Background

Salicylate was recently shown to provide protection against cisplatin nephrotoxicity in rats. We have demonstrated that enhanced tumor necrosis factor- (TNF-) production mediates, in part, cisplatin nephrotoxicity. The purpose of this study was to determine if the protective effects of salicylate were mediated through inhibition of TNF- in vivo and to explore the mechanism of inhibition in vitro.

Methods

The effects of treatment with cisplatin alone and in combination with sodium salicylate in mice on renal function, histology, and gene expression were determined. The effects of cisplatin and salicylate on TNF- expression, nuclear factor kappa B (NF-B) activity, and apoptosis were determined in vitro using cultured murine proximal tubule cells.

Results

Salicylate significantly reduced both the functional and histologic evidence of cisplatin renal injury. Cisplatin increased the renal expression of TNF-, monocyte chemoattractant protein-1 (MCP-1), intercellular adhesion molecule (ICAM)-1, heme oxygenase-1, TNF receptor 1 (TNFR1), and TNF receptor 2 (TNFR2). Treatment with sodium salicylate blunted the increase in TNF- mRNA and also reduced serum TNF- protein levels. Salicylate had little protective effect when administered with cisplatin to TNF-–deficient mice. Cisplatin increased the degradation of I kappa B (IB) in a time-dependent manner and also increased nuclear NF-B binding activity. Salicylate inhibited IB degradation and NF-B binding activity in the presence of cisplatin. In addition, salicylate inhibited the cisplatin induced TNF- mRNA increase in mouse proximal tubule epithelial (TKPT) cells.

Conclusion

These results indicate that salicylate acts via inhibition of TNF- production to reduce cisplatin nephrotoxicity. The inhibition of TNF- production may be mediated via stabilization of IB.

METHODS

Animals and drug administration

Experiments were performed on 10- to 12-week-old male C57BL/6, B6129SF2/J, or TNF-–deficient mice (B6129-Tnf^{tm1 Gkl}) weighing approximately 30 g. Mice were obtained from the Jackson Laboratory (Bar Harbor, ME, USA) and were maintained on a standard diet and water was freely available. Cisplatin (Sigma-Aldrich, St. Louis, MO, USA) was dissolved in saline at a concentration of 1 mg/mL. Mice were given a single intraperitoneal injection of either vehicle (saline) or cisplatin (20 mg/kg BW). This dose of cisplatin produces severe renal failure in mice^5,13. Some groups also received subcutaneous injection of sodium salicylate (100 mg/kg BW) either alone or with cisplatin. The salicylate was administered twice a day, beginning 24 hours prior to the cisplatin injection and was continued for 6 doses. Animals were sacrificed 72 hours after cisplatin injection and blood and kidney tissues were collected. Tissues were processed for histology and RNA isolation.

Renal function

Renal function was assessed by measurements of blood urea nitrogen and serum creatinine using commercially available kits (Sigma).

Quantitation of mRNA by real-time PCR

Total RNA was isolated from kidney using Trizol reagent. Real-time reverse transcription coupled polymerase chain reaction (RT-PCR) was performed in an Applied Biosystems 7700 Sequence Detection System (Foster City, CA, USA). Total RNA (5 g) was reverse transcribed in a reaction volume of 20 L using Superscript II (Invitrogen, Carlsbad, CA, USA) reverse transcriptase and random primers. The product was diluted to a volume of 500 L and either 2L (actin) or 10 L (all others) aliquots were used as templates for amplification using the SYBR Green PCR amplification reagent (Applied Biosystems) and gene specific primers. The primer sets used were: actin (forward: CATGGATGACGATATCGCT; reverse: CATGAGGTAGTCTGTCAGGT), TNF- (forward: GCATGATCCGCGACGTGGAA; reverse: AGATCCATGCCGTTGGCCAG), TNFR1 (forward: CCGGGCCACCTGGTCCG; reverse: CAAGTAGGTTCCTTTGTG), TNFR2 (forward: GTCGCGCTGGTCTTCGAACTG; reverse: GGTATACATGCTTGCCTCACAGTC), ICAM-1 (forward: AGATCACATTCACGGTGCTG; reverse: CTTCAGAGGCAGGAAACAGG), Heme oxygenase-1 (forward: AGCATGCCCCAGGATTTG; reverse: AGCTCAATGTTGAGCAGGA), and MCP-1 (forward: ATGCAGGTCCCTGTCATG; reverse: GCTTGAGGTGGTTGTGGA). The amount of resulting DNA was normalized to the actin signal amplified in a separate reaction.

TNF- quantitation by ELISA

Levels of TNF- in serum were determined using an enzyme-linked immunosorbent assay (ELISA) (Quantikine Mouse TNF- kit; R&D Systems, Inc., Minneapolis, MN, USA) according to the manufacturer's instructions.

Histology and histochemistry

Kidney tissue was fixed in buffered 10% formalin for 12 hours and then embedded in paraffin wax. Five-micron thick sections were stained with PAS or naphthol AS-D choroacetate esterase (Sigma, kit # 91C). The esterase stain identifies infiltrating neutrophils and monocytes. Thirty 40 fields of esterase stained sections were examined for quantitation of leukocytes. Tubular injury was assessed in PAS-stained sections using a semi-quantitative scale^3,14,15 in which the percentage of cortical tubules showing epithelial necrosis was assigned a score: 0 = normal; 1 = <10%; 2 = 10%–25%; 3 = 26%–75%; 4 = >75%. Apoptosis was scored by counting the number of apoptotic cells, as defined by chromatin condensation or nuclear fragmentation (apoptotic bodies), on PAS-stained sections. The individual scoring of the slides was blinded to the treatment and strain of the animal.

Renal platinum content

Kidneys were removed 48 hours after injection and digested in a mixture of Ultrex trace metal grade nitric acid and hydrochloric acid (J.T. Baker, Phillipsburg, NJ, USA) for one hour at 100°C. The digested samples were diluted with high-purity water and subjected to inductively coupled plasma/mass spectroscopy (ICP/MS) (Elan 6000; Perkin-Elmer, Boston, MA, USA) to determine the platinum content. ICP/MS has been shown to be superior to either atomic absorption spectrometry or inductively coupled plasma atomic emission spectrometry for the measurement of tissue platinum¹⁶.

Cell culture and Western blot analysis

Mouse proximal tubule epithelial cells (TKPT cells, kindly provided by E. Bello-Reuss) were cultured in Dulbecco's modified Eagle's medium (DMEM)-F12 medium containing antibiotics and 7.5% fetal bovine serum until confluent. Cells were treated with 100 mol/L cisplatin with or without 20 mol/L sodium salicylate for varying times. At the end of the treatment, the cells were harvested and used for RNA isolation and protein extraction. RNA was isolated using Trizol reagent. Proteins were extracted by solubilizing the cells in radioimmunoprecipitation (RIPA) buffer containing a protease and phosphatase inhibitor cocktail (Sigma). Protein concentrations were quantitated (BCA protein assay reagent; Pierce, Rockford, IL, USA) and 100 g samples of protein were separated by 10% sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis and then transferred onto a polyvinylidene fluoride (PVDF) membrane. Western blot analysis was performed with an anti-IB antibody (1:1000 dilution; Cell Signaling, Beverly, MA, USA). Proteins were detected using enhanced chemiluminescence detection reagents (Amersham Pharmacia Biotech, Piscataway, NJ, USA).

Preparation of nuclear extract

Cells treated with various agents were scraped and washed with ice-cold phosphate-buffered saline (PBS) and then resuspended in 200 L of ice-cold lysis buffer (10 mmol/L HEPES pH 7.9, 10 mmol/L KCl, 0.4% NP-40, 1.5 mmol/L MgCl₂, 1 mmol/L dithiothreitol (DTT), 0.1 mmol/L EDTA, and 1 protease cocktail inhibitor (Sigma). After 10 minute on ice, the lysate was centrifuged at 12, 000g for 1 minute at 4°C. The nuclear pellet was washed once with lysis buffer and then extracted with a buffer containing 20 mmol/L HEPES (pH 7.9), 420 mmol/L NaCl, 1.5 mmol/L MgCl₂, 1 mmol/L EDTA, 1 mmol/L DTT, and 1 protease inhibitor cocktail (Sigma) and centrifuged at 12, 000g for 10 minutes at 4°C. The supernatant was stored at -80°C until use.

Electromobility shift assay

An NF-B consensus oligonucleotide (Santa Cruz Biotechnology, Santa Cruz, CA, USA) was 5' end-labeled with [-³²P] ATP using T4 polynucleotide kinase. Nuclear protein (15 g) was incubated with the labeled oligonucleotide (2.0 10⁵ cpm) in binding buffer (10 mmol/L HEPES pH 7.5, 0.1 mol/L EDTA, 0.1 mmol/L DTT, 0.1 mmol/L MgCl₂, 50 mmol/L NaCl, 1 mmol/L CaCl₂, and 2% glycerol) for 20 minutes at room temperature in a final volume of 20 L. Subsequently, free oligonucleotide and oligonucleotide-protein complexes were resolved by electrophoresis on a 4–12% TB-polyacrylamide gel (Invitrogen) and detected by autoradiography. The specificity of the NF-B binding was determined by adding 20-fold excess unlabeled oligonucleotide or mutant oligonucleotide in the binding reaction.

DNA fragmentation

Apoptotic DNA fragments were isolated using the method of Herrmann et al¹⁷. Cells were washed with PBS, scraped from the dish, and centrifuged at 1000g for 3 minutes. The cell pellets were lysed (1% NP-40 in 20 mmol/L EDTA, 50 mmol/L Tris-HCl, pH 7.5) and centrifuged to remove nuclei and unlysed cells. SDS and Rnase A were added to the supernatant and incubated at 56°C for 1 hour, followed by digestion with proteinase K for 2 hours at 37°C. The DNA fragments were precipitated with ammonium acetate and ethanol and then separated by electrophoresis in 1.8% agarose gels. The gels were stained with ethidium bromide and visualized under ultraviolet light.

Statistical methods

All assays were performed in duplicate. The data are reported as mean SEM. Statistical significance was assessed by unpaired, two-tailed Student t test for single comparison, or analysis of variance (ANOVA) for multiple comparisons.

RESULTS

Salicylate provides functional and structural protection from cisplatin nephrotoxicity

To examine the effect of salicylate on cisplatin-induced kidney dysfunction, we administered cisplatin alone or in combination with salicylate to mice. As shown in Figure 1, cisplatin injection produced severe renal failure. In contrast, administration of salicylate together with cisplatin significantly reduced both the BUN (210 14 vs. 98 25 mg/dL, P < 0.005) and creatinine (3.6 0.4 vs. 1.0 0.3 mg/dL, P = 0.0005) levels compared with cisplatin alone. Salicylate alone did not affect either urea or creatinine values. Similar reductions in urea and creatinine were reported by Li et al¹¹ in the rat. The improvement in renal function was accompanied by less severe histologic damage. As shown Figure 2, cisplatin treatment resulted in severe tubular injury reflected by cast formation, loss of brush border membranes, sloughing of tubular epithelial cells, and dilation of tubules. These changes were markedly reduced in kidneys from animals injected with cisplatin and salicylate. Figure 3 presents a semi-quantitative measure of tubular necrosis and apoptosis. Consistent with previous reports^13,18, cisplatin produced a large increase in both necrosis and apoptosis. Both forms of cell death were significantly reduced by salicylate. We used morphologic criteria rather than biochemical detection methods [e.g., terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) or annexin staining) to detect apoptosis. Morphologic criteria remain the gold standard for the identification of apoptosis. In ischemia/reperfusion injury and cisplatin renal injury, there is a good correlation between morphologically defined apoptosis and TUNEL staining^19,20. The improvements in renal function and histology were not caused by an inhibition of platinum uptake in the kidney by salicylate. In fact, the platinum content of kidneys of mice treated with cisplatin plus salicylate was actually greater than in mice treated with cisplatin alone (8013 464 vs. 5110 352 g Pt/kg tissue, P < 0.001, N = 3).

Figure 1.

Effect of salicylate and cisplatin on renal function. Mice were injected with 20 mg/kg cisplatin and/or 100 mg/kg sodium salicylate as described in Methods. Blood urea nitrogen (solid bars) and plasma creatinine (hatched bars) were measured 72 hours after injection. Cisplatin caused severe renal dysfunction that was partially prevented by salicylate. ⁺P < 0.005 vs. saline; *P < 0.0005 vs. cisplatin. N = 4 to 5.

Full figure and legend (15K)

Figure 2.

Effect of salicylate and cisplatin on renal histology. Mice were treated with saline (A), salicylate (B), cisplatin (C), or cisplatin and salicylate (D). Kidneys were harvested 72 hours after injection. The cisplatin-treated kidneys (C) demonstrated marked injury with loss of brush border, necrosis, and loss of epithelial cells and cast formation. These changes were reduced in salicylate-treated mice (D). Salicylate treatment alone (B) had no effect on renal histology.

Full figure and legend (415K)

Figure 3.

Effect of salicylate and cisplatin on tubular necrosis and apoptosis. Tubular necrosis (solid bars) and apoptosis (hatched bars) were scored in kidneys from mice treated with saline, salicylate, cisplatin, or cisplatin and salicylate. ⁺P < 0.001 vs. saline; *P < 0.001 vs. cisplatin. N = 3 to 5.

Full figure and legend (17K)

Salicylate reduces leukocyte infiltration in cisplatin nephrotoxicity

Cisplatin nephrotoxicity is characterized by the infiltration of inflammatory cells into the kidney^4,5. We determined the effect of salicylate on this process. As shown in Figure 4, cisplatin injection produced a large increase in leukocytes within the kidney cortex and this increase was significantly reduced in the presence of salicylate.

Figure 4.

Effect of salicylate and cisplatin on renal leukocyte infiltration. Kidneys were harvested 72 hours after the indicated treatment and stained with naphthol AS-D choroacetate esterase. Leukocytes in 30 40 fields were counted for each animal. ⁺P < 0.05 vs. cisplatin. N = 3 to 7.

Full figure and legend (9K)

Salicylate inhibits the up-regulation of cytokine and adhesion molecule expression in cisplatin nephrotoxicity

We have previously shown that cisplatin results in the up-regulation of a number of pro-inflammatory chemokines and cytokines in the kidney⁵. Experiments were performed to determine if the salutary actions of salicylate Figure 1,Figure 2,Figure 3,Figure 4 involved suppression of this cytokine response. Kidneys were harvested at 72 hours after treatment with cisplatin in the presence or absence of salicylate. Cytokine gene expression was determined by real-time RT-PCR Figure 5. TNF-, monocyte chemoattractant protein-1 (MCP-1), as well as TNF receptor 1 (TNFR1) and TNF receptor 2 (TNFR2) were up-regulated after cisplatin injection. TNFR2 was up-regulated to a greater extent than TNFR1. In addition, intercellular adhesion molecule-1 (ICAM-1) and an oxidative stress marker, heme oxygenase–1 (HO-1), were also up-regulated. Treatment with salicylate significantly inhibited the up-regulation of TNF-. TNFR2 expression was reduced slightly but this did not achieve statistical significance. The expression of TNFR1, MCP-1, ICAM-1, and HO-1 were not affected by salicylate. In addition, serum TNF- protein levels Figure 6 were also significantly reduced in cisplatin- and salicylate-treated animals when compared to cisplatin-treated animals (81 23 vs. 18 5 pg/mL, P < 0.05).

Figure 5.

Effect of cisplatin and salicylate on renal gene expression. Kidneys were harvested 72 hours after treatment with saline (open bars), cisplatin (solid bars), or cisplatin and salicylate (hatched bars). Expression of the indicated genes was determined by real-time reverse transcription-polymerase chain reaction (RT-PCR). N = 4 to 8 in each group. *P < 0.05 vs. saline; ⁺P < 0.05 vs. cisplatin.

Full figure and legend (16K)

Figure 6.

Effect of cisplatin and salicylate on serum tumor necrosis factor (TNF) levels. Serum TNF concentrations were determined 72 hours after treatment with the indicated agents. ⁺P < 0.05 vs. cisplatin. N = 5 in each group.

Full figure and legend (8K)

Salicylate inhibits cisplatin toxicity via suppression of TNF- production

To determine if the beneficial effects of salicylate on renal function and structure Figure 1,Figure 2,Figure 3,Figure 4 were due to inhibition of TNF- production Figure 5 and Figure 6, we examined the effects of salicylate in TNF- deficient mice. Wild-type B6129S mice or TNF-–deficient mice received 20 mg/kg cisplatin in the presence or absence of sodium salicylate. As shown in Figure 7, wild-type mice developed severe renal failure, and, consistent with the results in Figure 1, this was significantly reduced by salicylate. As we reported earlier⁵, TNF-–deficient mice developed less renal dysfunction when compared to the wild-type mice. Of note, salicylate had no additional benefit in the absence of endogenous TNF-.

Figure 7.

Tumor necrosis factor (TNF)-dependence of salicylate actions in cisplatin nephrotoxicity. B6129SF/J- or TNF–deficient mice were treated with either cisplatin or cisplatin and salicylate. Blood urea nitrogen (solid bars) or serum creatinine (hatched bars) was measured 72 hours after injection. ⁺P < 0.05 vs. cisplatin. ⁺⁺P < 0.01 vs. cisplatin B6129SF/J. N = 5 in each group.

Full figure and legend (19K)

Salicylate inhibits cisplatin-induced IB degradation, NF-B binding activity, and TNF- expression in proximal tubule cells

As noted earlier, salicylates can inhibit IKK activity, thereby reducing IB degradation and subsequent NF-B transcriptional activity^9,10. To determine if such a mechanism could account for the observed reduction in renal TNF- expression Figure 5, cultured TKPT cells were treated with 100 mol/L cisplatin or cisplatin plus 20 mmol/L sodium salicylate. As shown in Figure 8, cisplatin increased the degradation of IB in a time-dependent manner. However, in the presence of salicylate this degradation of IB was inhibited. Degradation of IB allows the nuclear localization of NF-B and subsequent transcriptional activation of target genes¹², including TNF-²¹. Gel-shift assays were performed to evaluate the effects of cisplatin and salicylate on NF-B binding activity. As shown in Figure 9, treatment of TKPT cells with cisplatin increased the binding of nuclear extracts to a consensus NF-B binding sequence. Treatment with salicylate prevented the cisplatin-induced increase in NF-B binding. The binding to the NF-B sequence was specific as it was reduced by competition with unlabeled NF-B oligonucleotides, but not by competition with a mutant oligonucleotide. The promoter of the TNF- gene contains several NF-B binding sites. It was relevant, therefore, to determine the effects of cisplatin and salicylate on TNF- expression in TKPT cells. As shown in Figure 10, cisplatin increased TNF- mRNA in TKPT cells 9-fold at 12 hours, while salicylate treatment inhibited the cisplatin-induced TNF- mRNA expression significantly (P < 0.05) and also reduced basal TNF- expression.

Figure 8.

Effect of cisplatin and salicylate on the degradation of IB in renal proximal tubule cells. (Top). Mouse proximal tubule epithelial (TKPT) cells were treated with control media, media containing 100 mol/L cisplatin, or media containing cisplatin and 20 mmol/L sodium salicylate for the indicated times. Cytosolic IB was determined by Western blot analysis. (Bottom). Densitometric analysis of IB content of TKPT cells treated for 12 hours under the indicated conditions. Data are summarized from three independent experiments. ⁺P < 0.02 vs. control.

Full figure and legend (40K)

Figure 9.

Effect of cisplatin and salicylate on nuclear factor kappa B (NF-B) binding activity in renal proximal tubule cells. Electromobility shift assay was performed using nuclear extracts from mouse proximal tubule epithelial (TKPT) cells were treated with control media, media containing 100 mol/L cisplatin, or media containing cisplatin and 20 mmol/L sodium salicylate for 12 hours. Cells treated with 1 g/mL lipopolysaccharide (LPS) for 45 minutes were included as a positive control. Binding specificity was demonstrated by competition with excess unlabeled oligonucleotide.

Full figure and legend (67K)

Figure 10.

Effect of cisplatin and salicylate on tumor necrosis factor (TNF) expression in renal proximal tubule cells. Mouse proximal tubule epithelial (TKPT) cells were treated as in Figure 8. for 12 hours. TNF- mRNA was determined by real time reverse transcription-polymerase chain reaction (RT-PCR).

Full figure and legend (9K)

Salicylate reduces cisplatin-induced apoptosis in TKPT cells

The in vivo mechanisms of cisplatin nephrotoxicity are complex and involve changes in renal hemodynamics²², inflammatory mechanisms^3,4,5, and direct cytotoxicity to renal epithelial cells^23,24,25. In vitro, cisplatin can result in either necrosis or apoptosis of renal epithelial cells. We determined the effect of salicylate on cisplatin-induced apoptosis in vitro, TKPT cells were treated with 100 mol/L cisplatin for 12 hours in serum-free medium with or without 20 mmol/L sodium salicylate. DNA fragmentation was determined as an indication of endonuclease activity associated with apoptosis. As reported by Kaushal et al²⁶, cisplatin treatment increased DNA fragmentation Figure 11. Salicylates effectively reduced the extent of DNA fragmentation in the presence of cisplatin (results representative of three experiments).

Figure 11.

Effect of cisplatin and salicylate on DNA fragmentation in renal proximal tubule cells. Mouse proximal tubule epithelial (TKPT) cells were treated under the indicated conditions for 12 hours. Cells were harvested and low molecular DNA fragments were isolated as described in Methods. Cisplatin increased DNA fragmentation. This effect was inhibited by salicylate.

Full figure and legend (99K)

DISCUSSION

Cisplatin is an important antitumor agent used for treating various solid tumors. The key limitation of this drug is nephrotoxicity. Studies on the pathogenesis of cisplatin nephrotoxicity have mainly focused on the direct toxicity of cisplatin in vitro, including the role of oxidative stress^25,27,28. However, recent studies have demonstrated the important role of inflammation and cytokine activity in the pathogenesis of cisplatin nephrotoxicity^3,4,5. The recent observation that salicylate protects against cisplatin nephrotoxicity¹¹ may also be relevant to the role of inflammation. Salicylates are well known to reduce inflammation. However, the mechanism by which salicylate protects against nephrotoxicity is not known. High doses of salicylate are thought to inhibit NF-B and its upstream activator IB kinase ^9,10, as opposed to working through cyclooxygenase, the classic target of nonsteroidal anti-inflammatory drugs. Activation of NF-B can increase the production of various inflammatory cytokines, including TNF-²¹. However, no data are available regarding whether salicylate acts through inhibition of TNF- production. Therefore, the present study addressed three major issues. First, having documented an increase in TNF- mRNA and protein in cisplatin injury, to determine if salicylate treatment blunts the activation of TNF- systems within the kidney. Second, to determine if the protective effects of salicylate are referable to an inhibition of TNF- production. Third, to determine if salicylate prevents the degradation of IB, reduces NF-B DNA binding activity and the increase in TNF- mRNA in vitro.

We confirmed the results of Li et al¹¹ by demonstrating a significant protective effect of salicylate on cisplatin nephrotoxicity. In addition, we demonstrated preservation of renal histology and a reduction in necrosis, apoptosis, and renal leukocyte infiltration. As we, and others, have reported^4,5, kidney mRNA and protein levels for TNF- were increased by cisplatin in vivo. In addition, levels of TNFR1, TNFR2, MCP-1, ICAM-1, and HO-1 mRNA levels were increased. Treatment with salicylate reduced the expression of TNF- but not ICAM-1, MCP-1, TNFR1, or HO-1. HO-1 is increased in response to oxidative stress as occurs in cisplatin injury²⁹. Moreover, increases in HO-1 protect the kidney against cisplatin injury, while HO-1 knockout animals are more susceptible to cisplatin injury¹⁸. Although salicylate has antioxidant properties, the lack of any effect on HO-1 expression suggests that this was not a major pathway for protection against cisplatin injury. Likewise, the observation that salicylate decreased leukocyte infiltration Figure 4, but not ICAM-1 or MCP-1 expression, suggests that these molecules are not sufficient to account for leukocyte influx in cisplatin nephrotoxicity.

Salicylate decreased the expression of TNF- and TNFR2. In this regard, TNFR2 rather than TNFR1 is the primary mediator of cisplatin nephrotoxicity³⁰. We have shown, for instance, that cisplatin up-regulates TNFR2 to a greater extent than TNFR1, and that the up-regulation of TNFR2 by cisplatin is partly TNF-–dependent³⁰. Moreover, TNFR2-deficient mice are resistant to cisplatin nephrotoxicity. In this study, salicylate caused only a modest, and not statistically significant, reduction in TNFR2. This may reflect the incomplete suppression of TNF- by salicylate, as opposed to the complete absence of TNF- in the TNF- knockout mice used in our previous study³⁰. Finally, we demonstrated that the protective effects of salicylate are markedly reduced in the absence of TNF- Figure 7. Accordingly, the results of the present study indicate that inhibition of TNF- production is the major mechanism for the protective actions of salicylate in cisplatin toxicity.

The sites of renal TNF- production in cisplatin nephrotoxicity are not certain. However, we found, like Tsuruya et al⁶, that cisplatin increases TNF- mRNA and protein in proximal tubule cells in vitro. Therefore, we used this system to examine the effects of salicylate on TNF- production. Salicylate decreased cisplatin-induced TNF- mRNA expression and inhibited both cisplatin-induced IB degradation and cisplatin-induced NF-B DNA binding activity. The latter findings are consistent with the known ability of salicylate to inhibit the activity of IKK⁹. Together, these observations suggest that salicylates may reduce TNF- transcription by stabilizing IB and preventing NF-B from binding to the TNF- promoter²¹.

Because salicylates and TNF- antagonists reduce cisplatin nephrotoxicity, it is relevant to consider their possible effects on the oncolytic actions of cisplatin. Li et al¹¹ implanted tumors in mice and then administered cisplatin alone or in conjunction with sodium salicylate. No reduction in tumor killing was seen in the salicylate-treated animals. Indeed, because NF-B is a cell survival factor³¹, its inhibition by salicylate may increase the effectiveness of chemotherapy. There are no comparable data concerning the effects of TNF- antagonism on responses to chemotherapy. However, since salicylates reduce TNF- production (current study), but did not reduce cisplatin anti-tumor efficacy¹¹, reduction of TNF- may not impact tumor killing. Likewise, because TNF- is a potent inducer of NF-B activity, it is conceivable that antagonism of TNF- may sensitize tumors to the effects of chemotherapy. Moreover, our observation that the nephrotoxicity of cisplatin is mediated via TNFR2, while the anti-tumor actions of TNF- are mediated via TNFR1³², suggest that it should be possible to devise strategies to inhibit nephrotoxicity without compromising the tumor-killing efficacy of cisplatin.

CONCLUSION

We have demonstrated both in vivo and in vitro that salicylate attenuates cisplatin-induced TNF- production, leukocyte infiltration, and kidney dysfunction. The current study, along with others^5,6, indicates the importance of TNF- pathways in cisplatin- induced acute renal injury. Blockade of TNF- production and/or action may be effective in reducing cisplatin-induced acute renal injury. However, further studies are needed to determine the impact of TNF- inhibition on the clinical efficacy of cisplatin.

References

References

1.	LEBWOHL D & CANETTA R. Clinical development of platinum complexes in cancer therapy: An historical perspective and an update. Eur J Cancer 1998; 34: 1522–1534. | Article | PubMed | ISI | ChemPort |
2.	RIES F & KLASTERSKY J. Nephrotoxicity induced by cancer chemotherapy with special emphasis on cisplatin toxicity. Am J Kidney Dis 1986; 13: 368–379.
3.	KELLY KJ, MEEHAN SM & COLVIN RB et al. Protection from toxicant-mediated renal injury in the rat with anti-CD54 antibody. Kidney Int 1999; 56: 922–931. | PubMed |
4.	DENG J, KOHDA Y & CHIAO H et al. Interleukin-10 inhibits ischemic and cisplatin-induced acute renal injury. Kidney Int 2001; 60: 2118–2128. | PubMed |
5.	RAMESH G & REEVES WB. TNF- mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity. J Clin Invest 2002; 110: 835–842. | Article | PubMed | ISI | ChemPort |
6.	TSURUYA K, NINOMIYA T & TOKUMOTO M et al. Direct involvement of the receptor-mediated apoptotic pathways in cisplatin-induced renal tubular cell death. Kidney Int 2003; 63: 72–82. | PubMed |
7.	SHULMAN LM, YUHAS Y & FROLKIS I et al. Glycerol induced ARF in rats is mediated by tumor necrosis factor . Kidney Int 1993; 43: 1397–1401. | PubMed | ISI | ChemPort |
8.	DONNAHOO K, MENG X & AYALA A et al. Early kidney TNF- expression mediates neutrophil infiltration and injury after renal ischemia-reperfusion. Am J Physiol 1999; 277: R922–R929. | PubMed | ISI | ChemPort |
9.	YUAN M, KONSTANTOPOULOS N & LEE J et al. Reversal of obesity- and diet-induced insulin resistance with salicylate or targeted distruption of Ikk. Science 2001; 293: 1673–1677. | Article | PubMed | ISI | ChemPort |
10.	PIERCE JW, READ MA & DING H et al. Salicylates inhibit IB- phosphorylation, endothelial leukocyte adhesion molecule expression and neutrophil transmigration. J Immunol 1996; 156: 3961–3969. | PubMed | ISI | ChemPort |
11.	LI G, SHA S & ZOTOVA E et al. Salicylate protects hearing and kidney function from cisplatin toxicity without compromising its oncolytic action. Lab Invest 2002; 82: 585–596. | PubMed |
12.	BARNES P & KARIN M. Nuclear factor-B—A pivotal transcription factor in chronic inflammatory diseases. N Engl J Med 1997; 336: 1066–1071. | Article | PubMed | ISI | ChemPort |
13.	MEGYESI J, SAFIRSTEIN RL & PRICE PM. Induction of p21WAF1/CIP1/SDI1 in kidney tubule cells affects the course of cisplatin-induced acute renal failure. J Clin Invest 1998; 101: 777–782. | PubMed | ISI | ChemPort |
14.	KELLY KJ, WILLIAMS WW, COLVIN RB & BONVENTRE JV. Antibody to intercellular adhesion molecule-1 protects the kidney against ischemic injury. Proc Natl Acad Sci USA 1994; 91: 812–816. | PubMed | ChemPort |
15.	RABB H, DANIELS F & O'DONNELL M et al. Pathophysiological role of T lymphocytes in renal ischemia-reperfusion injury in mice. Am J Physiol Renal Physiol 2000; 279: F525–F531. | PubMed | ISI | ChemPort |
16.	MINAMI T, ICHII M & OKAZAKI Y. Comparison of three different methods for measurement of tissue platinum level. Bio Trace Elem Res 1995; 48: 37–44.
17.	HERRMANN M, LORENZ HM & VOLL R et al. A rapid and simple method for the isolation of apoptotic DNA fragments. Nucleic Acids Res 1994; 22: 5506–5507. | PubMed | ChemPort |
18.	SHIRAISHI F, CURTIS L & TRUONG L et al. Heme oxygenase-1 gene ablation or expression modulates cisplatin-induced renal tubular apoptosis. Am J Physiol Renal Physiol 2000; 278: F726–F736. | PubMed | ISI | ChemPort |
19.	KELLY KJ, PLOTKIN Z & DAGHER PC. Guanosine supplementation reduces apoptosis and protects renal function in the setting of ischemic injury. J Clin Invest 2001; 108: 1291–1298. | Article | PubMed | ISI | ChemPort |
20.	KELLY KL, SANDOVAL RM & DUNN KW et al. A novel method to determine specificity and sensitivity of the TUNEL reaction in the quantitation of apoptosis. Am J Physiol Cell Physiol 2003; 284: C1309–C1318. | PubMed |
21.	YOUNG S, YE J & FRAZER D et al. Molecular mechanism of tumor necrosis factor- production in 1–3- glucan (zymosan)-activated macrophages. J Biol Chem 2001; 276: 20781–20787. | Article | PubMed | ChemPort |
22.	WINSTON JA & SAFIRSTEIN R. Reduced renal blood flow in early cisplatin-induced acute renal failure in the rat. Am J Physiol 1985; 249: F490–F496. | PubMed | ISI | ChemPort |
23.	LEIBBRANDT ME, WOLFGANG GH & METZ AL et al. Critical subcellular targets of cisplatin and related platinum analogs in rat renal proximal tubule cells. Kidney Int 1995; 48: 761–770. | PubMed | ISI | ChemPort |
24.	SUGIYAMA S, HAYAKAWA M & KATO T et al. Adverse effects of anti-tumor drug, cisplatin, on rat kidney mitochrondria: disturbances in glutathione peroxidase activity. Biochem Biophys Res Commun 1989; 159: 1121–1127. | Article | PubMed | ISI | ChemPort |
25.	BALIGA R, ZHANG Z & BALIGA M et al. In vitro and in vivo evidence suggesting a role for iron in cisplatin-induced nephrotoxicity. Kidney Int 1998; 53: 394–401. | PubMed |
26.	KAUSHAL G, KAUSHAL V, HONG X & SHAH S. Role and regulation of activation of caspases in cisplatin-induced injury to renal tubular epithelial cells. Kidney Int 2001; 60: 1726–1736. | PubMed |
27.	DAVIS C, NICK H & AGARWAL A. Manganese superoxide dismutase attenuates cisplatin-induced renal injury: Importance of superoxide. J Am Soc Nephrol 2001; 12: 2683–2690. | PubMed | ISI | ChemPort |
28.	LIEBERTHAL W, TRIACA V & LEVINE J. Mechanisms of death induced by cisplatin in proximal tubular eipthelial cells: Apoptosis vs. necrosis. Am J Physiol Renal Physiol 1996; 270: F700–F708.
29.	AGARWAL A, BALLA J & ALAM J et al. Induction of heme oxygenase in toxic renal injury: A protective role in cisplatin nephrotoxicity in the rat. Kidney Int 1995; 48: 1298–1307. | PubMed | ISI | ChemPort |
30.	RAMESH G & REEVES WB. TNFR2-mediated apoptosis and necrosis in cisplatin-induced acute renal failure. Am J Physiol Renal Physiol 2003; 285: F610–618. | PubMed |
31.	WANG C-Y, MAYO MW & BALDWIN AS. TNF- and cancer therapy-induced apoptosis: Potentiation by inhibition of NF-B. Science 1996; 274: 784–787. | Article | PubMed | ISI | ChemPort |
32.	BAUD V & KARIN M. Signal transduction by tumor necrosis factor and its relatives. Trends Cell Biol 2001; 11: 372–377. | Article | PubMed | ISI | ChemPort |

Acknowledgments

This work was supported by the Veterans Affairs Medical Research Service and grants from the American Heart Association and the Four Diamonds Fund.