Basal cell carcinoma (BCC) is the most common skin cancer in humans. The incidence of BCC increases with exposure to ultraviolet (UV) light, and BCC favors sun-exposed sites of the body (Kricker et al, 1994,1995). Both of these facts indicate that UV light is the causal agent of BCC. Although BCC generally shows a relatively benign course, growing slowly and expanding only locally, some cases are aggressive and can rapidly infiltrate deeper structures and sometimes give rise to metastatic spreads (Miller, 1991).
It has been demonstrated that the invivo expression of interleukin-6 (IL-6) accompanies vascularization in reproductive system, during wound healing, in psoriasis (in which tortuous capillary in dermal papilla is a characteristic finding), and during tumor growth (Hirano et al, 1990;Motro et al, 1990;Elder et al, 1992;Mateo et al, 1994). These data suggest that IL-6 may induce angiogenesis.
Tumor growth and metastasis depend upon the ability to induce its own blood supply (Folkman and Shing, 1992). A number of studies have reported an association between intratumor microvessel density and tumor aggressiveness (Weidner, 1995). The tumor vasculization was also found to correlate with the aggressive (malignant) phenotype in human BCC (Staibano et al, 1996).
UV irradiation is considered to be a major etiological factor for pathogenesis of BCC (Kricker et al, 1994,1995). Interestingly, UV irradiation can trigger the release of IL-6 and tumor necrosis factor
(TNF-
from human epidermal keratinocytes;Avalos-Diaz et al, 1999). Our previous study revealed that increased tumorigenicity and vascularity in nude mice transplanted IL-6 overexpressing BCC cells. In addition, vascular endothelial growth factor (VEGF) and cyclooxygenase 2 (COX-2) have been found to be expressed in IL-6 overexpressing BCC cells (Jee et al, 2001). A recent study has shown that basic fibroblast growth factor 2 (bFGF) was overexpressed in epithelial neoplasm of skin (Arbiser et al, 2000), suggesting that bFGF may have a role in neoplastic alteration of skin. This study is thus aimed to investigate whether bFGF would be regulated by IL-6 and the possible role of bFGF in IL-6 induced angiogenesis in BCC cells. We found that IL-6 indeed upregulated bFGF mRNA and promoted the secretion of bFGF protein in BCC cells. In addition, IL-6-mediated angiogenic activity was strongly attenuated by treatment with anti-bFGF antibody.
Results
IL-6 enhances angiogenesis in invivo models
We previously demonstrated that BCC/IL-6 cells were more tumorigenic and induced more vascularization in nude mice (Jee et al, 2001). To clarify whether IL-6 could induce the angiogenic activity in BCC cells, we collected conditioned medium (CM) from cells and then performed chorioallantoic membrane (CAM) and Matrigel plug assay. CM from IL-6 overexpressing BCC cells (BCC/IL-6 or BCC/IL-6/8D cells) produced profound neo-capillaries 3 days after loading onto CAM as compared with that from parental BCC cells or BCC/neo cells (Figure 1). Matrigel plug assay showed that CM from IL-6 overexpressing cells displayed more vascularization in plugs on the seventh day after inoculation (data not shown). The degree of vascularization was quantitatively measured based on the hemoglobin contents (Figure 4b). These biological assays confirmed that IL-6 may increase angiogenic activity in human BCC cells.
Figure 1.
Increase in angiogenic activity in basal cell carcinoma (BCC) cells overexpressing interleukin-6 (IL-6). The condition media collected from parental BCC cells (BCC), control vector transfectant (BCC/Neo), pooled IL-6 transfectant (BCC/IL-6) and IL-6 transfectant with highest IL-6 expression (BCC/IL-6/8D) for chorioallantoic membrane (CAM) assay on Leghorn chicken eggs for 3 d. This represents one of three experiments.
Full figure and legend (83K)Figure 4.
Blockage of basic fibroblast growth factor 2 (bFGF) function or cyclooxygenase 2 (COX)-2 inhibited angiogenesis induced by interleukin-6 (IL-6). (A) 1
g anti-bFGF or anti-vascular endothelial growth factor (VEGF) antibody was pre-incubated with 150
L condition medium (CM) of BCC/IL-6/8D for 30 min. before incubation with human umbilical vein endothelial cells (HUVEC) cells. CM collected from BCC/IL-6/8D cells transfected with vector containing COX-2 siRNA was incubated with HUVEC cells. (The number of tube-like structures was expressed as mean
SD of randomly counting five 9.7 mm2 microscopic fields. n=3) (B) CM neutralized with anti-bFGF antibody was served for Matrigel blood plug assay in C57BL6j mice (five per group). The blood plugs were extracted and quantization of hemoglobulin was performed using the Drabkin method. The mean amount of hemoglobulin was calculated. Student's t test was used for comparison. NS: non-significant.
Upregulation of bFGF by IL-6 in BCC cells
To dissect whether bFGF or other possible angiogenic factor(s) may be regulated by IL-6, we used RT-PCR to examine the expression level of various angiogenic factors (bFGF, platelet-derived growth factor (PDGF), and IL-8) that have previously been reported to be important in activating angiogenesis. Only bFGF mRNA was elevated in IL-6 overexpressing BCC cells (Figure 2a). Correlating with the mRNA level, IL-6 overexpressing cells secreted a significant amount of bFGF protein (Figure 2b). We further confirm exogenous IL-6 treatment enhanced bFGF expression in the parental BCC cells. RT-PCR analysis showed a time-dependent increase in bFGF mRNA in BCC cells after treatment with IL-6 (Figure 3a). ELISA analysis revealed that IL-6 stimulation gradually increased the level of secreted bFGF at 4–24 h and peaked (3.3-fold) at 48 h in BCC cells (Figure 3b). Secreted VEGF was, however, upregulated to 1.36-fold only. Supportively, Western blot analysis of cell lysates from IL-6-treated BCC cells revealed that either high molecular weight (HMW) or low molecular weight (LMW) bFGF was significantly elevated at 4–16 h after IL-6 treatment (Figure 3c).
Figure 2.
Upregulation of basic fibroblast growth factor 2 (bFGF) in basal cell carcinoma (BCC) cells over-expressing interleukin-6 (IL-6). (A) After serum starvation, the mRNA of various cell lines as indicated were extracted and semiquantified by RT-PCR of bFGF, platelet-derived growth factor (PDGF), and IL-8. The number below each lane indicates the relative densitometric intensity to control (defined as 1.0). This represents one of three experiments. (B). Cell-free culture supernatant was analyzed for bFGF by ELISA. Concentration of bFGF was expressed as mean
SD of five experiments. Student's t test was used for comparison.
Figure 3.
Time dependent upregulation of mRNA, protein and secretion of basic fibroblast growth factor 2 (bFGF) in basal cell carcinoma (BCC) cells stimulated with interleukin-6 (IL-6). (A) After serum starvation, the parental BCC cells were incubated in the presence of 100 ng per mL human recombinant interleukin-6 (rIL-6) for different times as indicated. The mRNA extracted was semiquantified by RT-PCR for bFGF and vascular endothelial growth factor (VEGF). (B) The protein extracted from cell lysates were quantified by Western blotting for bFGF. The number below each lane indicates the relative densitometric intensity to control (defined as 1.0). This represents one of three experiments. High molecular weight (HMW: 24, 22.5 kDa) and low molecular weight (LMW: 18 kDa) bFGF are shown in upper, mid-, and lower row, respectively. (C) The secretion of bFGF in the culture supernatant was measured by ELISA. Concentration of bFGF was expressed as mean
SD of five experiments. Student's t test was used for comparing the paired cultured cells with and without stimulation with IL-6 at various time as indicated.
Neutralization of bFGF in CM and transfection of COX-2-specific siRNA into IL-6 over-expressing BCC cells inhibits IL-6-induced angiogenic activities
Our previous study shows that IL-6 induces VEGF and COX-2 in BCC cells (Jee et al, 2001). To clarify the biological function of bFGF, VEGF, and COX-2 in IL-6-mediated angiogenesis, we used anti-bFGF and anti-VEGF neutralizing antibody and transfection of COX-2 siRNA, respectively, to block their function and examined the angiogenic activity by using human umbilical vein endothelial cells (HUVEC) capillary tube formation on Matrigel. Exposure of HUVEC to CM from BCC/IL-6 or BCC/IL-6/8D resulted in tube formation that was significantly inhibited by neutralizing with anti-bFGF but not anti-VEGF antibody (83.1% and 14.9% inhibition, respectively). (Figure 4a, left). The protein lysate from BCC/IL-6/8D cells transfected with COX-2-specific siRNA was collected for western blotting to ensure the abrogation of 50% of Cox-2 (data not shown). The CM collected from COX-2-specific siRNA transfectant caused 62% inhibition of capillary tube formation compared with that of BCC/IL-6/8D cells. (Figure 4a, right). The results suggest that bFGF and COX-2 are possibly the main downstream effectors induced by IL-6 in the angiogenesis of BCC.
Direct treatment of HUVEC with IL-6 cytokine did not induce tube formation significantly (data not shown). In addition, anti-IL-6 antibody also failed to affect the tube formation induced by CM from IL-6 overexpressing cells (data not shown), suggesting that tube-forming activity of CM from IL-6 overexpressing cells was not directly caused by IL-6.
Using Drabkin method for quantitation of the total hemoglobulin in Matrigel gel plug assay, we showed that treatment with anti-bFGF antibodies caused 85% inhibition on the total amount of hemoglobin (Figure 4b). This confirmed that bFGF contributed to the IL-6-induced angiogenic activity in BCC cells.
JAK/STAT3 and PI3-Kinase/Akt signal pathways are involved in IL-6 induced upregulation of bFGF
Three major signaling pathways including the JAK/STAT3 pathway, PI3-Kinase/Akt pathway, and mitogen-activated protein kinase (MAPK) pathway (Heinrich et al, 2003) have been reported to be involved in the IL-6-mediated cellular functions. Initially, pharmacological inhibitors such as AG490 (a JAK inhibitor, 50
M), LY294002 (a PI3-Kinase inhibitor, 25
M), or PD98059 (a MEK inhibitor, 50
M) were used to examine which pathways were involved in IL-6-mediated bFGF upregulation in BCC cells. The optimal doses used to specifically inhibit the signaling pathways by these inhibitors were described in our previous study (Jee et al, 2002). RT-PCR analysis revealed that IL-6-mediated increase of bFGF mRNA was significantly attenuated by AG490 and LY294002 but not by PD98059 (Figure 5a). Both AG490 and LY294002 effectively reduced the amount of secreted bFGF protein in BCC cells stimulated by IL-6, as determined by ELISA (Figure 5b). These data suggest that PI3K/Akt and JAK/STAT3 are coordinately involved in IL-6-mediated bFGF gene expression in BCC cells. Consistently, transfection with dominant-negative STAT3 mutants (STAT3F and STAT3D) and Akt mutant (dnAkt) into BCC cells caused a strong inhibition on IL-6-stimulated bFGF mRNA and protein level. (data not shown).
Figure 5.
AG490 (JAK inhibitor) and LY294002 (PI3-Kinase inhibitor) reduced interleukin-6 (IL-6) upregulated expression and secretion of basic fibroblast growth factor 2 (bFGF) in basal cell carcinoma (BCC) cells. After pre-treating with human recombinant interleukin-6 (rIL-6) (100 ng per mL) for 15 min, BCC cells were serum starved for 72 h and treated with AG490 or LY294002 or PD98059 (MEK inhibitor) for 8 more hours. (A) The mRNA of BCC cells with various treatment were semiquantified by RT-PCR for bFGF. The number below each lane indicated the relative intensity of bFGF mRNA to controls (defined as 1.0). This is one representative experiments of three. (B) The culture supernatants were subjected to ELISA with bFGF antibody. The concentration of bFGF was expressed as mean
SD of five experiments. Student's t test was used for comparison. NS: non-significant.
Together, our study revealed that IL-6 induced angiogenesis in BCC by upregulation of secreted bFGF via both JAK/STAT3 and PI3-Kinase/Akt pathways and by COX-2.
Discussion
IL-6 has been implicated in the pathogenesis of multiple myeloma and some other malignancies, including renal cell carcinoma, prostate cancer, and Kaposi's sarcoma (Akira and Kishimoto, 1992;Aoyagi et al, 1996;Adler et al, 1999;Aoki et al, 1999;Kinoshita et al, 1999). Our previous study has demonstrated that transplantation of IL-6 overexpressing BCC cells into nude mice resulted in the enhancement of tumor growth accompanied by high vascularization (Jee et al, 2001). Here we provide evidence to show that exogenous IL-6 stimulation can upregulate the bFGF mRNA expression and protein secretion in BCC cells whereas IL-8 and PDGF are not affected by IL-6. Blockage of bFGF function by neutralizing antibody strongly prevented IL-6-mediated angiogenic activities as seen in HUVEC tube formation, and Matrigel plug assay. Our data revealed that bFGF is a downstream effector of IL-6-induced angiogenesis in BCC cell line cells under in vitro condition.
bFGF is a multifunctional protein with well-studied mitogenic and angiogenic properties (Basilico and Moscatelli, 1992). It is a protein devoid of secretory signal sequence. At variance with VEGF, bFGF is released via an alternative ATP-dependent secretion pathway independent of the endoplasmic reticulum–Golgi complex (Florkiewicz et al, 1998). During the development of fibrosarcoma in a transgenic mouse model, the appearance of an angiogenic phenotype is correlated with the export of bFGF (Kandel et al, 1991). A secreted FGF binding protein that mobilizes stored extracellular bFGF can serve as an angiogenic switch for different cell lines including squamous cell carcinoma (SCC) and colon cancer cells (Czubayko et al, 1996). Interestingly, bFGF has been shown to affect early tumor angiogenesis but without any effect in established tumors (Giavazzi et al, 2001). Our study reveals that the secreted bFGF was responsible for IL-6-induced angiogenesis; however, whether the elevation of bFGF contributes to IL-6-induced tumor growth in BCC is unknown and needs to be clarified. The paracrine tumor–stromal cell interaction of VEGF and IL-6 in multiple myeloma has been reported (Dankbar et al, 2000). This study indicates the crucial role of bFGF in IL-6-induced angiogenesis in BCC cells.
bFGF has been detected in normal skin, benign epidermal proliferation, and malignant neoplasm of skin (Yaguchi et al, 1993;Arbiser et al, 2000). Sun exposure is the essential causal factor of BCC. A single exposure to UVB irradiation can induce erythema, epidermal hyperplasia, and increased cutaneous vasculization. IL-6 is one of the pro-inflammatory cytokines induced by UV irradiation in keratinocytes (Schwarz and Luger, 1989;Chung et al, 1996). UVB induced cutaneous angiogenesis in C3H/HeN mice via upregulation of bFGF, but not VEGF, on day 1 of UVB irradiation (Bielenberg et al, 1998). Concordantly, our data demonstrated that bFGF was markedly upregulated by IL-6 in BCC cells.
Accumulating evidence is defining a critical role for STAT3 in oncogenesis (Bowman et al, 2000;Catlett et al, 1999a,b). Constitutive activation of STAT3 signaling contributes to oncogenesis by preventing apoptosis and enhancing cell proliferation (Grandis et al, 1998,2000;Catlett et al, 1999a, b;Bowman et al, 2000). Similarly, PI3-Kinase/Akt pathway has been reported to play a major role in agonist-induced cell survival and growth (del Peso et al, 1997;Blume-Jensen, 1998;Vanhaesebroeck and Alessi et al, 2000). We previously demonstrated the anti-apoptotic activity of both STAT3 and PI3-Kinase/Akt in BCC cells or BCC cells stimulated with IL-6. We reported previously that cervical tumor growth promotion by IL-6 in VEGF-dependent angiogenesis via a STAT3 pathway (Wei et al, 2003). In this study bFGF was upregulated via JAK/STAT3 and PI 3-Kinase/Akt pathways in BCC cells stimulated with IL-6. It has been shown that 5(S)-hydroxyeicosatetraenoic acid stimulates autocrine growth of HUVEC via activation of JAK/STAT and PI3-Kinase/Akt signal leading to activation of bFGF (Zeng et al, 2002). Our study demonstrated that IL-6 stimulates secretion of bFGF via similar pathways to act on HUVEC cells in a paracrine mode. These data suggest that activation of JAK/STAT/bFGF and PI3-Kinase/Akt/bFGF pathways in either tumor cells (paracrine mode) or endothelial cells (autocrine mode) leads to angiogenesis.
Finally, our study revealed that IL-6 induced angiogenesis in BCC by upregulation of secreted bFGF via both JAK/STAT3 and PI3-Kinase/Akt pathways. This finding suggests prevention of IL-6 production (e.g., avoid exposure to UV light or usage of anti-inflammatory drugs), inhibition of bFGF production or secretion, or blockage of the JAK/STAT3 and PI3-Kinase/Akt signal pathways may be the feasible management for prevention or treatment of skin cancer. In addition, our data also showed that blockage of Cox-2 by siRNA reduced angiogenic activity in IL-6 overexpressing BCC cells, suggesting that Cox-2 also play a role in IL-6-induced angiogenesis.
Materials and Methods
All the described study was approved by the medical ethical committee of National Taiwan University College of Medicine and was conducted according to Declaration of Helsinski Principle.
Cell origin, cell culture, and establishment of IL-6 transfectants
The human BCC cell line (parental BCC cells), originally named BCC-KMC-1, was originated from an undifferentiated BCC derived from a trauma scar. Using keratinocytes cultured in serum-free medium as positive control, we performed RT-PCR to measure the expression of K14 mRNA in BCC cells. The basaloid keratinocytes nature of this BCC cell line is verified by the presence of keratin 14 mRNA by RT-PCR method in these BCC cells, but not in Hela cells.
The 105–108th passages of this cell line were used in this study. The pCMV-IL-6, a constitutive expression vector, carries 0.64 kb full-length human IL-6 cDNA under the control of the CMV promoter/enhancer sequence and with a neomycin selection marker. The BCC cells were transfected with pCMV-IL-6 or control pcDNA3 vector (GIBCO Invitrogen, Grand Island, New York), containing a CMV promotor and a neomycin selection marker, using the TransFast transfection reagent (Promega, Madison, Wisconsin). After 24 h, cells were replated in RPMI 1640 medium (GibcoBRL, Rockville, Maryland) with 10% fetal calf serum (FCS) and 500 ng per mL G418 (Sigma, St Louis, Missouri). G418-resistant clones were selected and expanded. For this study, we used the pooled transfectants (BCC/IL-6) and the highest expression transfectant (BCC/IL-6/8D), with IL-6 secretion of about 832 and 1427 pg per mL, respectively. The parental BCC cells and BCC cells transfected with control vector, BCC/Neo cells, served as controls. All these cells were grown at 37°C and 5% CO2 in RPMI 1640 medium supplemented with 10% (vol/vol) fetal bovine serum (FBS).
Antibodies and reagents
Affinity-purified monoclonal mouse anti-bFGF antibody was purchased from BD Bioscience (San Diego, California). Anti-
-tubulin antibody was from NeoMarkers (Fremont, California). Neutralizing antibodies (mouse monoclonal anti-IL-6 antibodies and goat polyclonal anti-bFGF antibody) were from R&D Systems (Minneapolis, Minnesota). AG490 (JAK inhibitor), LY294002 (LY, PI3-Kinase inhibitor), and PD98059 (MEK inhibitor) were from Calbiochem (San Diego, California).
Preparation of CM
Parental BCC, BCC/Neo, BCC/IL-6, or BCC/IL-6/8D cells were plated in 1 mL culture medium without serum at 2
105 cells per well in 24-well 18 mm culture dishes. The culture supernatants were collected 24 h later and centrifuged sequentially at 12,500g with Microcon YM-3 centrifugal filter devices (cutoff molecules smaller than 3000 Da; Millipore, Bedford, Massachusetts) for 10 min to obtain a 10-fold concentrate culture supernatant.
CAM assay
Nine-day-old fertilized White Leghorn chicken eggs were incubated at 37°C at constant humidity. On incubation day 3, a square window was opened on the shell and sealed with a glass. On day 11, 1 mm3 filter papers loaded with 30
L CM were implanted on top of the CAM. Capillary tube formations were examined 3 days later, when the angiogenic response peaked. The blood vessels entering the paper were recognized macroscopically and photographed.
In vivo Matrigel blood plug assay
Matrigel blood plug assay was performed as described previously (Plunkett and Hailey, 1990;O'Reilly et al, 1997). Briefly, C57BL6j mice (five per group) were each injected subcutaneously with 50
L of CM from various cell lines mixed with 450
L Matrigel L (growth factor reduced; Becton Dickinson Labware, Bedford, Massachusetts) and 40 U heparin per mL at 4oC. Mice were sacrificed 6 d later, and gels were recovered and processed for further studies. Neovessels was quantified by Drabkin method, measuring hemoglobin of the plug with Drabkin reagent kit 525 (Sigma). Experiment was authorized by animal experiment committee of National Taiwan University College of Medicine.
Cox-2-specific RNA interference
Target sequence for the COX-2 siRNA was bases 291–313 of NM000963.1 (5' aactgctcaacaccggaattttt3'). PRNA-U6/neo (GenScript, Piscataway, New Jersey) is a siRNA expression vector with neomycin as selection marker. We construct pRNA-U6/COX-2, a constitutively expressed vector that carries the COX-2 siRNA sequence under the control of U6 promotor. The BCC/IL-6/8D cells were transiently transfected with pRNA-U6/COX-2 overnight. The CM was collected for capillary tube formation assay.
In vitro capillary tube formation on Matrigel
Human umbilical vein was collected with consent form. HUVEC capillary tube formation was evaluated as follows. 24-well 18 mm tissue culture dishes were coated with Matrigel basement membrane matrix (300
L per well; Becton Dickinson Labware) at 4°C and allowed to polymerize at 37°C for at least 30 min. HUVEC (2
105 cells per well) were grown in a final volume of 0.30 mL culture medium containing 150
L M199 (GibcoBRL) and 150
L CM. After 6 h incubation, tube formation was observed through a reverted, phase-contrast photomicroscope photographed and counted. The number of tube formations was measured by counting the number of tube like structures formed by connected endothelial cells in five randomly selected 9.7 mm2 microscopic fields. The assay was performed in triplicate.
Construction of dominant-negative DNA and transient transfection
For assay of JAK/STAT3 signal pathway, we constructed hemagglutinin (HA) epitope-tagged dominant-negative STAT3 mutants. An HA epitope tag was inserted into STAT3F (Nakajima et al, 1996) cDNA or STAT3D (Horvath et al, 1995) cDNA and cloned into a pcDNA3 vector (GIBCO Invitrogen). BCC cells were plated 12 h before transfection at a density of 1
105 cells per 6 cm Petri dish, followed by transfection with 1
g of STAT3F plasmid or STAT3D plasmid using the Transfast Transfection Reagent (Promega) as per manufacturer's instructions. The amount of HA was concomitantly measured to confirm the transfection efficiency. Dominant-negative mutant of Akt was similarly constructed and transfected as described above.
RT-PCR
Messenger RNAs from BCC cells treated with IL-6 were isolated using commercial kits (Promega). The total RNA was subjected to first-strand synthesis using Random Hexamer (Promega) and M-MLV Reverse Transcriptase (RNase H Minus) (Promega) at 37°C for 3 h. The cDNA was then diluted to a final volume of 50
L and quantified. PCR reactions contained 5
g cDNA, 0.5 U per
L Taq polymerase (Protech Technology, Taiwan), and 25 pmol each of the sense and the anti-sense primers in PCR buffer (10 mM Tris pH 9, 50 mM KCl, 6 mM MgCl2, 0.01% gelatin, and 0.1% Triton X-100). The reaction mixture was incubated for 5 min at 94°C and then amplified by 25 PCR cycles (denaturation for 1 min at 94°C, annealing for 1 min at 56°C, and extension for 1 min at 72°C). Each PCR product was then analyzed on a 2% agarose gel stained with 1
g per mL ethidium bromide and photographed (Digital Science SP700 camera; Kodak Scientific Imaging Systems, New Haven, Connecticut). Intensity of bands on the photographs was quantified by scanning laser densitometry.
Enzyme immunoassay (ELISA)
The bFGF and VEGF levels of the cell culture supernatant were determined by using commercially available ELISA kits (R&D Systems) according to the manufacturer's instructions. Each measurement was repeated in triplicate, and the average value was recorded as pg per mL.
Western blot analysis
The cellular lysates were prepared as described previously (Kuo et al, 1998). Lysate samples (50
g from each lysate) were subjected to electrophoresis on 15% SDS-polyacrylamide gels and were electroblotted on nitrocellulose papers. After blocking, blots were incubated with horseradish peroxidase-conjugated mouse anti-bFGF antibody (BD PharMingen, San Diego, California) in PBST (phosphate-buffered saline containing Triton X-100) for 1 h followed by three washes (15 min each) in PBST. After washing, blots were incubated with the Western blotting reagent ECL (Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, England) for 1 min. Chemiluminescence was detected by exposure of Kodak-BioMax films to the blots for 10 s and 5 min for HMW and LMW bFGF, respectively. Intensity of bands on autoradiograms were quantified by scanning laser densitometry.
References
- Adler, HL, McCurdy, MA, Kattan, MW, Timme, TL, Scardino, PT, Thompson, TC: Elevated levels of circulating interleukin-6 and transforming growth factor-beta1 in patients with metastatic prostatic carcinoma. J Urol 1999 16:182–187, 10.1097/00005392-199901000-00051
- Akira, S, Kishimoto, T: The evidence for interleukin-6 as an autocrine growth factor in malignancy. Sem Cancer Biol 1992 3:17–26, | ChemPort |
- Aoki, Y, Jaffe, ES, Chang, Y, Jones, K, Teruya-Feldstein, J, Moore, PS, Tosato, G: Angiogenesis and hematopoiesis induced by Kaposi's sarcoma-associated herpesvirus-encoded interleukin-6. Blood 1999 93:4034–4043, | PubMed | ISI | ChemPort |
- Aoyagi, T, Takishima, K, Hayakawa, M, Nakamura, H: Gene expression of TGF-alpha, EGF and IL-6 in cultured renal tubular cells and renal cell carcinoma. Internat J Urol 1996 3:392–396, | ChemPort |
- Arbiser, JL, Byer, HR, Cohen, C, Arbeit, J: Altered basic fibroblast growth factor expression in common epidermal neoplasms: Examination with insitu hybridization and immunohistochemistry. J Am Acad Dermatol 2000 42:973–977, 10.1016/S0190-9622(00)90288-3 | Article | PubMed | ISI | ChemPort |
- Avalos-Diaz, E, Alvarado-Flores, E, Herrera-Esparza, R: UV-A irradiation induces transcription of IL-6 and TNF alpha genes in human keratinocytes and dermal fibroblasts. Revue du Rhumatisme (English Edition) 1999 66:13–9, | ChemPort |
- Basilico, C, Moscatelli, D: The FGF family of growth factors and oncogenes. Adv Cancer Res 1992 59:115–165, | PubMed | ISI | ChemPort |
- Bielenberg, DR, Bucana, CD, Sanchez, R, Donawho, CK, Kripke, ML, Fidler, IJ: Molecular regulation of UVB-induced cutaneous angiogenesis. J Invest Dermatol 1998 111:864–872, | Article | PubMed | ISI | ChemPort |
- Blume-Jensen, P, Janknecht, R, Hunter, T: The kit receptor promotes cell survival via activation of PI 3-kinase and subsequent Akt-mediated phosphorylation of Bad on Ser136. Curr Biol 1998 8:779–782, | Article | PubMed | ISI | ChemPort |
- Bowman, T, Garcia, R, Turkson, J, Jove, R: STATs in oncogenesis. Oncogene 2000 19:2474–2488, | Article | PubMed | ISI | ChemPort |
- Catlett-Falcone, R, Dalton, WS, Jove, R: STAT proteins as novel targets for cancer therapy. Signal transducer an activator of transcription. Curr Opin Oncol 1999a 11:490–496, | Article | PubMed | ChemPort |
- Catlett-Falcone, R, Landowski, TH, Oshiro, MM, et al: Constitutive activation of STAT3 signaling confers resistance to apoptosis in human U266 myeloma cells. Immunity 1999b 10:105–115, | Article | PubMed | ISI | ChemPort |
- Chung, JH, Youn, SH, Koh, WS, Eun, HC, Cho, KH, Park, KC, Youn, JI: Ultraviolet B irradiation-enhanced interleukin (IL)-6 production and mRNA expression are mediated by IL-1 alpha in cultured human keratinocytes. J Invest Dermatol 1996 106:715–720, | Article | PubMed | ISI | ChemPort |
- Czubayko, F, Schulte, AM, Berchem, GJ, Wellstein, A: Melanoma angiogenesis and metastasis modulated by ribozyme targeting of the secreted growth factor pleiotrophin. Proc Natl Acad Sci USA 1996 93:14753–14758, | Article | PubMed | ChemPort |
- Dankbar, B, Padro, T, Leo, R, et al: Vascular endothelial growth factor and interleukin-6 in paracrine tumor-stromal cell interactions in multiple myeloma. Blood 2000 95:2630–2636, | PubMed | ISI | ChemPort |
- Del Peso, L, Gonzalez-Garcia, M, Page, C, Herrera, R, Nunez, G: Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt. Sci 1997 278:687–689, 10.1126/science.278.5338.687 | ChemPort |
- Elder, JT, Sartor, CI, Boman, DK, Benrazavi, S, Fisher, GJ, Pittelkow, MR: Interleukin-6 in psoriasis: Expression and mitogenicity studies. Arch Dermatol Res 1992 284:324–332, 10.1007/BF00372034 | Article | PubMed | ISI | ChemPort |
- Florkiewicz, RZ, Anchin, J, Baird, A: The inhibition of fibroblast growth factor-2 export by cardenolides implies a novel function for the catalytic subunit of Na+, K+-ATPase. J Biol Chem 1998 273:544–551, 10.1074/jbc.273.1.544 | Article | PubMed | ISI | ChemPort |
- Folkman, J, Shing, Y: Angiogenesis. J Biol Chem 1992 267:10931–10934, | PubMed | ISI | ChemPort |
- Giavazzi, R, Giuliani, R, Coltrini, D, et al: Modulation of tumor angiogenesis by conditional expression of fibroblast growth factor-2 affects early but not established tumors. Cancer Res 2001 61:309–317, | PubMed | ISI | ChemPort |
- Grandis, JR, Drenning, SD, Chakraborty, A, Zhou, MY, Zeng, Q, Pitt, AS, Tweardy, DJ: Requirement of STAT3 but not Stat1 activation for epidermal growth factor receptor-mediated cell growth in vitro. J Clin Invest 1998 102:1385–1392, | PubMed | ISI | ChemPort |
- Grandis, JR, Drenning, SD, Zeng, Q, et al: Constitutive activation of STAT3 signaling abrogates apoptosis in squamous cell carcinogenesis invivo. Proc Natl Acad Sci USA 2000 97:4227–4232, 10.1073/pnas.97.8.4227 | Article | PubMed | ChemPort |
- Heinrich, PC, Behrmann, I, Haan, S, Hermanns, HM, Muller-Newen, G, Schaper, F: Principles of interleukin (IL)-6-type cytokine signalling and its regulation. [Review] Biochem J 2003 374 (Pt 1):1–20, 10.1042/BJ20030407
- Hirano, T, Akira, S, Taga, T, Kishimoto, T: Biological and clinical aspects of interleukin 6. Immunol Today 1990 11:443–449, 10.1016/0167-5699(90)90173-7 | Article | PubMed | ISI | ChemPort |
- Horvath, CM, Wen, Z, Darnell, JE Jr: A STAT protein domain that determines DNA sequence recognition suggests a novel DNA-binding domain. Genes Dev 1995 9:984–994, | PubMed | ISI | ChemPort |
- Jee, SH, Chiu, HC, Tsai, TF, Tsai, WL, Liao, YH, Chu, CY, Kuo, ML: The PI 3-kinase/Akt signal pathway is involved in IL-6-mediated Mcl-1 upregulation and anti-apoptosis activity in BCC cells. J Invest Dermatol 2002 119:1121–1127, 10.1046/j.1523-1747.2002.19503.x | Article | PubMed | ISI | ChemPort |
- Jee, SH, Shen, SC, Chiu, HC, Tsai, WL, Kuo, ML: Overexpression of interleukin-6 in human basal cell carcinoma cell lines increases anti-apoptotic activity and tumorigenic potency. Oncogene 2001 20:198–208, 10.1038/sj.onc.1204076 | Article | PubMed | ISI | ChemPort |
- Kandel, J, Bossy-Wetzel, E, Radvanyi, F, Klagsbrun, M, Folkman, J, Hanahan, D: Neovascularization is associated with a switch to the export of bFGF in the multistep development of fibrosarcoma. Cell 1991 66:1095–1104, | Article | PubMed | ISI | ChemPort |
- Kinoshita, T, Ito, H, Miki, C: Serum interleukin-6 level reflects the tumor proliferative activity in patients with colorectal carcinoma. Cancer 1999 85:2526–2531, | Article | PubMed | ISI | ChemPort |
- Kricker, A, Armstrong, BK, English, DR: Sun exposure and non-melanocytic skin cancer. Cancer Causes & Control 1994 5:367–392,
- Kricker, A, Armstrong, BK, English, DR, Heenan, PJ: Does intermittent sun exposure cause basal cell carcinoma? a case–control study in Western Australia. Internatl J Cancer 1995 60:489–494, | ChemPort |
- Kuo, ML, Shen, SC, Yang, CH, Chuang, SE, Cheng, AL, Huang, TS: Bcl-2 prevents topoisomerase II inhibitor GL331-induced apoptosis is mediated by down-regulation of poly (ADP-ribose) polymerase activity. Oncogene 1998 17:2225–2234, 10.1038/sj.onc.1202133 | Article | PubMed | ISI | ChemPort |
- Mateo, RB, Reichner, JS, Albina, JE: Interleukin-6 activity in wounds. Am J Physiol 1994 266:1840–1844,
- Miller, SJ: Biology of basal cell carcinoma (Part I). J Am Acad Dermatol 1991 24:1–13, | PubMed | ISI | ChemPort |
- Motro, B, Itin, A, Sach, L, Keshet, E: Pattern of interleukin 6 gene expression invivo suggests a role for this cytokine in angiogenesis. Proc Natl Acad Sci USA 1990 87:3092–3096, | PubMed | ChemPort |
- Nakajima, K, Yamanaka, Y, Nakae, K, et al: A central role for Stat3 in IL-6-induced regulation of growth and differentiation in MI leukemia cells. EMBO J 1996 15:3651–3658, | PubMed | ISI | ChemPort |
- O'Reilly, MS, Boehm, T, Shing, Y, et al: Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Cell 1997 88:277–285, | Article | PubMed | ChemPort |
- Plunkett, ML, Hailey, JA: An invivo quantitative angiogenesis model using tumor cells entrapped in alginate. Lab Invest 1990 62:510–517, | PubMed | ISI | ChemPort |
- Schwarz, T, Luger, TA: Effect of UV irradiation on epidermal cell cytokine production. J Photochem Photobiol 1989 4:1–13, 10.1016/1011-1344(89)80097-1 | ISI | ChemPort |
- Staibano, S, Boscaino, A, Salvatore, G, Orabona, P, Palombini, L, De Rosa, G: The prognostic significance of tumor angiogenesis in nonaggressive and aggressive basal cell carcinoma of the human skin. Hum Pathol 1996 27:695–700, 10.1016/S0046-8177(96)90400-1 | Article | PubMed | ISI | ChemPort |
- Vanhaesebroeck, B, Alessi, DR: The PI3-Kinase-PDK1 connection: More than just a road to PKB. Biochem J 2000 346 (Pt 3):561–576, 10.1042/0264-6021:3460561 | Article | PubMed | ISI | ChemPort |
- Wei, LH, Kuo, ML, Chen, CA, Chou, CH, Lai, KB, Lee, CN, Hsieh, CY: Interleukin-6 promotes cervical tumor growth by VEGF-dependent angiogenesis via a STAT3 pathway. Oncogene 2003 22:1517–1527, 10.1038/sj.onc.1206226 | Article | PubMed | ISI | ChemPort |
- Weidner, N: Intratumor microvessel density as a prognostic factor in cancer. Am. J. Pathol 1995 147:9–19, | PubMed | ISI | ChemPort |
- Yaguchi, H, Tsuboi, R, Ueki, R, Ogawa, H: Immunohistochemical localization of basic fibroblast growth factor in skin diseases. Acta Derm Venereol 1993 73:81–83, | PubMed | ISI | ChemPort |
- Zeng, ZZ, Yellaturu, CR, Neeli, I, Rao, GN: 5(S)-hydroxyeicosatetraenoic acid stimulates DNA synthesis in human microvascular endothelial cells via activation of Jak/STAT and phosphatidylinositol 3-kinase/Akt signaling, leading to induction of expression of basic fibroblast growth factor 2. J Biol Chem 2002 277:41213–41219, 10.1074/jbc.M204508200 | Article | PubMed | ISI | ChemPort |
Acknowledgments
This work was supported by grants from National Science Council, Taiwan (NSC-91-2314-B002-194, NSC-92-2314-B-002-156 and NSC-92-3112-B-002-049).



