoptosis mediated by TRAIL receptor 2. Immunity 2000; 12: 599-609, MEDLINE

51 Abe K, Kurakin A, Mohseni-Maybodi M, Kay B, Khosravi-Far R. The complexity of TNF-related apoptosis-inducing ligand. Ann N Y Acad Sci 2000; 926: 52-63, MEDLINE

52 Fulda S, Meyer E, Debatin KM. Metabolic inhibitors sensitize for CD95 (APO-1/Fas)-induced apoptosis by down-regulating Fas-associated death domain-like interleukin 1-converting enzyme inhibitory protein expression. Cancer Res 2000; 60: 3947-3956, MEDLINE

53 Kataoka T, Budd RC, Holler N, Thome M, Martinon F, Irmler M, Burns K, Hahne M, Kennedy N, Kovacsovics M, Tschopp J. The caspase-8 inhibitor FLIP promotes activation of NF-kappaB and Erk signaling pathways. Curr Biol 2000; 10: 640-648, Article MEDLINE

54 Kitada S, Zapata JM, Andreeff M, Reed JC. Bryostatin and CD40-ligand enhance apoptosis resistance and induce expression of cell survival genes in B-cell chronic lymphocytic leukemia. Br J Haematol 1999; 106: 995-1004, MEDLINE

Figures

Figure 1 mRNA expression of TRAIL receptors in progressive (+) and non-progressive (-) B-CLL patients. RNA was extracted from 57 B-CLL patients (28 progressive and 29 non-progressive) and analyzed for TRAIL-R1, -R2, -R3 and -R4 expression by RT-PCR. The mRNA levels were determined by densitometric analysis and normalized according to G3PDH mRNA expression. Quantile box plots are shown, with data representing the ratio between TRAIL receptor and G3PDH.

Figure 2 Flow cytometric analysis of TRAIL-R1, -R2, -R3, and -R4 expression on the cell surface (a) and in permeabilized (b) B-CLL cells. The solid line indicates staining by TRAIL-R mAb and the dashed line represents staining with isotype control mAb. The x-axis corresponds to logarithmic fluorescence intensity and the y-axis corresponds to cell number. Specific MFI (after the subtraction of background MFI) is in the right corner of each panel.

Figure 3 TRAIL-R2 protein expression in B-CLL cells. TRAIL-R2 protein was determined in B-CLL cells by Western blot, using a polyclonal goat anti-TRAIL-R2 antibody. TRAIL-R2 protein expression in Jurkat and K-562 cells was used as positive controls. Actin was used as control for protein loading.

Figure 4 Sensitization of B-CLL cells to TRAIL-mediated apoptosis by Act D. Isolated B cells from B-CLL patient (0.4 ´ 106) were cultured in 96-well plates. Act D (5 ng/ml or 10 ng/ml) was added to each well immediately before adding 300 ng/ml LZ-TRAIL. In L-263 cell cultures 2.5 ng/ml of Act D was added. Apoptosis was determined after 24 h (a) and 48 h (b), using annexin-V staining and the results are presented as percentage of annexin-positive cells. TRAIL-sensitive Jurkat cells were used as positive controls. Data from a representative of three independent experiments are shown.

Figure 5 Constitutive expression of FLIPL and FLIPS in B-CLL cells. FLIPL and FLIPS expression was determined in cell lysates from B-CLL cells and isolated normal tonsillar B cells (NB) by Western blot, using a monoclonal rat anti-human FLIP antibody (a). The long and short forms of FLIP migrate as a 55 kDa and 28 kDa band, respectively. Cell lysates from murine B lymphoma A20 cell lines transfected with human FLIPL, human FLIPS or with an empty vector were used as control for the FLIP expression (b). Actin antibody was used as control for protein loading. Data from a representative of two independent experiments are presented.

Figure 6 Down-regulation of FLIPL and FLIPS expression in B-CLL by Act D treatment. B-CLL cells were cultured for the indicated periods in the presence or absence of Act D, together or not with TRAIL (300 ng/ml) and analyzed for FLIP expression by Western blot. The long and short forms of FLIP migrate as a 55 kDa and 28 kDa band, respectively. Actin antibody was used as control for protein loading. Data from a representative of two independent experiments are presented.

Tables

Table 1 TRAIL-Rs expression and TRAIL-induced apoptosis in B-CLL cells

Received 11 September 2000; accepted 20 July 2001
December 2001, Volume 15, Number 12, Pages 1868-1877
Table of contents    Previous  Article  Next    [PDF]
Privacy Policy © 2001 Nature Publishing Group