The BRAF (v-raf murine sarcoma viral oncogene homolog B1) gene (MIM #164757) is situated on chromosome 7q34 (Eychene et al, 1992) and encodes a proto-oncogenic serine/threonine-protein kinase. Its normal function is to control proliferation and differentiation through the MAP kinase pathway.
Exon 15 BRAF mutations in melanoma were first reported in 2002 and 80% of the mutations identified were a single substitution of a neutral amino acid (valine at position 599 in exon 15) by a negatively charged one (usually glutamic acid) which is an activating mutation (Davies et al, 2002). The sequence numbering of the V599E is now changed to V600E, as there is a discrepancy of one codon in exon 1 in the BRAF gene sequence with accession number NM_004333. The sequence analysis of exon 1 of the BRAF gene byKumar et al, 2003 has shown that the sequence derived from NT_007914 is correct.
Davies et al studied melanoma lines and short-term cultures but only nine samples of primary melanoma, six of which contained the mutation. Other groups have therefore sought to confirm the work of Davies with larger numbers of primary tumor samples, and other relevant material. The number of reports of BRAF mutations in primary melanoma tissue is growing (Cruz et al, 2003;Dong et al, 2003;Omholt et al, 2003;Pollock et al, 2003;Uribe et al, 2003;Yazdi et al, 2003;Reifenberger et al, 2004;Sasaki et al, 2004;Shinozaki et al, 2004). These studies confirm the presence of BRAF mutations but at very varying prevalences in primary melanoma tissue which has led other groups to study primary melanoma tissue from the four major histogenetic types to see if there is any correlation between tumor type and the presence or absence of BRAF mutations (Maldonado et al, 2003;Sasaki et al, 2004).
In this paper, we report our experience of exon 15 BRAF mutations in the four major histogenetic subtypes of primary melanoma.
Results
Fifty-seven samples were selected for DNA extraction. DNA was successfully extracted and amplified from 52 of these (Table I). The five samples in which amplification failed were one superficial spreading melanoma, 3.5 mm thick from a male back aged 72 y and four acral lentiginous melanomas (AM), three from females and one from a male, all from the foot. Their thicknesses ranged from 1.6 to 7.0 mm.
Thirteen abnormal chromatogram patterns as shown in Figure 1, were identified on dHPLC for exon 15 and its flanking sequences. On sequencing all samples, on two occasions, ten of 13 samples showed the V600E substitution, (Figure 2) and in three it was only observed on one sequence result. All normal chromatogram patterns showed a wild-type sequence on both occasions. The allele-specific PCR confirmed the presence of the mutation in all 13 samples shown to have an abnormal dHPLC chromatogram pattern, including the three samples with one positive and one negative sequencing result. All samples negative on dHPLC and on two sequencing results were also negative in the allele-specific PCR. Thus, these data demonstrate in our hands the greater sensitivity of dHPLC over sequencing.
Figure 1.
Identification of mutation V600E by dHPLC. dHPLC WAVE analysis of PCR-amplified somatic DNA from tumor sample Braf19. Tumor DNA was amplified using intronic primer pair BRAF exon 15. All elution profiles that were abnormal were identical in pattern to each other.
Full figure and legend (16K)Figure 2.
Identification of mutation V600E in primary melanoma tumor tissue. Sequence analysis of PCR-amplified somatic DNA from tumor sample Braf30.
Full figure and legend (74K)The 13 samples in which we detected the V600E BRAF mutation were five of seventeen (29%) superficial spreading melanomas (SSM), three of 11 (27%) nodular melanomas (NM), two of ten (20%) lentigo maligna melanomas (LMM) and two of 13 (15%) AM. Nine of 29 (31%) samples from male patients and four of 23 (17%) from female patients were mutation positive (difference not significant). Six of 32 primary melanomas from constantly light-exposed sites defined above carried the mutation (19%), and seven of 20 (35%) primaries from habitually covered sites contained the mutation (difference not significant).
Discussion
This study adds a further 52 primary melanomas to those already investigated for BRAF mutations. Although there are currently 11 relevant papers in the literature, seven of these have studied less than 50 samples (Table II). A further three papers have reported on the consistently negative findings in the search for BRAF mutations in mucosal melanomas (Table III).
Pollock et al (2003) reported BRAF mutations in four of five samples, andCruz et al, 2003 found the BRAF mutation in two of ten primary melanomas.Dong et al, 2003 found BRAF mutations in five of eight (63%) vertical growth phase melanomas, and two of 20 (10%) radial growth phase melanomas.Uribe et al (2003) investigated the development of BRAF mutations during malignant transformation of melanocytes by examining DNA from 22 banal melanocytic nevi, 23 atypical melanocytic nevi, and 25 primary cutaneous melanomas (13 SSM, three AM, two LMM, three NM, and four unclassified melanomas) for BRAF mutations. Sixteen of 22 banal nevi (73%), 11 of 23 atypical melanocytic nevi (48%), and 13 of 25 melanomas (52%) had the V600E mutation. In this paper, no information is given as to which subtype of melanoma had the mutations, and no correlation was found between BRAF mutational status and age, presence of primary on sun exposed or covered site, or Clark level of invasion. Their findings of a high frequency of BRAF mutations in benign melanocytic lesions confirm the previous observation byPollock et al (2003) and also suggest that a proportion of benign melanocytic lesions with little or no recognized potential for progression to melanoma contain a population of BRAF-mutated cells. Similarly,Yazdi et al, 2003 in this journal detected BRAF mutations in 28 of 97 (29%) melanomas nevi, four of which were reported as arising in a nevus and in 39 of 187 (21%). Thus the V600E BRAF mutation alone appears not to be sufficient for malignant transformation of the nevus cell.
Shinozaki et al (2004) assessed BRAF mutation frequency in exons 11 and 15 in 59 primary and 68 metastatic melanomas. They found 18 of 59 (31%) primary melanomas to have a BRAF mutation in exon 15 with a significantly higher frequency in patients <60 y old (p=0.001). The incidence of BRAF mutations did not correlate with Breslow thickness.
Table III gives details of the findings in the four papers currently in the literature, which like us have divided BRAF findings by histogenetic type.
Omholt et al (2003) screened 71 primary melanomas and 88 corresponding metastases from 71 patients for BRAF exon 11 and exon 15 mutations. Of the 71 primary melanoma tumors, 40 were SSM, 28 NM, one LMM and two were not classified. They identified mutations in 42 of 71 patients (59%), with 23 of 41 SSM 17of 27 NM, and oneof one LMM carrying the mutation. In most cases, mutations present in the primary tumors were also found in the corresponding metastases, and mutations were not found in metastases arising from primary tumors without a BRAF mutation.
Maldonado et al (2003) identified BRAF mutations in 19 of 39 SSM, one of four NM, three of 23 AM, one of nine LMM and eight of 40 unclassified melanomas, and report a higher prevalence of primary melanomas with BRAF mutations from intermittently sun-exposed sites.
Reifenberger et al (2004) identified BRAF mutations in two of four AM, five of eight NM, zero of two SSM, and zero of one polypoid melanoma.
RecentlySasaki et al (2004) reported in this journal BRAF mutations in nine of 35 primary melanomas (26%). Four of eight (50%) SSM and five of 15 (33%) of AM had the mutation, but none of six NM, five LMM or one mucosal melanoma.Cohen et al (2004), Edwards et al (2004), andHelmke et al (2004) have together analyzed 40 mucosal melanomas and found the V600E mutation in only one case. Our only mucosal melanoma showed the mutation and it may be of relevance that the primary melanoma was on the light-exposed lip.
If the results from these studies and our observations reported in this paper are pooled, it appears that whereas BRAF mutations are more prevalent in SSM and NM, they are also present in a proportion of LMM and AM. Thus BRAF mutations are predominantly associated with melanomas arising on intermittently sun-exposed skin rather than those arising on continually exposed skin or totally non-exposed mucosal sites.
In conclusion, cumulative data show that the BRAF gene is mutated in 20%–80% of primary melanomas, although all reports to date involve relatively small numbers of primary melanomas. From these data and that relating to the presence of BRAF mutations in non-progressor benign nevi, it would appear that although mutations in the BRAF gene develop in some benign melanocytic lesions, additional events are needed for progression to melanoma. Conversely, the absence of mutations in a proportion of primary and metastatic melanomas indicate that there are alternative genetic pathways to melanoma.
Materials and Methods
DNA for this study was extracted from paraffin-embedded sporadic primary melanoma samples. Ethical committee permission (reference number LREC 00/161(2)) was obtained and written consent given by participants, all of whom were Caucasians resident in Scotland. The study was conducted according to the Declaration of Helsinki principles.
Samples were obtained from 17 SSM, 11 NM, 13 AM, one mucosal melanoma and ten LMM from 29 male patients and 23 female patients. The patient's age at diagnosis ranged from 40–88 y and Breslow thickness ranged from 0.6–22 mm (mean 6.3 mm, median 5.6 mm). The primary tumors selected were relatively thick because of the need to obtain an adequate volume of tumor tissue. We defined constantly sun-exposed skin in this environment as the head, neck, and hands in both sexes, and the female lower leg. Intermittently exposed sites in our climate are the trunk and arms in both sexes, and the legs in males.
Exon 15 BRAF mutation analysis
DNA extraction from paraffin-embedded tissue
Ten 10
M sections of formalin-fixed paraffin-embedded primary melanoma tissue were cut and deparaffinized in 1200
L of Histo-Clear (National Diagnostics, Hessle, UK). DNA was extracted using the QIAGEN QIAamp DNA Mini kit (Qiagen, Sussex, UK) according to the manufacturer's instructions.
Denaturing HPLC analysis
To identify the presence of mutant alleles a mutation screen of exon 15 was carried out by dHPLC using the Transgenomic WAVE 3500 machine (Transgenomic, Glasgow, UK). Optimum dHPLC temperatures were determined by a temperature scan, using the WAVEMaker 4.0 melting profile for this 37.5% GC-rich fragment. Three mutation positive samples were originally run at four temperatures to determine the profile of the mutated samples. The two best temperatures were chosen. For exon 15 of BRAF, samples were run at 56°C and 58°C, although all mutations were detected at 56°C. After amplification, DNA was eluted using a linear acetonitrile (Labscan, Dublin, Ireland) gradient at a flow rate of 0.9 mL per min with the gradient duration adjusted according to product length.
Sequence analysis
Exon 15 of the BRAF gene and the flanking splice junctions were amplified from the extracted DNA using primer sequences (Davies et al, 2002) and PCR conditions previously described (Lang et al, 2003). The amplified DNA was subjected to a second round of PCR amplification using the same conditions. Agarose gel electrophoresis and ethidium bromide staining confirmed the size and integrity of the expected 224 bp amplified fragments. PCR products were purified directly from PCR reaction mixtures using the QuickStep PCR Purification Kit (Ver. 4) (Edge BioSystems, Gateshead, UK) and mixed with 0.8
L of the sequencing primer, 4
L of ABI PRISM BigDye Terminator v3.1, 4
L of BetterBuffer (Microzone, Sussex, UK), and H2O to a final volume of 20
L. Samples were subjected to 25 cycles at 96°C for 10 s, 50°C for 5 s, and 60°C for 4 min, followed by purification by ethanol precipitation. Sequence analysis was carried out using an Applied Biosystems ABI PRISM 3100 Genetic Analyzer (ABI, Warrington, UK). Forward and reverse sequence electropherograms were generated by ABI Sequence Analysis 3.4.1 and analyzed using ABI SeqScape versions 1.1 and 2.0. Each sequence was read at least twice.
Allele-specific PCR
In order to validate the above sequencing and dHPLC results by only amplifying mutant DNA and to be able to perform a rapid screen of paraffin-embedded primary melanoma tissues, an allele-specific PCR was designed. For this study, the same reverse primer as used previously and taken fromDavies et al (2002) was used along with an allele-specific forward primer designed to only amplify DNA where the mutant V600E allele was present, and a control forward primer to amplify any wild-type sequence. The primers were V600V F AATAGGTGATTTTGGTCTAGCTACAGT, which amplifies only wild-type BRAF and V600E F AATAGGGATTTTGGTCTAGCTACAGA, which amplifies only the V600E mutant sequence. Amplification conditions were 1 cycle at 94°C for 5 min, 30 cycles at 94°C for 1 min, 57°C for 1 min, 72°C for 1 min, and 1 cycle at 72°C for 10 min.
References
- Brose, MS, Volpe, P, Feldman, M, et al: BRAF and RAS mutations in human lung cancer and melanoma. Cancer Res 2002 62:6997–7000,
- Cohen, Y, Rosenbaum, E, Begum, S, et al: Exon 15 BRAF mutations are uncommon in melanomas arising in non sun exposed sites. Cancer Res 2004 63:5761–5766,
- Cruz, F, III, Rubin, BP, Wilson, D, et al: Absence of BRAF and NRAS mutations in uveal melanoma. Cancer Res 2003 63:5761–5766,
- Davies, H, Bignell, GR, Cox, C, et al: Mutations of the BRAF gene in human cancer. Nature 2002 417:949–954,
- Dong, J, Phelps, RG, Qiao, R, Benard, O, Ronai, Z, Aaranson, SA: BRAF oncogenic mutations correlate with progression rather than initiation of human melanoma. Cancer Res 2003 63:3883–3885,
- Edwards, RH, Ward, MR, Wu, H, et al: Absence of BRAF mutations in UV protected mucosal melanomas. J Med Genet 2004 41:270–272,
- Eychene, A, Barnier, JV, Apiou, F, Dutrillaux, B, Calothy, G: Chromosomal assignment of two human B-raf(Rmil) proto-oncogene loci: B-raf-1 encoding the p94Braf/Rmil and B-raf-2, a processed pseudogene. Oncogene 1992 7:1657–1660,
- Helmke, BM, Mollenhauer, J, Herold-Mende, C, et al: BRAF mutations distinguish anorectal melanoma from cutaneous melanoma at the molecular level. Gastroenterology 2004 127:1815–1829,
- Kumar, R, Angelini, S, Czene, K, Sauroja, I, Hahka-Kemppinen, M, Pyrhonen, S: BRAF mutations in metastatic melanoma: A possible association with clinical outcome. Clin Cancer Res 2003 9:3362–3368,
- Lang, J, Boxer, M, MacKie, R: Absence of exon 15 BRAF germline mutations in familial melanoma. Hum Mutat 2003 21:327–330,
- Maldonado, JL, Fridlyand, J, Patel, H, et al: Determinants of BRAF mutations in primary melanomas. J Natl Cancer Inst 2003 17:1878–1890,
- Omholt, K, Platz, A, Kanter, L, Ringborg, U, Hansson, J: NRAS and BRAF mutations arise early during melanoma pathogenesis and are preserved throughout tumor progression. Clin Cancer Res 2003 9:6483–6488,
- Pollock, PM, Harper, UL, Hansen, KS, et al: High frequency of BRAF mutations in nevi. Nat Genet 2003 33:19–20,
- Reifenberger, J, Knobbe, CB, Sterzinger, AA, Blaschke, B, Schulte, KW, Ruzicka, T, Reifenberger, G: Frequent alterations of Ras signaling pathway genes in sporadic malignant melanomas. Int J Cancer 2004 109:377–384,
- Sasaki, Y, Niu, C, Makino, R, et al: BRAF point mutations in primary melanoma show different prevalences by subtype. J Invest Dermatol 2004 123:177–183,
- Shinozaki, M, Fujimoto, A, Morton, DL, Hoon, DS: Incidence of BRAF oncogene mutation and clinical relevance for primary cutaneous melanomas. Clin Cancer Res 2004 10:1753–1757,
- Uribe, P, Wistuba, II, Gonzalez, S: BRAF mutation: A frequent event in benign, atypical, and malignant melanocytic lesions of the skin. Am J Dermatopathol 2003 25:365–370,
- Yazdi, AS, Palmedo, G, Flaig, MJ, et al: Mutations of the BRAF gene in benign and malignant melanocytic lesions. J Invest Dermatol 2003 121:1160–1162,
Acknowledgments
We acknowledge financial support of The Shaw Melanoma Trust and The Leverhulme Trust.



