Regular Article

Journal of Investigative Dermatology (2000) 115, 981–985; doi:10.1046/j.1523-1747.2000.00154.x

Xeroderma Pigmentosum Variant Heterozygotes Show Reduced Levels of Recovery of Replicative DNA Synthesis in the Presence of Caffeine after Ultraviolet Irradiation

Toshiki Itoh*,†, Stuart Linn*, Ryoichi Kamide‡, Hiroyuki Tokushige§, Nobutada Katori§, Yoshiaki Hosaka§ and Masaru Yamaizumi†

  1. *Department of Molecular and Cell Biology, Division of Biochemistry and Molecular Biology, University of California, Berkeley, California, U.S.A.
  2. †Department of Cell Genetics, Institute of Molecular Embryology and Genetics, Kumamoto University, Japan
  3. ‡Department of Dermatology, Jikei University School of Medicine, Japan
  4. §Department of Plastic and Reconstructive Surgery, Showa University School of Medicine, Japan

Correspondence: Dr Toshiki Itoh, Department of Molecular and Cell Biology, Division of Biochemistry and Cell Biology, University of California, Berkeley, 229 Stanley Hall, Berkeley, CA, 94720-3206. Email: toshiki@uclink4.berkeley.edu

Received 17 June 2000; Revised 15 August 2000; Accepted 22 August 2000.

Top

Abstract

Patients with xeroderma pigmentosum variant show clinical photosensitivity, skin neoplasias induced by ultraviolet light, and defective postreplication repair, but normal nucleotide excision repair. We recently reported an alternative, simple method for the diagnosis of xeroderma pigmentosum variant that measures by autoradiography three cellular markers for DNA repair after ultraviolet irradiation: unscheduled DNA synthesis, recovery of RNA synthesis, and recovery of replicative DNA synthesis. Among hereditary photosensitive disorders, including other xeroderma pigmentosum groups, Cockayne syndrome, and a newly established ultraviolet-sensitive syndrome, only xeroderma pigmentosum variant cells exhibited normal unscheduled DNA synthesis, normal recovery of RNA synthesis, but reduced recovery of replicative DNA synthesis (51 plusminus 6% the rate relative to normal controls). This reduction of recovery of replicative DNA synthesis was enhanced in the presence of a nontoxic level of caffeine to 36 plusminus 5%. In this study we assess the cellular markers in two independent families that included two photosensitive patients that were identified as xeroderma pigmentosum variant. Cells from heterozygotic parents showed normal levels of unscheduled DNA synthesis, recovery of RNA synthesis, and recovery of replicative DNA synthesis, but reduced rates of recovery of replicative DNA synthesis in the presence of 1 mM caffeine (53 plusminus 8% relative to the normal control). Furthermore, with a colony-forming assay, the cells showed normal survival by ultraviolet without caffeine, but slightly reduced survival by ultraviolet with 1 mM caffeine present. In one family, we confirmed inheritance of two heterozygous mis-sense mutations. One mutation is an Aright arrowG transition at nucleotide 1840 that generates a K535E mis-sense mutation. Another mutation is an Aright arrowC transversion at nucleotide 2003 that generates a K589 mis-sense mutation. Each of these mutations were absent in 52 unrelated Japanese individuals. These results suggest that xeroderma pigmentosum variant heterozygotes can be identified by their sensitivity to ultraviolet irradiation in the presence of nontoxic levels of caffeine.

Keywords:

DNA polymerase eta, DNA replication, mutations

Abbreviations:

XP, xeroderma pigmentosum; XPV, xeroderma pigmentosum variant; UDS, unscheduled DNA synthesis; RRS, recovery of RNA synthesis; RDS, recovery of replicative DNA synthesis; NER, nucleotide excision repair

Xeroderma pigmentosum (XP), an autosomal recessive disease characterized by photo-induced deterioration of the skin and eyes, often leads to early onset of malignant skin neoplasias (Kraemer & Slor, 1985;Cleaver & Kraemer, 1995). There are seven complementation groups, A through G (XPA–XPG), that are deficient in nucleotide excision repair (NER). A separate group, XP variant (XPV), shows normal NER but an exaggerated delay in recovery of replicative DNA synthesis (RDS) after ultraviolet (UV) irradiation (Lehmann et al. 1975,1977;Rude & Friedberg, 1977;Cleaver & Kraemer, 1995). Recently, the XPV cDNA was cloned and its product identified as DNA polymerase eta, an enzyme that specifically inserts to deoxyadenosine triphosphate residues opposite a cyclobutane thymine dimer (Masutani et al. 1999;Johnson et al. 1999).

It is difficult to diagnose patients with XPV at an early age because most XPV patients do not develop clinical manifestations and skin neoplasias until a later age. It is particularly difficult to identify heterozygous parents of XPV patients, as no unique cellular characteristics of XPV heterozygotes have been elucidated. We recently reported a simple method for the diagnosis of XPV that utilizes the measurement of three cellular markers of DNA repair by autoradiography: unscheduled DNA synthesis (UDS), recovery of RNA synthesis (RRS), and RDS after UV irradiation (Itoh et al. 1996a). The method provides a systematic basis for the diagnosis of photosensitive disorders, including XP, Cockayne syndrome, or UV-sensitive syndrome (Itoh et al. 1994,1995,1996b). In this study, we used this method to characterize cells of two XPV patients and their heterozygous parents. This application has allowed us to identify unique characteristics of the XPV heterozygotes.

Top

Materials and methods

Cells and culture conditions

The cell strains used in this study are shown in Table 1. Ops4 and Ops36 cells are primary fibroblast strains designated XPV, whereas Ops17, Ops18, and Ops39 cells are primary fibroblast strains designated heterozygotes of XPV. A pedigree of the two families giving rise to these strains is shown in Figure 1. Mori, Turu, and Sono cells are primary normal fibroblast strains established and characterized previously (Itoh et al. 1996a,2000). Fifty-two fibroblast strains, each derived from unrelated Japanese individuals, including 18 normal and 34 photosensitive patients, were used to test whether the Ops4 mutations were a polymorphism. All cells were cultured in a humidified incubator at 37°C in 5% CO2 in Dulbecco's modified Eagle's Minimum Essential Medium (ICN, Costa Mesa, CA) supplemented with 15% (vol/vol) fetal bovine serum (HyClone Laboratories, Logan, UT), 100 units penicillin G per ml, and 100 mug streptomycin per ml.

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Pedigrees of two XPV families. Filled symbols represent affected individuals, half-filled symbols are individuals heterozygotes for XP variant, and open symbols are individuals who were unavailable for analysis. Parents of Ops36 are consanguineous. Ops4, Ops36, and the youngest brother of Ops36 showed clinical photosensitivity (*). The father of Ops36 died of gastric cancer at the age of 58, and the youngest brother of Ops36 had photosensitivity and skin cancer, strongly suggesting xeroderma pigmentosum.

Full figure and legend (15K)


Measurement of UDS, RRS, and RDS after UV irradiation

UDS was measured as described (Itoh et al. 1994) with some modifications. Briefly, to minimize variations between different preparations and to facilitate comparison, 20 mul aliquots (1–2 times 104 cells) of the experimental or control (Mori) cell suspensions were plated with micropipettes in two rows on the same 18 times 18 mm coverslip (Itoh et al. 1994) and incubated for 7–10 d until they were in stationary phase. They were then washed with phosphate-buffered saline, irradiated with UV light (254 nm) at a dose rate of 1 J per m2 per s for 30 s, immediately labeled with [3H]thymidine (40 muCi per ml) for 2.5 h, and fixed. Coverslips were mounted on glass slides, dipped in Kodak NTB-3 emulsion, and exposed for 24 h or 48 h at 4°C. Grains above 20 nuclei were then counted under a microscope.

RRS (Itoh et al. 1994) and RDS (Itoh et al. 1996a) were measured as follows: 1–2 times 104 cells were plated on a coverslip as described above and incubated for 1–2 d to reach log phase. They were then washed with phosphate-buffered saline and irradiated with UV light (254 nm) at a dose rate of 1 J per m2 per s for 15 s. Cells were next incubated for 23 h for RRS or 6 h with or without 1 mM caffeine for RDS and labeled with [3H]uridine (40 muCi per ml) or [3H]thymidine (15 muCi per ml), respectively, for 1 h. Autoradiography was performed as described above.

UV survival assay

UV survival of cells was measured as described elsewhere (Itoh et al. 1994,2000). Briefly, appropriate numbers of cells were inoculated on to 60 mm dishes and left to attach for 10 h. Subsequently, cells were rinsed with phosphate-buffered saline and exposed to UV light at a fluence rate of 0.7–1.0 J per m2 per s for the times indicated. Then, after incubation for 10–21 d, the dishes were washed with phosphate-buffered saline, and the colonies fixed with 80% (vol/vol) methanol, stained with Giemsa, and counted. Three dishes were utilized for each dose.

Sequence analysis

Reverse transcription–polymerase chain reaction (reverse transcription–PCR) and DNA sequencing were performed essentially as described (Itoh et al. 1999) with PCR primers described previously (Masutani et al. 1999). Briefly, PCR was performed between forward primer S0 (GATCCCTTCTCGGTTTTCC, base pairs 57–76) and reverse primer AS25 (TCCATGCCTGTGAAGAGATG, base pairs 2531–2550), nested PCR was performed between forward primer S1 (ACTGGACCTCCTAGAAAG, base pairs 110–129) and reverse primer AS24 (ATCCTACAGGCAAGCCTGAG, base pairs 2387–2416), between forward primer S1 and reverse primer AS9 (TGCCAGGACC-TTATTGTGTGT, base pairs 885–905), and between forward primer S8 (TCCACAATAAGGTCCTGGC, base pairs 887–906) and reverse primer AS24. PCR fragments were subcloned into pGEM-T Easy Vector (Promega, Madison, WI). Sequencing was performed utilizing T7 and SP6 DNA polymerases and forward primer S1, S5 (AGCCAGTGTTGA- AGTGATGG, base pairs 519–538), S8, S13 (AGCTGGTTGTGAGCA- TTCG, base pairs 1331–1349), or S17 (CCATGAGCAATTCACCA- TCC, base pairs 1760–1779). To exclude the possibility that either or both of the Ops4 mutations are a polymorphism in the Japanese population, RNA was extracted from diploid fibroblast strains from 52 unrelated Japanese individuals as described (Itoh et al. 1999), and reverse transcription–PCR was performed using primers S0 and AS25; nested PCR was then performed using primers S17 and AS24. The PCR products were purified with the QIAquick PCR purification kit (Qiagen, Valencia, CA) and direct sequencing was performed utilizing primer S17.

Top

Results

Case reports

Ops4, an 8 y old boy and the second of three siblings (Figure 1), was first recognized to be photosensitive at the age of 2–3 y. The parents were not consanguineous. He burned easily after long periods of exposure to the sun. At present, he shows slight tanning, and a number of small pigmented freckles around the lower eyelids and on the cheeks (Table 1). Ops36, a 67 y old man and the first of four siblings (Figure 1), showed photosensitivity at an early age. He suffered from squamous cell carcinomas on his nose at the ages of 46 and 54, and these tumors were resected. Recently, he suffered from nine metastatic malignant melanomas on the body and basal cell carcinoma on the face at age 67. After resection of tumors, he underwent the following treatment regimen: peplomycin, nimustihe hydrochloride (ACNU), vincristine, and natural interferon-beta (Feron, Toray Industries, Tokyo, Japan). The parents of Ops36 were consanguineous (Figure 1b).

Application of an alternative method for the diagnosis of XPV

We applied an alternative method (Itoh et al. 1996a) for the diagnosis of XP complementation group to cells from the two photosensitive patients (Table 1). In this method fibroblast strains are plated on four coverslips in parallel with normal cells, and then RDS with or without caffeine present, UDS, and RRS are measured. XPV cells specifically exhibit normal UDS, normal RRS, but a reduction of the rate of RDS that is enhanced in the presence of 1 mM caffeine (Itoh et al. 1996a,2000); both the Ops4 and Ops36 cells showed normal UDS (Table 2), normal RRS (Table 3), but reduced RDS, which was enhanced in the presence of 1 mM caffeine (Table 4). These properties and the patients' phenotypes are consistent with a classification as XPV.




Cellular DNA repair markers in heterozygotes of XPV

When the cellular DNA repair markers of parents of the XPV patients, Ops17, Ops18, and Ops39, were examined, UDS and RRS levels were normal (Table 2 and Table 3). RDS levels of these cells were also normal, but were reduced in the presence of 1 mM caffeine (Table 4). As the aphenotypic parents of the XPV patients are presumed to be heterozygous for XPV because of the autosomal recessive inheritance of XP, these results indicate that heterozygotes of XPV show normal levels of UDS, RRS, and RDS, but reduced levels of RDS in the presence of 1 mM caffeine.

UV survival in the presence and absence of caffeine

The XPV cells Ops4 and Ops36 were abnormally sensitive to killing by UV irradiation only in the presence of 1 mM caffeine (Figure 2a, b). These results are consistent with the established characteristics of most XPV cells (Arlett et al. 1975;Lehmann et al. 1975;Cleaver & Kraemer, 1995;Itoh et al. 1996a,2000) and also confirm that Ops4 and Ops36 cells are XPV. The XPV heterozygote Ops17, Ops18, and Ops39 were similarly examined (Figure 2c–e). These cells were not sensitive to UV without caffeine, but were slightly more sensitive than normal cells in the presence of 1 mM caffeine.

Figure 2.
Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Survival to UV irradiation in the presence and absence of caffeine. The cells utilized were: (a) Ops4, (b) Ops36, (c) Ops17, (d) Ops18, and (e) Ops39. After UV irradiation, cells were incubated for 10–21 d, fixed with 80% methanol, and stained with Giemsa. Caffeine was added to a final concentration of 1 mM just after UV irradiation. Open circles and solid lines are measurements in the absence of 1 mM caffeine, and closed circles and dotted lines in the presence of 1 mM caffeine. The data of Mori are a normal control and are overwritten in each figure (no circles). Points for these lines are omitted for clarity. Each point represents an average of two or three independent experiments (one experiment is an average of two dishes for each point). The error bar indicates SEM.

Full figure and legend (28K)

Novel mutations present in the XPV (DNA polymerase eta) cDNA

By sequence analysis, Ops4 cells were determined to have compound heterozygous mutations (Table 5). An Aright arrowG transition at nucleotide 1840 generates a K535E mis-sense mutation in one allele, whereas a Aright arrowC transversion at nucleotide 2003 generates a K589T mis-sense mutation in the other allele. Ops17 cells have only the Aright arrowC transversion at nucleotide 2003 in one allele (Table 5), whereas Ops18 cells have only the Aright arrowG transition at nucleotide 1840 in one allele (Table 5). These basic Lys residues are highly conserved between human and mouse (Yamada et al. 2000). On the other hand, Glu or Thr are acidic or hydroxyl residues, respectively, and therefore these mutations would likely affect the conformation and functionality of the DNA polymerase. Furthermore, we screened for these mutations in 52 unrelated Japanese individuals (104 chromosomes) by direct sequencing and they were absent. Therefore, these changes are not a polymorphism in the Japanese population. On the basis of these results we conclude that Ops17 and Ops18 are the obligate heterozygous parents of XPV Ops4. Similar sequence analyses of Ops36 and Ops39 cells are in progress.


Top

Discussion

XPV cells showed reduced RDS levels without caffeine after UV irradiation (Itoh et al. 1996a,2000). RDS levels relative to normal in all XPV cells examined to date are 51 plusminus 6% without caffeine and 36 plusminus 5% with caffeine (Itoh et al. 1996a,2000; this study), whereas XPV heterozygotes showed reduced RDS levels in the presence of caffeine at 53 plusminus 8%. A similar intermediate effect was seen in heterozygotes of Cockayne syndrome, a rare autosomal recessive disorder defective DNA repair: cells from parents of patients with Cockayne syndrome were intermediately sensitive to UV and the degree of sensitivity was between that of normal and Cockayne syndrome cells (Lehmann, 1987).

XPV and XPV heterozygous cells appear to have normal UV sensitivity in the absence of caffeine. Ops36 (XPV) and Ops39 (XPV heterozygote) cells, however, showed impaired UV survival in the absence of caffeine. This sensitivity might be a general property of XPV and XPV heterozygous cells or it may have been caused by these particular individuals' histories. Ops36 suffered from multiple skin neoplasias (squamous cell carcinomas, basal cell carcinoma, and malignant melanomas) and underwent chemotherapy as described above. DNA damages induced by the chemotherapy regimen could have led to the reduced UV survival of cells cultured from Ops36. Ops39 was 87 y old when her skin biopsy was performed and as a consequence these cells rapidly senesce because of her age and possibly also because of an accumulation of DNA damages caused by sun exposure during her long life.

It is difficult to diagnose patients with mild photosensitivity (Itoh et al. 2000). The observation that the heterozygotes of XPV showed abnormal RDS is an important finding as many XPV patients have been reported in Japan and it is therefore necessary for diagnosis to distinguish among XPV, heterozygotes of XPV, and XPE (Itoh et al. 1999,2000) from normal cells. For example, GM01389 cells were formerly assigned to XPV, but recently reclassified as XPE byOtrin et al. (1998) and the mutations confirmed in the DDB2 gene (Nichols et al. 2000).

Although the XPV gene product has recently been identified as DNA polymerase eta (Johnson et al. 1999;Masutani et al. 1999), little is known about the relation of the mutant XPV proteins to the caffeine effect. The molecular mechanisms of inhibition of repair processes by caffeine were studied bySelby & Sancar 1990). They concluded that caffeine inhibits DNA repair by two different mechanisms: (i) interference with specific binding of the DNA repair enzymes to damaged DNA, and (ii) promotion of nonspecific binding of DNA repair enzymes to DNA. DNA polymerase eta inserts to deoxyadenosine triphosphate residues specifically opposite a cyclobutane thymine dimer (error-free bypass) (Johnson et al. 1999;Masutani et al. 1999) and as XPV homozygotes and heterozygotes might be compromised in this regard, other DNA polymerases might compensate to allow such bypass. Were caffeine to interfere with these DNA polymerases as described above, XPV homozygous and heterozygous cells might then be abnormally sensitive to caffeine. We are currently studying the effect(s) of caffeine on a number of human DNA polymerases in this regard.

Top

References

  1. Arlett, CF, Harcourt, SA, Broughton, BC: The influence of caffeine on cell survival in excision-proficient and excision-deficient xeroderma pigmentosum and normal human cell strains following ultraviolet-light irradiation. Mutat Res 1975 33: 341–346,  | Article | PubMed | ISI | ChemPort |
  2. Cleaver, JE, Kraemer, KH: Xeroderma pigmentosum and Cockayne syndrome. In: Scriver CR, Beaudet AL, Sly WS, Valle D (eds). The Metabolic and Molecular Basis of Inherited Disease. 1995 New York: McGraw-Hill, pp 4393–4419,
  3. Itoh, T, Fujiwara, Y, Ono, T, Yamaizumi, M: UVs syndrome, a new general category of photosensitive disorder with defective DNA repair, is distinct from xeroderma pigmentosum variant and rodent complementation group 1. Am J Hum Genet 1995 56: 1267–1276,  | PubMed | ISI | ChemPort |
  4. Itoh, T, Linn, S, Ono, T, Yamaizumi, M: Reinvestigation of the classification of five cell strains of xeroderma pigmentosum group E with reclassification of three of them. J Invest Dermatol 2000 114: 1022–1029, 10.1046/j.1523-1747.2000.00952.x | Article | PubMed | ISI | ChemPort |
  5. Itoh, T, Mori, T, Ohkubo, H, Yamaizumi, M: A newly identified patient with clinical xeroderma pigmentosum phenotype has a nonsense mutation in the DDB2 gene and incomplete repair in (6–4) photoproducts. J Invest Dermatol 1999 113: 251–257, 10.1046/j.1523-1747.1999.00652.x | Article | PubMed | ISI | ChemPort |
  6. Itoh, T, Ono, T, Yamaizumi, M: A new UV-sensitive syndrome not belonging to any complementation groups of xeroderma pigmentosum or Cockayne syndrome: siblings showing biochemical characteristics of Cockayne syndrome without typical manifestations. Mutat Res 1994 314: 233–248,  | PubMed | ISI | ChemPort |
  7. Itoh, T, Ono, T, Yamaizumi, M: A simple method for diagnosing xeroderma pigmentosum variant. J Invest Dermatol 1996a 107: 349–353,  | Article | PubMed | ISI | ChemPort |
  8. Itoh, T, Yamaizumi, M, Ichihashi, M, Hiro-oka, M, Matsui, T, Matsuno, M, Ono, T: Clinical characteristics of three patients with UVs syndrome, a photosensitive disorder with defective DNA repair. Br J Dermatol 1996b 134: 1147–1150,  | Article | PubMed | ISI | ChemPort |
  9. Johnson, RE, Kondratick, CM, Prakash, S, Prakash, L: hRAD30 mutations in the variant form of xeroderma pigmentosum. Science 1999 285: 263–265, 10.1126/science.285.5425.263 | Article | PubMed | ISI | ChemPort |
  10. Kraemer, KH, Slor, H: Xeroderma pigmentosum. Clin Dermatol 1985 3: 33–69,  | Article | PubMed | ChemPort |
  11. Lehmann, AR: Cockayne's syndrome and tricho-thiodystrophy: defective repair without cancer. Cancer Rev 1987 7: 82–103,
  12. Lehmann, AR, Kirk-Bell, S, Arlett, CF, Harcourt, SA, de Weerd-Kastelein, EA, Keijzer, W, Hall-Smith, P: Repair of ultraviolet light damage in a variety of human fibroblast cell strains. Cancer Res 1977 37: 904–910,  | PubMed | ISI | ChemPort |
  13. Lehmann, AR, Kirk-Bell, S, Arlett, CF, Paterson, MC, Lohman, PH, de Weerd-Kastelein, EA, Bootsma, D: Xeroderma pigmentosum cells with normal levels of excision repair have a defect in DNA synthesis after UV-irradiation. Proc Natl Acad Sci USA 1975 72: 219–223,  | PubMed | ChemPort |
  14. Masutani, C, Kusumoto, R, Yamada, A, et al: The, XPV, (xeroderma pigmentosum variant) gene encodes human, DNA, polymerase eta. Nature 1999 399: 700–704,  | Article | PubMed | ISI | ChemPort |
  15. Nichols, AF, Itoh, T, Graham, JA, Liu, W, Yamaizumi, M, Linn, S: Human damage-specific DNA binding protein p48: characterization of XPE mutations and regulation following UV-irradiation. J Biol Chem 2000 275: 21422–21428,  | Article | PubMed | ISI | ChemPort |
  16. Otrin, VR, Kuraoka, I, Nardo, T, et al: Relationship of xeroderma pigmentosum group E DNA repair defect to the chromatin and DNA binding proteins UV-DDB and replication protein A. Mol Cell Biol 1998 18: 3182–3190,  | PubMed | ISI | ChemPort |
  17. Rude, J, Friedberg, EC: Semiconservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts. Mutat Res 1977 42: 433–442,  | PubMed | ISI | ChemPort |
  18. Selby, CP, Sancar, A: Molecular mechanisms of DNA repair inhibition by caffeine. Proc Natl Acad Sci USA 1990 87: 3522–3525,  | PubMed | ChemPort |
  19. Yamada, A, Masutani, C, Iwai, S, Hanaoka, F: Complementation of defective translesion synthesis and UV light sensitivity in xeroderma pigmentosum variant cells by human and mouse DNA polymerase eta. Nucleic Acids Res 2000 28: 2473–2480, 10.1093/nar/28.13.2473 | Article | PubMed | ISI | ChemPort |
Top

Acknowledgments

We thank Mrs Yuka Itoh and Dr. Toshiro Kageshita (Kumamoto University of Medicine) for help with the preparation of the manuscript. We are also grateful to Dr. Francesca Zollezi, Dr. Anne Nichols and Dr. Hitomi Asahara (Berkeley) for helpful discussions. This work was supported partly by Grants-in-Aid from the Ministry of Education, Science, Sports, and Culture of Japan (11770468 to T.I.), the Kao Foundation for Arts and Sciences (to T.I.), the Nakatomi Foundation (to T.I.) and USPHS grant P30ES08196 (to S.L.).

Extra navigation

.
ADVERTISEMENT