Hormones – Cytokines – Signaling

Kidney International (2003) 64, 1632–1642; doi:10.1046/j.1523-1755.2003.00263.x

Vitamin D3 up-regulated protein-1 regulates collagen expression in mesangial cells

Tsutomu Kobayashi, Sayuri Uehara, Takanori Ikeda, Hiraku Itadani and Hidehito Kotani

Banyu Tsukuba Research Institute in collaboration with Merck Research Laboratories, Tsukuba, Ibaraki, Japan

Correspondence: Hidehito Kotani, Banyu Tsukuba Research Institute, Ibaraki 300-2611, Japan. E-mail: kotanihh@banyu.co.jp

Received 16 January 2003; Revised 16 June 2003; Accepted 26 June 2003.

Top

Abstract

Vitamin D3 up-regulated protein-1 regulates collagen expression in mesangial cells.

Background

 

Hyperglycemia is a known risk factor in the pathogenesis of nephropathy, and collagen accumulation due to an increase reactive oxygen species (ROS) has been suspected to be one of the reasons for high glucose-mediated diseases. However, molecular mechanisms that connect glucose stimulation, oxidative stress, and collagen induction are unknown.

Methods

 

We examined global changes in gene expression patterns following high glucose stimulation by using DNA microarray technology in cultured human mesangial cells. The expression of vitamin D3 up-regulated protein-1 (VDUP-1), our candidate for the molecular mediator, was evaluated in the human mesangial cells, mouse mesangial cell line, and kidneys of diabetic mice by quantitative reverse transcription-polymerase chain reaction (RT-PCR). Truncated VDUP-1 proteins were used to test the effects of VDUP-1 on the biosynthesis of collagen in mesangial cells.

Results

 

Expression of VDUP-1, which was reported as an inhibitor of thioredoxin, was induced rapidly and constantly after exposure to high concentrations of glucose upon analysis with DNA microarray. Overexpression of VDUP-1 gene in cultured mesangial cells resulted in type IV collagen alpha1 chain (COL4A1) mRNA induction and accumulation of type IV collagen protein. However, induction of COL4A1 expression was abolished with a deletion mutant of VDUP-1, which lost thioredoxin-interacting domain. Also, streptozotocin-induced diabetic mice were shown to overexpress VDUP-1 as well as COL4A1.

Conclusion

 

VDUP-1 mediates collagen accumulation in mesangial cells and could be the molecular mediator/marker for fibrosis in diabetic nephropathy caused by chronic hyperglycemia such as diabetes.

Keywords:

diabetic nephropathy, hyperglycemia, DNA microarray, VDUP-1 collagen

Diabetes mellitus is implicated as the major factor initiating development of diabetic nephropathy in humans and in animal models of diabetes mellitus1. Diabetic nephropathy is characterized by an accumulation of mesangial extracellular matrix and manifests as glomerulosclerosis2,3. Elevated blood glucose levels in diabetes promote the synthesis of extracellular matrix proteins and inhibition of matrix turnover1. The accumulation of matrix proteins in mesangium in diabetes in vivo is reproduced to increase matrix proteins production by mesangial cells grown under high glucose conditions in vitro4. However, the molecular mechanisms driving diabetic nephropathy in mesangial cells have not been characterized.

Diabetic nephropathy involves structural alterations that are characterized by development of thickened glomerular basement membranes and progressive accumulation of extracellular matrix proteins in the glomerular mesangium2,3,5. In kidneys of human and experimental animal models, increased renal synthesis of extracellular matrix, including type IV collagen, is an early event in diabetic nephropathy6,7,8. In mesangial cells, high glucose stimulates the production of type IV collagen and other extracellular matrix proteins by activating the cellular transforming growth factor-beta (TGF-beta) system9. High glucose increases the secretion of endogenous TGF-beta110,11 that acts on the cells in an autocrine fashion to stimulate the expression of extracellular matrix proteins12.

Glucose-induced oxidative stress is thought to be an important cause of diabetic nephropathy13,14. In kidneys with diabetic nephropathy, the levels of 8-hydroxydeoxyguanosine, a marker of oxidative tissue damage, are increased15. In cultured mesangial cells, reactive oxygen species (ROS) generation was demonstrated under high glucose conditions16, and high glucose-induced collagen production in mesangial cells was effectively prevented by antioxidants, including taurine17 and vitamin E18. It has also been reported that hydrogen peroxide increases gene expression of extracellular matrix in cultured mesangial cells through activating TGF-beta1 synthesis19. Several studies have demonstrated that ROS increase the synthesis of arachidonic acid metabolites20, platelet-activating factor21, endothelin22, and nitric oxide23,24 in kidneys. These bioactive mediators modulate cellular proliferation and extracellular matrix synthesis in kidneys. Oxygen derivatives, acting as a secondary intracellular messenger, have been shown to activate transcription factors25,26, such as nuclear factor kappaB (NF-kappaB)27,28 and activated protein-1 (AP-1)29.

Vitamin D3 up-regulated protein-1 (VDUP-1), originally reported as an up-regulated gene in HL-60 cells treated with 1alpha,25-dihydroxyvitamin D330, has been reported to interact with thioredoxin31,32,33,34,35. Thioredoxin acts as an antioxidant by reducing ROS and has a role in defense against oxidative stress25,36. Previous studies showed that VDUP-1 binds to the catalytic center of thioredoxin and inhibits the reducing activity of thioredoxin31,32,34,35. Thus, VDUP-1 seems to have a role in regulating redox state in a cell by regulating the activity of thioredoxin. Thioredoxin has been shown to be a direct binding protein of apoptosis signal-regulating kinase 1 (ASK-1) and acts as a direct inhibitor of ASK-137. VDUP-1 inhibits the interaction between thioredoxin and ASK-1 and sensitizes cells to apoptosis32. In fact, it has been reported that overexpression of VDUP-1 in NIH3T3 cells renders the cells more vulnerable to hydrogen peroxide and accelerates apoptosis of these cells during oxidative stress32.

In this report, using a DNA chip technique, we identified that expression of VDUP-1 increased in human mesangial cells exposed to high glucose conditions. To assess the role of VDUP-1 induction in mesangial cells with high glucose, we investigated whether overexpression of VDUP-1 modulated the expression of type IV collagen in cultured mesangial cells. Second, we investigated mechanisms of VDUP-1–mediated type IV collagen alpha1 chain (COL4A1) induction by VDUP-1 deletion mutants, which were used whether they induced COL4A1 expression. And finally, we investigated its expression in the kidneys of diabetic mice induced by streptozotocin.

Top

METHODS

All reagents were obtained from Sigma Chemical Co., Ltd. (St. Louis, MO, USA) unless otherwise stated.

Primary cultured human mesangial cells

Primary cultured human mesangial cells were obtained from Clonetics (Walkersville, MD, USA). The cells were maintained in RPMI 1640 medium, containing 10% fetal calf serum (FCS), 100 mug/mL penicillin, and 100 mug/mL streptomycin. All culture medium were purchased from Invitrogen Corp. (Carlsbad, CA, USA). Cells were routinely passaged with a 1:5 split and were used for experiments at the seventh to ninth passages. Before the beginning of experiments, cells were grown until confluent in assay flasks with normal culture medium. Subsequently, cells were cultured with high glucose condition for each experimental period. During the experimental period, to control for the effect of hyperosmolality, mesangial cells under normal glucose condition were cultured in medium containing 25 mmol/L L-glucose, which is an optical isomer of D-glucose and is not metabolized in cells. At the end of high glucose stimulation, cells were lysed by TRIzol (Invitrogen Corp.) for investigating gene expression. Obtained RNA was purified by RNeasy (Qiagen GmbH, Hilden, Germany) and stored at -80°C until use.

Microarray

The cDNA labeling, hybridization, and scanning were performed as described by Affimetrix (Santa Clara, CA, USA). DNA microarray (GeneChip MG-U74Av2, Affimetrix) analysis was performed to study the gene expression profile of mesangial cells. Fold-change values were obtained by GeneChip software and a two-fold change was considered as a threshold for real differences in gene expression change.

MES13 cells

The mouse mesangial cell line MES1338,39,40 was obtained from ATCC (Manassas, VA, USA), and cultured using 3:1 mixture of Dulbecco's modified Eagle's medium (DMEM) and Ham's F12 media, containing 5% FCS, 100 ug/mL penicillin, and 100 mug/mL streptomycin. Cells were routinely passaged with a 1:10 split. MES13 cells were cultured in normal glucose (5 mmol/L) or high glucose (30 mmol/L) conditions for 1, 2, 3, and 4 days. At the end of each culture period, cells were lysed, and total RNA was extracted by RNeasy (Qiagen). Obtained RNA was dissolved in RNase-free water and stored at -80°C until use.

Vitamin D3 (1,25(OH)2 vitamin D3) was dissolved in ethanol and added to the experimental culture medium at a final ethanol concentration of 0.1%. MES13 cells were cultured for 24 hours in normal glucose condition with vehicle or with various concentrations of vitamin D3. Total RNA was extracted to measure gene expression of VDUP-1.

For TGF-beta-antibody experiments, MES13 cells containing pIND-VDUP were incubated for 24 hours (1) in normal glucose condition or (2) with 5 mumol/L ponasterone A or (3) with 5 mumol/L ponasterone A + 20 mug/mL TGF-beta-neutralizing antibody (R&D Systems, Minneapolis, MN, USA). At the end of incubation period, total RNA was extracted to measure gene expression levels of VDUP-1 and COL4A1.

Quantitative polymerase chain reaction (PCR)

Total RNA was reverse-transcribed to evaluate gene expression levels. Equal amounts of total RNA from each sample were converted to cDNA by TaqMAN Reverse Transcription Reagents (Applied Biosystems, Foster City, CA, USA, http://www.appliedbiosystems.com) with random hexamer primers according to manufacturer's manual (Applied Biosystems). Real-time quantification of the target genes was performed with an SYBR Green PCR assay (Applied Biosystems) using ABI PRISM 7700 Sequence Detection System (Applied Biosystems). The expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a housekeeping gene, was measured as an internal control for sample-to-sample variation in reverse transcription (RT) reaction, and the extent of degradation and recovery of RNA was monitored. As negative controls, the same reaction was performed on the RNA samples without RT reaction, and no PCR products were detected. The sequences of primers were as follows: human VDUP-1 (AB051901), sense CACACTTACCTTGCCAATGGC, antisense TGCGCATGTCCCTGAGATAATA; human COL4A1 (NM001845), sense GGTGTTGCAGGAGTGCCAG, antisense GCAAGTCGAAATAAAACTCACCAG; mouse VDUP-1 (AF282826), sense TCTCCTAGAAGAGCAGCCTACAGG, anti-sense CTCGAAGCCGAACTTGTACTCATA; and mouse COL4A1 (X06777), sense GTCTGGCTTCTGCTGCTCTTC, antisense CCTTCACGCCATGACAGTCA. The measurements of GAPDH expression were measured using Pre-Developed TaqMAN Assay Reagents (Applied Biosystems). Relative quantities of target gene expressions were compared after normalization to the value of GAPDH.

Overexpression of VDUP-1 in MES13 cells

An ecdysone-inducible expression system (Invitrogen Corp.)41 was used for VDUP-1 overexpression in MES13 cells. To establish ecdysone-inducible system in MES13 cells, the cells were transfected with the linearized plasmid pVgRXR containing ecdysone receptor and retinoid X receptor (RXR). The ecdysone receptor and the RXR form a heterodimer, which binds ecdysone response element in the presence of ponasterone A (a synthetic analog of ecdysone). Clonal cells containing these genes were selected by the resistance against Zeocin (0.5 mg/mL). We checked for ecdysone-inducible gene expression in these cells by transient transfection of plasmid pIND/TOPO/lacZ, which contains beta-galactosidase gene in the downstream of ecdysone response element. The inducible expression of beta-galactosidase responding to ponasterone A, which is a potent synthetic ecdysone analog, was tested by standard liquid O-nitrophenyl beta-galactoside assay. PCR fragment containing the whole coding region of the mouse VDUP-1 gene was amplified by RT-PCR. The sequences of the primers were as follows: sense TTTTCCTCTCCGGCTTTCGT, antisense CTTCATTTCCTGCAGCTTCA. Plasmid pIND-VDUP was constructed by ligation of the obtained PCR product into pIND/V5-His-TOPO vector in the sense orientation and checked the DNA sequences. Linearized pIND-VDUP was transfected to MES13 cells expressing the heterodimeric ecdysone receptor, and clones containing pIND-VDUP were selected by the resistance to G418 (1 mg/mL). Obtained cells were treated with 5 mumol/L ponasterone A, potent ecdysone analog, for 24 hours, and total RNA was extracted to measure gene expression levels.

Measurement of type IV collagen protein

The amount of type IV collagen protein in the culture medium was determined by competitive indirect enzyme-linked immunosorbent assay (ELISA). MES13 cells containing pIND-VDUP were treated with 5 mumol/L ponasterone A for 24 hours. The culture medium was collected and stored at -80°C until use. Cells were lysed in 0.1% sodium dodecyl sulfate (SDS) and collected to determine the amount of cell protein. The quantities of type IV collagen were measured by an ELISA Kit (Collagen IV M, Exocell, Inc, Philadelphia, PA, USA). The quantities of collagen protein were normalized to the amounts of cell protein.

VDUP-1 deletion study

Clones carrying the full-length or truncated VDUP-1 sequence were constructed as follows33. The full-length and two smaller size VDUP-1 cDNA were produced by PCR. One deletion construct, DEL155, had 155 amino acid residues deleted from the first methionin, and another construct, DEL 226, had 1-226 amino acid residues deleted. The sequences of the PCR primers were as follows: full-length forward ATGGTGATGTTCAAGAAG; DEL155 forward GACCTAATGGCACCAGTG; DEL226 forward CAGACCAAAGTGTTCACT; and reverse primer for all amplicons CTTCATTTCCTGCAGCTTCA. The cDNA sequences of first methionin were joined to each PCR product in-frame with the VDUP-1 protein and ligated into a plasmid pIND. The authenticity of sequences for these constructs was verified by DNA sequencing. These constructs were transfected to MES13 cells expressing ecdysone receptors and clones were selected by the resistance to Zeocin and G418. Obtained clones were treated 5 mumol/L ponasterone A for 24 hours, and total RNA was extracted to measure gene expressions of COL4A1.

Streptozotocin-induced diabetic mouse

Ten-week-old male mice were housed in specific pathogen-free facility and were maintained on standard mouse chow and tap water ad libitum. The mice were injected with a bolus injection of 185 mg/kg of streptozotocin dissolved in 0.1 mmol/L citrate buffer (pH 4.5) into the tail vain. After 4 weeks, induction of diabetes was confirmed by measurement of the tail blood glucose level using the glucose oxidase method. Hyperglycemic mice with glucose levels>300 mg/dL were used. Four weeks after streptozotocin injection, the mice were anesthetized with pentobarbital, and blood samples were taken from the abdominal aorta. Kidneys were immediately frozen for gene expression analysis. Total RNA was extracted from the kidneys using TRIzol, and purified by RNeasy. RNA was dissolved in RNase-free water and stored until use. All animal procedures complied with NIH guidelines and were approved by the Banyu Animal Care and Usage Committee.

Laser capture microdissection and RT-PCR

Laser capture microdissection (LCM) was performed on a Leica AS LMD System (Leica Microsystems AG, Wetzlar, Germany) according to a manufacturer's manual. Briefly, mice were euthanized, and the kidneys were rapidly removed. The tissues were embedded in 22-oxacalcitriol compound (OCT) and immediately frozen in dry ice-chilled hexan. Sections (8 mum thick) were cut and mounted on glass slides. The sections were fixed in ethanol: acetic acid (19:1), rinsed with RNase-free water, stained with 0.01% toluidine blue, rinsed with RNase-free water, and completely dried. Approximately 350 glomeruli were collected by LCM. Total RNA from the microdissected glomeruli was extracted using RNeasy micro column (Qiagen). Obtained RNA samples were checked by Bioanalyzer 2100 System (Agilent Technologies, Palo Alto, CA, USA), reverse-transcribed, and applied to TaqMan RT-PCR analysis.

Statistical analysis

Results were compared using unpaired t test. A P value of 0.05 or less was regarded as denoting a significant difference.

Top

RESULTS

Induction of VDUP-1 expression in primary cultured mesangial cells with high glucose condition

In order to evaluate genetic alterations associated with high glucose exposure in kidney mesangial cells, we employed DNA microarray technology to analyze gene expression changes. The human mesangial cells were cultured in either standard glucose conditions (5 mmol/L) or high glucose conditions (30 mmol/L) with supplement of FCS (10%). Cells were harvested 1, 3, and 7 days after the high glucose exposure, and RNA was isolated. The resulting RNA samples were subjected for DNA microarray analysis. Oligonucleotide DNA microarray system was used for our assay and expression of 7070 probes were monitored in these analyses. We found that expression of S73591 was significantly induced by more than two-fold at all experimental points (day 1, day 3, and day 7 after culture with high glucose condition) Table 1. Induction of S73591 was stable at the following time points: 3.8-fold at day 1, 8.9-fold at day 3, and 5.1-fold increase at day 7. In fact, S73591 gene was the only gene with constant expression changes. Other genes that were known to alter the expression levels in mesangial cells with high glucose exposure were as follows: alpha2-macroglobulin (serpin family)42,43,44, 4.4-fold at day 7; and gamma-glutamylcysteine synthetase (glutathione biosynthesis)44, -3.9-fold at day 1. Subsequent database searches revealed that S73591 was VDUP-1, which was a gene originally isolated with association to oxidative stress33.


To confirm the microarray results, VDUP-1 mRNA expression level was reevaluated with quantitative RT-PCR. We have confirmed that expression of VDUP-1 was increased on days 1, 3, and 7 when compared to that of control cells Figure 1a. Induction rates were in good agreement with DNA microarray results, which were 3.4-fold, 12-fold, and 6.0-fold on day 1, 3, and 7, respectively. We also confirmed the expression of COL4A1 mRNA, an extracellular matrix protein that is known to be associated with basement membrane in the human glomeruli. The expression of COL4A1 was increased in high glucose conditions when compared to that in the normal glucose conditions Figure 1b. These results suggested that our cultured condition mimics in vivo glomerulosclerosis conditions as previously described by other studies4,45.

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Induction of vitamin D3 up-regulated protein-1 (VDUP-1) expression and type IV collagen alpha1 (COL4A1) expression in human mesangial cells. Human mesangial cells were exposed to normal glucose (control), and high glucose (HG) for 1, 3, and 7 days. Gene expression was analyzed by quantitative polymerase chain reaction (PCR) with corresponding the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control for loading. (A) The expressions of VDUP-1 mRNA. (B) The expression levels of COL4A1 mRNA. The mean plusminus SD (N = 3) of obtained values are shown with the relative ratio in control cells assigned a value of 1. *P < 0.05 vs. control; †P < 0.01 vs. control.

Full figure and legend (24K)

The expression of VDUP-1 in MES13

VDUP-1 mRNA was induced in cultured human mesangial cells in high glucose conditions. Next, we evaluated the effect of high glucose conditions on mouse-cultured mesangial MES13 cells38,39,40. MES13 cells were cultured in standard glucose (5 mmol/L) and high glucose conditions (30 mmol/L) for 4 days, and VDUP-1 mRNA was measured at each time point Figure 2a. We observed that expression of VDUP-1 was elevated at day 1 and continuously increased until day 4. Maximum expression of VDUP-1 was reached on day 4, which was 8.9-fold induction when compared to that during standard glucose conditions. In contrast to that of COL4A1 mRNA Figure 2b, induction of VDUP-1 mRNA was more rapid and extensive, which suggested that VDUP-1 induction is mediated by direct response to the high glucose exposure. The COL4A1 mRNA was slightly induced at day 3 and reached 1.8-fold induction within 4 days. We also examined whether vitamin D3 induced VDUP-1 expression in MES13 cells as descried in other cell lines, and results confirmed that induction of VDUP-1 by vitamin D3 in MES13 cells (1.7-fold with 10 nmol/L vitamin D, 1.9-fold with 1 mumol/L vitamin D3 compared to the vehicle treated).

Figure 2.
Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Induction of vitamin D3 up-regulated protein-1 (VDUP-1) expression and type IV collagen alpha1 (COL4A1) expression in MES13 cells. MES13 cells were incubated for 4 days in normal glucose or high glucose condition. Gene expressions were analyzed by quantitative polymerase chain reaction (PCR) with corresponding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control for loading. (A) Expression levels of VDUP-1 mRNA. (B) Expression levels of COL4A1 mRNA. The values are indicated with the relative ratio to each gene expression in the samples at day 0 assigned a value of 1. Each point represents the mean plusminus SD (N = 4). *P < 0.05 vs. control; †P < 0.01 vs. control.

Full figure and legend (21K)

The effect of VDUP-1 overexpression on COL4A1 expression

Collagen accumulation is the hallmark of glomerulosclerosis, and increases of COL4A1 play a pivotal part in this process45. COL4A1 induction had been demonstrated in various in vitro models of kidney diseases such as high glucose stimulation46, as well as rodent models of glomerulosclerosis, including streptozotocin-induced diabetic mice6,7. To investigate whether overexpression of VDUP-1 modulates collagen synthesis in mesangial cells, we constructed an ecdysone-inducible expression system of VDUP-1 in MES13 cells Figure 3a. In this system, mouse VDUP-1 gene was controlled under the ecdysone-inducible promoter so that expression of VDUP-1 can be regulated by the addition of ponasterone A, a synthetic potent ligand of ecdysone receptor, which upon the ligand binding, stimulates VDUP-1 expression. Plasmids containing ecdysone receptor and ecdysone-inducible VDUP-1 were sequentially transfected to MES13 cells and clones containing both plasmids were selected by resistance to Zeocin and G418. We checked the ecdysone induction in each clone by transient transfection of beta-galactosidase, which was cloned under ecdysone-inducible promoter, and cells with confirmed induction of beta-galactosidase by addition of ponasterone A were used in further analysis. Expression levels of VDUP-1 and COL4A1 were evaluated by the quantitative TaqMAN PCR. Figure 3 shows that VDUP-1 expression was induced about three-fold upon ponasterone stimulation Figure 3b, and expression of COL4A1 was induced about 1.8-fold Figure 3c. Cells, which were transfected only with ecdysone receptor, did not induce VDUP-1 and COL4A1 expression. In addition, we evaluated the accumulation of type IV collagen protein by ELISA, which confirmed the 2.7-fold accumulation of type IV collagen protein Figure 3d. These results indicated that VDUP-1 overexpression induced COL4A1 expression in MES13 cells and suggested VDUP-1 locates upstream of a COL4A1 expression regulation mechanism.

Figure 3.
Figure 3 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Up-regulation of type IV collagen alpha1 (COL4A1) expression by vitamin D3 up-regulated protein-1 (VDUP-1) in MES13 cells. (A) The scheme of ecdysone-inducible expression system. Abbreviations are: EcR, ecdysione receptor; RXR, retinoid X receptor; P, ponasterone A (synthetic ecdysone analog); E/GRE, ecdysone response element. (B) The induction of VDUP-1 expression in MES13 cells with the ecdysone-inducible expression system. Cells were incubated for 24 hours in normal glucose condition with (filled square) or without (square) ponasterone A. Gene expressions were analyzed by quantitative PCR with corresponding that of GAPDH as an internal control. The values are indicated with the relative ratio to the expression of VDUP-1 in the condition without ponasterone A assigned a value of 1. (C) The expression of COL4A1 mRNA in MES13 cells. The values are indicated with the relative ratio to the expression of COL4A1 mRNA in the condition without ponasterone A assigned a value of 1. (D) The accumulation of type IV collagen protein in the culture medium. Cells containing pIND-VDUP were incubated for 24 h in normal glucose condition with (filled square) or without (square) ponasterone A. The quantities of type IV collagen contained in the media at the end of incubation were determined by enzyme-linked immunosorbent assay (ELISA). Each point represents the mean plusminus SD (N = 3). *P < 0.05 vs. without ponasterone A; †P < 0.01 vs. without ponasterone A.

Full figure and legend (28K)

The effect of truncated VDUP-1 on the COL4A1 expression

In an attempt to assess functions of VDUP-1 in up-regulation of COL4A1 mRNA directly, we constructed a series of deletions in VDUP-1 molecule33, and the effects of these deletions on the expression of COL4A1 mRNA were investigated using the same ecdysone-inducible expression system. Two deletion constructs are illustrated in Figure 4a; DEL155 had a deletion of the first methionin to codon 155, DEL226 had a deletion of the 1-226 amino acid residues. These truncated VDUP-1 constructs were transfected to ecdysone receptor-containing MES13 cells, and expressions of VDUP-1 or its truncated forms was stimulated with 5 muM of ponasterone. Expression of COL4A1 mRNA was observed in both clones containing either full length VDUP-1 or DEL115 Figure 4b, whereas the VDUP-1 construct with 226 amino acids deletion (DEL226) failed to stimulate COL4A1 expression even when they retained the up-regulation of the VDUP-1 Figure 4b. These results indicated that the critical domain for COL4A1 induction resides in the amino acids residues 156-226 and that DEL226 lost the up-regulation activity of COL4A1 expression.

Figure 4.
Figure 4 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Effects of truncated vitamin D3 up-regulated protein-1 (VDUP-1) on expression levels of type IV collagen alpha1 (COL4A1) in MES13. (A) Constructs of truncated VDUP-1. The numbers above the closed bars indicate the amino acid numbers of VDUP-1 protein. Each construct was transfected into MES13 cells with ecdysone-inducible systems, and the expressions of transfected genes were induced by ponasterone A. (B) The gene expressions of VDUP-1 and COL4A1 in the cells (upper, full-length transfected; middle, DEL155 transfected; bottom, DEL226 transfected). Cells were treated with (filled square) or without (square) ponasterone A for 24 hours. Left graphs show the expression levels of VDUP-1, and right graphs show the expression levels of COL4A1. The values of gene expressions are indicated with the relative ratio to each gene expression in each clone without ponasterone A assigned a value of 1. Each point represents the mean plusminus SD (N = 3). †P < 0.01 vs. control.

Full figure and legend (27K)

The expression of VDUP-1 in the kidneys of streptozotocin-induced diabetic mice

Following in vitro observations, we studied the expression of VDUP-1 and COL4A1 in the diabetic kidney in vivo model. The streptozotocin-induced nephropathy model is a well-established in vivo model of diabetic nephropathy6,47, and several reports concluded that accumulation of collagen is important for pathogenesis of this model6. Also, in this streptozotocin-induced model, blood glucose was reported to be elevated47. Therefore, we chose streptozotocin-induced diabetic mice to evaluate the expression level of VDUP-1 mRNA in the kidneys. In our streptozotocin-induced mouse model, blood glucose levels were elevated after 28 days from the streptozotocin injection when compared to saline injection Figure 5a. The significant increase in blood glucose level suggested that mice were in the diabetic condition and relevant to elucidate VDUP-1 functions. Mice were sacrificed at 28 days, and mRNA levels were measured by quantitative TaqMAN PCR. The VDUP-1 mRNA seemed to be up-regulated in the kidneys of diabetic mice, and COL4A1 mRNA was significantly higher in the streptozotocin-treated diabetic mice than in control mice Figure 5b. We further confirmed that increased in VDUP-1 mRNA expression in glomeruli by laser capture microdissection from isolated glomeruli Figure 5c. These results imply that in vitro observations of VDUP-1-regulated COL4A1 expression could be translated to in vivo models of diabetic glomerulosclerosis, and pharmaceutical intervention of this process could lead to improvements in this pathologic condition.

Figure 5.
Figure 5 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Vitamin D3 up-regulated protein-1 (VDUP-1) expression in streptozotocin-induced diabetic mice. (A) Blood glucose concentrations of streptozotocin-induced diabetic mice. (square) indicates blood glucose levels of control mice and (filled square) indicates that of diabetic mice. (B) The expression levels of type IV collagen alpha1 (COL4A1) and VDUP-1 in kidneys of diabetic mice. The gene expression levels were analyzed by quantitative reverse transcription-polymerase chain reaction (RT-PCR) with corresponding that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control for loading. Left graph shows the levels of COL4A1 mRNA, and right graph shows the levels of VDUP-1 mRNA. The values are indicated with the relative ratio to each gene expression in control mice assigned a value of 1. Each point represents the mean plusminus SE (N = 4). (C) The gene expression levels of VDUP-1 in glomeruli of diabetic mice. The glomeruli were collected by laser capture microdissection (LCM), and the expression levels of VDUP-1 were analyzed by quantitative RT-PCR. The values are indicated with the relative ratio to the gene expression in control mice assigned a value of 1. Each point represents the mean plusminus SE (N = 3). *P < 0.05 vs. control; †P < 0.01 vs. control.

Full figure and legend (27K)

Top

DISCUSSION

In the present study, we evaluated mRNA expression changes associated with exposure to high glucose in cultured human primary mesangial cells. Upon analysis with DNA microarray, we have found that expression of VDUP-1, a vitamin D3 up-regulated protein-1, was induced rapidly and constantly after exposure to high concentrations of glucose. Overexpression of VDUP-1 mRNA in MES13 mesangial cells revealed that COL4A1 mRNA was induced by the expression of VDUP-1; however, the induction of COL4A1 expression was abolished in MES13 cells, which overexpressed a deletion mutant of VDUP-1. Streptozotocin-induced diabetic mice were shown to overexpress VDUP-1 and COL4A1. These results strongly indicated that VDUP-1 mediated collagen accumulation both in vitro and in vivo in mesangial cells and could be the molecular mechanism/marker for glomerulosclerosis caused by chronic hyperglycemia such as diabetes.

To our surprise, the expression patterns of only a few genes were changed by high glucose stimulation. A total of 173 genes showed increased expression after glucose exposure, and 82 genes showed two-fold decreases in gene expression. Several proteins associated with extracellular matrix have also changed their expression patterns. Expression levels of tenascin C48,49 and entactin50 were increased. However, relative changes in matrix protein mRNAs were small when compared to those reported in other published studies, and expression changes greater than two-fold were not detected in other matrix proteins. We chose to use mild cell culture conditions, which included serum and standard glucose in control cells, and these conditions may have contributed to the smaller changes after glucose stimulation. DNA microarray results were also confirmed by the other measurement of mRNA such as quantitative RT-PCR methods.

There are several observations that may suggest the mechanisms of VDUP-1 induction after high glucose exposure. NF-kappaB is a transcription factor that regulates the variety of gene expressions25 and is known to be one of the acute transcription factors that are induced by high glucose28. NF-kappaB mediates its transcriptional activation via binding to the nucleotide sequence, and this sequence is known to be located within the promoter region of VDUP-151. Overexpression of thioredoxin was reported to down-regulate NF-kappaB in HeLa cells52, which could be the mechanisms to maintain high VDUP-1 expression in reduced thioredoxin activities such as glucose exposure.

Oxidative stress has been implicated in the pathogenesis of tissue fibrosis19, and the regulation of cellular antioxidant systems is controlled by the activities of redox balance systems, including the thioredoxin system. Thioredoxin acts as an antioxidant by reducing ROS through an interaction with the redox-active center of thioredoxin36,53 and protects cells against hydrogen peroxide-induced cytotoxicity36. Thioredoxin participates in many thiol-dependent cellular reductive processes, including signal-transduction and regulation of the activity of transcription factors25,26. VDUP-1 has been reported as an endogenous inhibitor of thioredoxin31,32, and the redox-active site of thioredoxin mediates the interaction with VDUP-133, suggesting that the interaction may be an important regulatory mechanism of cellular redox processes. We found that expression of VDUP-1 is induced in the cells exposed to high glucose conditions, and similar observation was reported recently in rat-1 fibroblasts54. It is possible that the antioxidative response caused by high glucose exposure is induced by the rapid increase in VDUP-1 message and resulted changes in thioredoxin activity as an antioxidant. This is in good agreement with our deletion studies of VDUP-1. When we introduced the deletion of 1-226 amino acids in VDUP-1, the effects of COL4A1 mRNA induction were abolished; while mRNA induction was not affected by deletion of amino acids 1-155. The suggested critical domain for collagen induction resides between amino acids residues 156 and 226. This region coincides with the domain of VDUP-1 and thioredoxin interaction. Since the same region of VDUP-1 is responsible for both the up-regulation of COL4A1 and thioredoxin interaction, the induction of COL4A1 mRNA could be associated with oxidative response of VDUP-1. Induction of COL4A1 message by oxidative stress has been previously described19,55. High glucose stress-induced redox imbalance may cause dysregulation of collagen biosynthesis, which contributes to a variety of pathologic processes, including the kidney fibrogenic process in diabetic nephropathy13,17,18.

Induction of TGF-beta and activation of TGF-beta pathway are well-documented molecular events that occur during glomerulosclerosis both in vitro12,47,56 and in vivo10,47. It has been reported that high glucose conditions in cultured mesangial cells induced TGF-beta pathway56, and also hydrogen peroxide was reported to increase extracellular matrix mRNA through TGF-beta cascade in mesangial cells19. In fact, in our inducible VDUP-1 expression system, induction of type IV collagen expression was suppressed significantly by the additional of anti-TGF-beta antibody Figure 6 a and b. Hence, this observation confirmed that high glucose conditions lead to the VDUP-1 mRNA increase, which mediates type IV collagen expression, at least partially, through TGF-beta cascade. Direct interaction between collagen peptide (pro-alpha1 type I collagen) and reduced form of thioredoxin was recently reported, suggesting a possibility that assembly of type I collagen protein is under the regulation of thioredoxin-dependent redox control57. Although interaction of thioredoxin and type IV collagen remained to be elucidated, induction of VDUP-1 may have direct effects in type IV collagen assembly and accumulation.

Figure 6.
Figure 6 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Effect of transforming growth factor-beta (TGF- beta) blockade on vitamin D3 up-regulated protein-1 (VDUP-1)-induced type IV collagen alpha1 (COL4A1) expression. MES13 cells containing pIND-VDUP were incubated for 24 hours in normal glucose condition (square), with 5 mumol/L ponasterone A (filled square), or with 5 mumol/L ponasterone A + 20 mug/mL TGF-beta-neutralizing antibody (Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author). (A) The expression of VDUP-1 mRNA in MES13 cells. (B) The expression of COL4A1 mRNA in MES13 cells. The values are indicated with the relative ratio to the expression of each gene in the condition without ponasterone A and anti-TGF-beta antibody assigned a value of 1. Each point represents the mean plusminus SD (N = 3). *P < 0.05 vs. normal condition; †P < 0.01 vs. normal condition; ‡P < 0.05 vs. ponasterone A without anti-TGF- beta antibody.

Full figure and legend (24K)

It was reported that a potent vitamin D3 analog increases expression levels of TGF-beta type II receptor and type IV collagen in mesangial cells58, and MES13 cells induced VDUP-1 expression by vitamin D3 in our experiment. Since beneficial effects of a vitamin D3 analog in rat anti-Thy 1 glomerulonephritis was documented59, it could be interesting to examine the expression levels of VDUP-1 in such models.

We also confirmed that overexpression of VDUP-1 occurs in the streptozotocin-induced diabetic nephropathy model. The expression of VDUP-1 was significantly increased in kidneys of diabetic mice when compared to saline injected control mice, and expression of COL4A1 was increased. These results suggested that exposure to high glucose condition in vivo also caused up-regulation of VDUP-1 and COL4A1. However, our current study did not address the relationship among disease progression, VDUP-1 expression, and fibrosis; it is interesting to investigate the correlations between severity of glycemia and VDUP-1 expression in streptozotocin-induced diabetic models.

Top

CONCLUSION

We have identified a molecular mediator of collagen induction, VDUP-1, in vitro, and in vivo in streptozotocin-induced diabetic nephropathy models, by DNA microarray technology. Overexpression of VDUP-1 in mesangial cells directly influenced the level of COL4A1 mRNA in cultured mesangial cells, and deletion of thioredoxin-interacting domain abolished VDUP-1 induced COL4A1 expression. These data, together with previous works, indicated that VDUP-1 contributes to the development of diabetic nephropathy. Further works that decipher molecular pathways from VDUP-1 to COL4A1 will give us more insight into the role of hyperglycemia and oxidative stress in development of the fibrosis of diabetic nephropathy.

Top

References

References

1. The Diabetes Control and Comlications Trial Research Group. The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus. N Engl J Med 1993; 329: 977−986. | PubMed | ISI |
2. Steffes MW, Bilous RW & Sutherland DE et al. Cell and matrix components of the glomerular mesangium in type I diabetes. Diabetes 1992; 41: 679−684. | PubMed | ISI | ChemPort |
3. Osterby R, Gall MA & Schmitx FS et al. Glomerular structure and function in proteinuric type 2 (non-insulin-dependent) diabetic patients. Diabetologia 1993; 36: 1064−1070. | PubMed | ISI | ChemPort |
4. Ayo SH, Radnik RA & Garoni JA et al. High glucose causes an increase in extracellular matrix proteins in cultured mesangial cells. Am J Pathol 1990; 136: 1339−1348. | PubMed | ISI | ChemPort |
5. Osterby R. Glomerular structural changes in type 1 (insulin-dependent) diabetes mellitus: causes, consequences, and prevention. Diabetologia 1992; 35: 803−812. | PubMed | ISI | ChemPort |
6. Sharma K, Jin Y & Guo J et al. Neutralization of TGF-beta by anti-TGF-beta antibody attenuates kidney hypertrophy and the enhanced extracellular matrix gene expression in STZ-induced diabetic mice. Diabetes 1996; 45: 522−530. | PubMed | ISI | ChemPort |
7. Park I, Kiyomoto H & Abboud SL et al. Expression of transforming growth factor-beta and type IV collagen in early streptozotocin-induced diabetes. Diabetes 1997; 46: 473−480. | PubMed | ISI | ChemPort |
8. Adler SG, Kang S & Feld S et al. Glomerular mRNA in human type 1 diabetes: Biochemical evidence for microalbuminuria as a manifestation of diabetic nephropathy. Kidney Int 2001; 60: 2330−2336. | Article | PubMed | ISI | ChemPort |
9. Sharma K & Ziyadeh FN. Biochemical events and cytokine interactions linking glucose metabolism to the development of diabetic nephropathy. Semin Nephrol 1997; 17: 80−92. | PubMed | ISI | ChemPort |
10. Yamamoto T, Nakamura T & Noble NA et al. Expression of transforming growth factor beta is elevated in human and experimental diabetic nephropathy. Proc Natl Acad Sci USA 1993; 90: 1814−1818. | PubMed | ChemPort |
11. Sharma K & Ziyadeh FN. Renal hypertrophy is associated with up-regulation of TGF-beta1 gene expression in diabetic BB rat and NOD mouse. Am J Physiol 1994; 267: F1094−F1101. | PubMed | ISI | ChemPort |
12. Ziyadeh FN, Sharma K & Ericksen M et al. Stimulation of collagen gene expression and protein synthesis in murine mesangial cells by high glucose is mediated by autocrine activation of transforming growth factor-beta. J Clin Invest 1994; 93: 536−542. | PubMed | ISI | ChemPort |
13. Trachtman H, Futterweit S & Maeska J et al. Taurine ameliorates chronic streptozotocin-induced diabetic nephropathy in rats. Am J Physiol 1995; 269: F429−F438. | PubMed | ISI | ChemPort |
14. Koya D, Lee IK & Ishihi H et al. Prevention of glomerular dysfunction in diabetic rats by treatment of d-alpha-tocopherol. J Am Soc Nephrol 1997; 8: 426−435. | PubMed | ISI | ChemPort |
15. Ha H, Kim C & Son Y et al. DNA damage in the kidneys of diabetic rats exhibiting microalbuminuria. Free Rad Biol Med 1994; 16: 271−274. | Article | PubMed | ISI | ChemPort |
16. Ha H & Lee HB. Reactive oxygen species as glucose signaling molecules in mesangial cells cultured under high glucose. Kidney Int 2000; 58 Suppl 77: S19−S25. | Article | ISI |
17. Trachtman H, Futterweit S & Bienkowski RS. Taurine prevents glucose-induced lipid peroxidation and increased collagen production in cultured rat mesangial cells. Biochem Biophys Res Commun 1993; 191: 759−765. | Article | PubMed | ISI | ChemPort |
18. Trachtman H. Vitamin E prevents glucose-induced lipid peroxidation and increased collagen production in cultured rat mesangial cells. Microvasc Res 1994; 47: 232−239. | PubMed | ISI | ChemPort |
19. Cruz MCI, Ruiz-Torres P & Alcamí J et al. Hydrogen peroxide increases extracellular matrix mRNA through TGF-beta in human mesangial cells. Kidney Int 2001; 59: 87−95. | Article | PubMed |
20. Baud L, Nivez MP & Chansel D et al. Stimulation by oxygen radicals of prostaglandin production by rat renal glomeruli. Kidney Int 1981; 20: 332−339. | PubMed | ISI | ChemPort |
21. Lewis MS, Whatley RE & Cain P et al. Hydrogen peroxide stimulates the synthesis of platelet-activating factor by endothelium and induces endothelial cell-dependent neutrophil adhesion. J Clin Invest 1988; 82: 2045−2055. | PubMed | ISI | ChemPort |
22. Hughes AK, Stricklett PK & Padilla E et al. Effect of reactive oxygen species on endothelin-1 production by human mesangial cells. Kidney Int 1996; 49: 181−189. | PubMed | ISI | ChemPort |
23. Trachtman H, Futterweit S & Singhall P. Nitric oxide modulates the synthesis of extracellular matrix proteins in cultured rat mesangial cells. Biochem Biophys Res Commun 1995; 207: 120−125. | Article | PubMed | ISI | ChemPort |
24. López-Ongil S, Hernández-Perena O & Navarro-Antolín J et al. Role of reactive oxygen species in the signaling cascade of cyclosporine A-mediated up-regulation of eNOS in vascular endothelial cells. Br J Pharmacol 1998; 124: 447−454. | PubMed |
25. Sen CK & Packer L. Antioxidant and redox regulation of gene transcription. FASEB J 1996; 10: 709−720. | PubMed | ISI | ChemPort |
26. Sun Y & Oberley LW. Redox regulation of transcriptional activators. Free Rad Biol Med 1996; 21: 335−348. | Article | PubMed | ISI | ChemPort |
27. Schreck R, Rieber P & Baeuerle PA. Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappaB transcription factor and HIV-1. EMBO J 1991; 10: 2247−2258. | PubMed | ISI | ChemPort |
28. Hattri Y, Hattri S & Sato N et al. High-glucose-induced nuclear factor kappaB activation in vascular smooth muscle cells. Cardiovasc Res 2000; 46: 188−197. | PubMed |
29. Meyer M, Schreck R & Baeuerle PA. H2O2 and antioxidants have opposite effects on activation of NF-kappaB and AP-1 in intact cells: AP-1 as secondary antioxidant-responsive factor. EMBO J 1993; 12: 2005−2015. | PubMed | ISI | ChemPort |
30. Chen KS & Deluca HF. Isolation and characterization of a novel cDNA from HL-60 cells treated with 1,25-dihydroxyvitamin D3. Biochim Biophys Acta 1994; 1219: 26−32. | Article | PubMed | ISI | ChemPort |
31. Nishiyama A, Matsui M & Iwata S et al. Identification of thioredoxin-binding protein-2/vitamin D3 up-regulated protein 1 as a negative regulation of thioredoxin function and expression. J Biol Chem 1999; 274: 21645−21650. | Article | PubMed | ISI | ChemPort |
32. Junn E, Han SH & Im JY et al. Vitamin D3 up-regulated protein 1 mediates oxidative stress via suppressing the thioredoxin function. J Immunol 2000; 164: 6287−6295. | PubMed | ISI | ChemPort |
33. Yamanaka H, Maehira F & Oshiro M et al. A possible interaction of thioredoxin with VDUP-1 in HeLa cells detected in a yeast two-hybrid system. Biochem Biophys Res Commun 2000; 271: 796−800. | Article | PubMed | ISI | ChemPort |
34. Schulze PC, De Keulenaer GW & Yoshioka J et al. Vitamin D3-upregulated protein-1 (VDUP-1) regulates redox-dependent vascular smooth muscle cell proliferation through interaction with thioredoxin. Circ Res 2002; 91: 689−695. | Article | PubMed | ISI | ChemPort |
35. Wang Y, De Keulenaer GW & Lee RT. Vitamin D3-up-regulated protein-1 is a stress-responsive gene that regulates cardiomyocyte viability through interaction with thioredoxin. J Biol Chem 2002; 277: 26496−26500. | Article | PubMed | ISI | ChemPort |
36. Nordberg J & Arner ESJ. Reactive oxygen species, antioxidants, and the mammalian thioredoxin system. Free Rad Biol Med 2001; 31: 1287−1312. | Article | PubMed | ISI | ChemPort |
37. Saitoh M, Nishitoh H & Fujii M et al. Mammalian thioredoxin is a direct inhibitor of apoptosis signal-regulating kinase (ASK) 1. EMBO J 1998; 17: 2596−2606. | Article | PubMed | ISI | ChemPort |
38. Mackay K, Striker LJ & Pinkert CA et al. Glomerular epithelial, mesangial, and endothelial cell lines from transgenic mice. Kidney Int 1988; 33: 677−684. | PubMed | ISI | ChemPort |
39. Caenazzo C, Garbisa S & Ceol M et al. Heparin modulates proliferation and proteoglycan biosynthesis in murine mesangial cells. Nephrol Dial Transplant 1995; 10: 175−184. | PubMed | ISI | ChemPort |
40. Phillips SL, DeRubertis FR & Craven PA. Regulation of the laminin C1 promoter in cultured mesangial cells. Diabetes 1999; 48: 2083−2089. | PubMed | ISI | ChemPort |
41. No D, Yao T & Evans RM. Ecdysone-inducible gene expression in mammalian cells and transgenic mice. Proc Natl Acad Sci USA 1996; 93: 3346−3351. | Article | PubMed | ChemPort |
42. Yang AH & Chen JY. Glomerular deposition of alpha 2-macroglobulin in glomerular disease. Nephrol Dial Transplant 1997; 12: 465−469. | PubMed | ISI | ChemPort |
43. van Goor H, Diamond JR & Ding G et al. Alpha macroglobulins and the low-density-lipoprotein-related protein/alpha-2-macroglobulin receptor in experimental renal fibrosis. Exp Nephrol 1999; 7: 35−43. | Article | PubMed | ISI | ChemPort |
44. Catherwood MA, Powell LA & Anderson P et al. Glucose-induced oxidative stress in mesangial cells. Kidney Int 2002; 61: 599−608. | Article | PubMed | ISI | ChemPort |
45. Pugliese G, Pricci F & Pugliese F et al. Mechanisms of glucose-enhanced extracellular matrix accumulation in rat glomerular mesangial cells. Diabetes 1994; 43: 478−490. | PubMed | ISI | ChemPort |
46. Ziyadeh FN, Hoffman BB & Han DC. Long-term prevention of renal insufficiency, excess matrix gene expression, and glomerular mesangial matrix expansion by treatment with monoclonal antitransforming growth factor-beta antibody in db/db diabetic mice. Pro Natl Acad Sci USA 2000; 97: 8015−8020. | ChemPort |
47. Isono M, Mogyorósi A & Han DC et al. Stimulation of TGF-beta type II receptor by high glucose in mouse mesangial cells and in diabetic kidney. Am J Physiol 2000; 278: F830−F838. | ISI | ChemPort |
48. Truong LD, Majesky M & Pindur J. Tenascin is synthesized and secreted by rat mesangial cells in culture and is present in extracellular matrix in human glomerular diseases. J Am Soc Nephrol 1994; 4: 1771−1777. | PubMed | ISI | ChemPort |
49. Truong LD, Pindur J & Barrios R et al. Tenascin is an important component of the glomerular extracellular matrix in normal and pathologic conditions. Kidney Int 1994; 45: 201−210. | PubMed | ISI | ChemPort |
50. Miner JH. Renal basement membrane components. Kidney Int 1999; 56: 2016−2024. | Article | PubMed | ISI | ChemPort |
51. Ludwig DL, Kotanides H & Thanh L et al. Cloning, genetic characterization, and chromosomal mapping of the mouse VDUP1 gene. Gene 2001; 269: 103−112. | Article | PubMed | ISI | ChemPort |
52. Schenk H, Klein M & Erdbrügger W et al. Distinct effects of thioredoxin and antioxidants on the activation of transcription factors NF-kappaB and AP-1. Proc Natl Acad Sci USA 1994; 91: 1672−1676. | PubMed | ChemPort |
53. Powis G & Montfort WR. Properties and biological activities of thioredoxins. Annu Rev Pharmacol Toxicol 2001; 41: 261−295. | Article | PubMed | ISI | ChemPort |
54. Hirota T, Okano T & Kokame O et al. Glucose down-regulates Per1 and Per2 mRNA levels and induces circadian gene expression in cultured rat-1 fibroblasts. J Biol Chem 2002; 277: 44244−44251. | Article | PubMed | ISI | ChemPort |
55. Nath KA, Grande J & Croatt A et al. Redox regulation of renal DNA synthesis, transforming growth factor-beta1 and collagen gene expression. Kidney Int 1998; 53: 367−381. | Article | PubMed | ISI | ChemPort |
56. Kolm-Litty V, Sauer U & Nerlich A et al. High glucose-induced transforming growth factor beta1 production is mediated by the hexosamine pathway in porcine glomerular mesangial cells. J Clin Invest 1998; 101: 160−169. | PubMed | ISI | ChemPort |
57. Matsumoto K, Masutani H & Nishiyama A et al. C-peptide region of human pro alpha1 type 1 collagen interacts with thioredoxin. Biochem Biophys Res Commun 2002; 295: 663−667. | Article | PubMed | ISI | ChemPort |
58. Abe H, Iehara N & Utsunomiya K et al. A vitamin D analog regulates mesangial cell smooth muscle phenotypes in a transforming growth factor-beta type II receptor-mediated manner. J Biol Chem 1999; 274: 20874−20878. | Article | PubMed | ISI | ChemPort |
59. Makibayashi K, Tatematsu M & Hirata M et al. A vitamin D analog ameliorates glomerular injury on rat glomerulonephritis. Am J Pathol 2001; 158: 1733−1741. | PubMed | ISI | ChemPort |

Extra navigation

.
ADVERTISEMENT