Alterations in cell/matrix contacts influence the differentiation and activation of eucaryotic cells (Watt & Green, 1982). Inspired by this concept we have previously analyzed alterations of the gene expression profile induced in differentiated keratinocyte cultures upon dispase-mediated detachment from the growth substratum. By using immunohistochemistry and northern blotting we found upregulation of a complex array of proliferation- and migration-related molecules (Schaefer et al. 1996,2000;Grondahl-Hansen et al. 1988;McNeil & Jensen (1990;Romer et al. 1991,1994). Collectively, our findings indicated that dispase-induced detachment induces a reaction, which at first approximation resembles a process termed keratinocyte ''activation'' (Coulombe 1997;Schaefer et al. 2000). Activation is observed in keratinocytes involved in epidermal lesions in vivo and is thought to encompass phenotypic and functional changes preparing these cells for repair, i.e., for reepithelialization, of epidermal defects (Coulombe et al. 1997).
We applied subtraction cloning to identify genes upregulated upon dispase-mediated detachment (Schaefer et al. 2000). During these studies we identified a transcript that we denominated pKe#192. We established the full-length cDNA sequence of pKe#192 and found the gene to be identical with the previously described DD96/MAP17 molecule, which was identified as a membrane-associated molecule in human kidney tubules (Kocher et al. 1995,1996). Transfection studies suggested a role for DD96/MAP17 in the regulation of proliferation (Kocher et al. 1996). So far, pKe#192/MAP17 has not been described in human epidermal keratinocytes. This study was undertaken to explore pKe#192/MAP17 in human epidermal keratinocytes, and in particular its localization in the human epidermis by using novel pKe#192/MAP17-specific antibodies.
Materials and methods
Cell culture
Human keratinocytes were obtained from skin biopsies by overnight trypsinization at 4°C. Cells were cultivated using the feeder-layer technique according toRheinwald & Green (1975) for 8 d in DMEM containing 10% fetal calf serum and supplements. Confluent cultures were treated for 30 min with dispase II (2.4 mg per ml in DMEM without fetal calf serum), washed twice in DMEM, and incubated for different intervals of time (0, 2, 4, and 8 h) in complete DMEM. To avoid the influence of fresh serum, which is known to induce a variety of genes (Rosen et al. 1995), the keratinocyte cultures were fed 24 h prior to dispase treatment and the dispase-detached keratinocyte sheets were incubated in the ''old'' medium directly collected before dispase treatment.
Cloning of pKe#192
PKe#192 was identified in a subtraction cloning experiment recently described in detail (Schaefer et al. 2000). In short: RNA was extracted from keratinocytes after detachment (T0) as well as after detachment and further incubation for 4 h (T4) using an RNA-extraction kit (RNAZolB, WAK-Chemie Medical GmbH, Bad Homburg, Germany) based on the acid guanidinium thioglycolate-phenol-chloroform extraction method (Chomoczynski & Sacchi 1986). Poly(A)+RNA was prepared by using oligo(dT) chromatography (Oligotex mRNA kit, Qiagen, Hilden, Germany). Enrichment of differentially expressed genes was then achieved by using the PCR-Select cDNA Subtraction Kit (Clontech, Heidelberg, Germany). Briefly, poly(A)+RNA isolated from adherent keratinocytes was hybridized to oligo(dT) beads and reversely transcribed to generate a single-stranded cDNA-library. Subtractive hybridization was performed using an excess of poly(A)+RNA samples transcribed into cDNA, cloned into the pUEX-1 expression vector (Haymerle et al. 1986), and transformed into E. coli MC1061.
Analysis of the pKe#192 cDNA clone
Plasmid-DNA was isolated by using a plasmid isolation kit (Qiagen plasmid midi kit; Qiagen) and cycle sequenced using the (d)Rhodamin terminator cycle sequencing reaction kit (PE Biosystems, Weiterstadt, Germany). Sequence analysis were performed by using an ABI310 sequencer (PE Biosystems) and the subsequent genebank search by using the HUSAR program pack version 4.0 (Deutsches Krebsforschungszentrum, Heidelberg, Germany).
Reverse transcriptase (RT)-PCR
Total cytoplasmic RNA from cultured normal human keratinocytes was isolated before and 2, 4, 8 h after dispase treatment using an RNA-extraction kit (RNAZolB, WAK-Chemie). RNA from colon carcinoma cell-line HT29, known to express MAP17 (Kocher et al. 1996), was used as positive control. The cDNA templates were reversely transcribed from total RNA using AMV reverse transcriptase (AGS, Heidelberg, Germany). For subsequent PCR amplification the AGSGold PCR Kit (AGS) and appropriate forward and reverse primers for GAPDH or pKe#192 were used. Thirty cycles of amplification were performed (1 min at 95°C, 45 s at 58°C, 45 s at 72°C). An aliquot of the PCR product was electrophoresed in 1.5% agarose in Tris-acetate buffer. Bands were visualized by ethidium bromide staining and photographed. The specific primers were: for GAPDH, CCACCCATGGCAAATTCCATGGCA and TCTAGACGGCAGGT-CAGGTCCACC; for pKe#192, CATCGGGTGCTGCGGACC and TAGACTCCACAGCAGCTCCAGG.
Expression and purification of recombinant pKe#192
The cytoplasmic part of pKe#192 (termed ''pKe#192-C''; compare Figure 1) was subcloned into the pGEX-2T vector and expressed in E. coli by using the GST Gene Fusion System (Pharmacia Biotech, Freiburg, Germany). The fusion protein was purified by affinity chromatography using glutathione sepharose 4B. pKe#192-protein was released from the GST moiety by thrombin cleavage on the column (Smith et al. 1986).
Figure 1.
Nucleotide and amino acid sequence of pKe#192/MAP17. The part of the sequence expressed as GST-fusion protein in E. coli (''GST-pKe#192-C'') is marked in bold letters (GeneBank, accession number U21049).
Full figure and legend (70K)Generation of polyclonal pKe#192-specific antibodies
Polyclonal antibodies were prepared against the 18-mer carboxy-terminal peptide of the predicted protein sequence of pKe#192/MAP17 (NAYENVPEEE-GKVRSTPM). The peptide synthesis according to the Multiple antigenic peptide method (Posnett & Tam 1998) was kindly performed by Dr. Ackerman (Niederländisches Peptidforschungs-Institut, Hannover, Germany). Polyclonal antibodies were also generated against the GST-pKe#192-C fusion protein. Rabbits were immunized, and the antibodies were purified by affinity chromatography using the peptide or GST-pKe#192-C fusion protein bound to sepharose 4B (Pharmacia Biotech, Uppsala, Sweden).
Production and characterization of monoclonal pKe#192-specific antibodies
Monoclonal antibodies were raised in BALB/C mice against the fusion protein GST-pKe#192-C according to previously described protocols (Kohler & Milstein, 1975;Gefter et al. 1977). Antibodies were tested by ELISA and immuno-blotting using recombinant protein as well as lysates of human kidney tissues. Antibodies produced in serum-free medium were precipitated by using ammonium sulfate at 50% saturation as precipitation agent and filtered on Sephadex G-25 M PD 10 columns (Pharmacia Biotech). Isotypes of the monoclonal antibody were determined by using the Mouse Monoclonal Antibody Isotyping Kit (Immuno Type Kit, Sigma, Steinheim, Germany).
COS cell transfection
For transfection experiments the full-length cDNA clone of pke#192 was cloned in frame into the TOPO TA Cloning Site of pc DNA3.1 V5/His-TO vector (Eukaryotic TOPO TA Cloning Kit, Invitrogen, Leek, Netherlands). Two 
105 exponentially growing COS cells were incubated overnight in a six-well plate (Nunc, Roskilde, Denmark). Adherent cells were washed twice with 2 ml of phosphate-buffered saline (PBS) and incubated for 4 h in 1 ml of transfection solution (2 
g per ml DNA, 10 mg per ml DEAE-dextran, 5.6 mg per ml Chloroquine in RPMI 1640 supplemented with 2% (vol/vol) fetal calf serum). The solution was subsequently removed, and 1 ml of 10% (vol/vol) DMSO (Merck, Darmstadt, Germany) in RPMI was added and allowed to incubate for 2 min. Then cells were washed once with PBS and incubated for 36 h in 2–3 ml of culture medium. Transfected cells were washed in PBS and lyzed in 250 l of lysis buffer (Bruyns et al. 1998) or fixed with Methanol for immunohistologic stainings.
Extracts of epidermis and kidney
Human skin and kidney tissue were obtained from surgical specimens that would have been otherwise discarded. The skin biopsies were treated with heat for 1 min at 65°C to separate epidermis from dermis (Dale et al. 1985). Human kidney tissue and isolated epidermis were homogenized using 2 ml tissue grinder (Neo Lab, Heidelberg, Germany). Proteins were further solubilized by the nonionic detergent Triton-X 100 (1%, vol/vol) in Tris-buffered saline (TBS), containing protease inhibitor cocktail (complete, Boehringer Mannheim, Germany) at 4°C. Particulate material was removed by centrifugation at 10 000 g for 30 min. In case of kidney tissue pKe#192/MAP17 was detected in the soluble fraction. In epidermal tissue, the pKe#192/MAP17 remained in the pellet and was solubilized by resuspending the pellet in PBS containing protease inhibitor cocktail, 5 mM Tris/MgCl2 pH 8, and 10 l DNase 1 mg per ml. Protein concentration was determined by BCA Protein Assay Reagent (Pierce, Germany).
Immunoprecipitation and immuno-blot analysis of human kidney and epidermis
All steps of immunoprecipitation were performed at 4°C and incubation by end-over-end rotation. After protein extraction the lysates were precleared by incubating with 1:10-diluted protein-G-sepharose (Pharmacia Biotech) for 1 h followed by centrifugation at 10 000 g for 5 min to remove protein-G-sepharose. PKe#192 was immunoprecipitated by 10 g per ml polyclonal rabbit anti-pKe#192 IgG overnight followed by incubation with a 1:1 slurry of protein-G-sepharose for 2 h. The solution was centrifuged for 10 min at 10 000 g and the supernatant discharged, the pellet was washed three times in lysis buffer. The immunoprecipitate was resuspended in Laemmli sample buffer, denaturated for 3 min at 95°C, and subjected to SDS-PAGE followed by immuno-blot analysis.
Immuno-blot analysis
Extracted proteins and immunoprecipitates were subjected to SDS-PAGE (15% acrylamide under reducing conditions). The gels were either stained with Coomassie brilliant blue R250 or further processed for immuno-blotting. For the latter the separated proteins were electroblotted onto Hybond-C extra membranes (Amersham, Freiburg, Germany) for 1 h at 50 V and blocked with TBS containing 0.25% (vol/vol) Tween-20 and 5% (wt/vol) dry milk. Antibody incubation was performed with primary antibody at a concentration of 10 g per ml in TBS containing 0.25% (vol/vol) Tween-20 overnight at 4°C. After washings in 0.05% (vol/vol) Tween 20 TBS (2 10 min) and TBS (1 10 min) the sheets were incubated for 2 h at room temperature with peroxidase-conjugated goat antimouse IgG (Fc Fragment specific, Dianova, Hamburg, Germany) or mouse antirabbit IgG (H + L) (Dianova) diluted 1:5000 in 0.05% Tween 20 TBS. After a washing sequence as above, the blots were incubated in ECL western blotting reagents (Amersham) and exposed to X-ray film.
Immunocytochemistry
Immunohistologic studies were performed on frozen sections obtained from normal human skin, lesional skin of bullous pemphigoid and pemphigus vulgaris as well as kidney. Tissue samples were snap frozen and embedded in Tissue-tek medium at -80°C. Tissues were cut at -20°C into 4 m-thick cryo-sections, air-dried, fixed in acetone for 10 min, air-dried again, and blocked with Avidin blocking kit (Vector Laboratories, Burlingame) for 15 min. The following primary antibodies were used at a concentration of 10 g per ml diluted in PBS containing 0.2% BSA: mouse anti-pKe#192-C, rabbit-anti-pKe#192-peptide, rabbit-anti-pKe#192-C, and rabbit-anti-involucrin diluted 1:20 (Harbor Bio-Products, Norwood). Sections were washed three times with PBS containing BSA 0.2% for 10 min and incubated with biotin-labeled rabbit antimouse IgG (Dianova) or mouse antirabbit antibodies (Dianova) for 30 min at room temperature. The biotin-labeled antibodies were detected by using Cy3-labeled streptavidin (Dianova). As negative controls normal rabbit IgG and an isotype-matched murine monoclonal antibody were used. After staining, the sections were analyzed using a laser scan microscope (Leica TCS NT, Heidelberg, Germany) working with two lasers at wavelengths of 516 nm (Cy3) and 651 nm (Cy5), respectively. For double-immunofluorescence Cy3-labeled streptavidin in combination with biotin-labeled goat antirabbit IgG (dilution 1:500) (Dianova) and Cy-5-labeled goat antimouse (Dianova) were used for staining.
Results
Isolation of pKe#192-specific cDNA and sequence comparison
PKe#192 was isolated from a subtractive cDNA library preferentially representing transcripts induced by activation via detachment of cultured keratinocytes (Schaefer et al. 2000). One clone, termed ''pKe#192'' was 807 bp long and contained a 411-bp open reading frame Figure 1. A GeneBank search revealed identity to MAP17, a gene previously isolated from human kidney tissue. Hydrophobicity analysis of the predicted protein sequence revealed a hydrophilic carboxy terminus containing two potential phosphorylation sites, a transmembrane domain, and a markedly hydrophobic amino terminus, with a possible signal peptide (Kocher et al. 1996).
Upregulation of pKe#192/MAP17 in detached keratino-cytes
We analyzed the expression of pKe#192/MAP17 in cultured keratinocytes before (T0), 2 h after (T2), and 8 h after (T8) dispase-induced detachment. Total RNA was isolated from keratinocytes at the respective time points and analyzed by specific RT-PCR as described in Materials and Methods. As a reference a GAPDH-specific RT-PCR was performed. The pKe#192/MAP17 specific RT-PCR yielded a strong specific band in RNA isolated 2 h (T2) and 8 h (T8) after detachment, but not in RNA isolated directly after detachment (T0). On the other hand, a GAPDH-specific signal was obtained in RNA from all time points Figure 2. Total RNA of the colon carcinoma cell-line HT29, known to express MAP17, served as positive control (Kocher et al. 1996).
Figure 2.
Detection of pKe#192/MAP17- and GAPDH-specific mRNA in cultured keratinocytes by RT-PCR. RNA was isolated from cultured human keratinocytes before (T0) and 2 h (T2) or 8 h (T8) after dispase-mediated detachment. The RNA was subjected to RT-PCR analysis by using pKe#192- or GAPDH-specific primers. As positive control mRNA of the cell line HT29 was used, which is known to express pKe#192/MAP17. As negative control the respective RT-PCR was performed without addition of RNA. A pke#192/MAP17-specific signal was obtained in RNA from keratinocytes at T2 and T8, while no specific signal was obtained at T0. The GAPDH-specific signal was obtained in RNA from all time points.
Full figure and legend (80K)Production and characterization of pKe#192/MAP17-specific poly- and monoclonal antibodies
Anti-peptide antibodies were prepared against the 18-mer carboxy-terminal peptide of pKe#192 in rabbits. These antibodies were affinity purified by using the same peptide. Second, the intracytoplasmic part of pKe#192/MAP17 (''pKe#192-C'') was expressed as GST-fusion protein and purified as described under Materials and Methods. The fusion protein was used to generate polyclonal rabbit IgG as well as murine monoclonal antibodies. The affinity purified antipeptide and anti-GST-pKe#192-C rabbit IgG as well as the monoclonal antibodies were tested by immuno-blotting on recombinant pKe#192-C and kidney lysates, the latter of which are known to contain MAP17 (Kocher et al. 1996). All antibody preparations reacted specifically with the recombinant pKe#192-C as well as with a 17-kDa band, corresponding to native MAP17 in kidney lysates Figure 3. The antibody preparations were further characterized by immuno-fluorescence staining of pKe#192-transfected COS cells. As exemplified for the monoclonal antibody strong staining of transfected cells was observed Figure 4a, whereas untransfected cells were negative Figure 4b. To further corroborate the specificity of the antibody preparations, frozen sections of human kidney were analyzed by using immuno-fluorescence. Both, the poly- (not shown) as well as the monoclonal Figure 4c antibody preparations stained – as expected – the proximal kidney tubuli.
Figure 3.
Characterization of anti-pKe#192/MAP17 antibodies by immuno-blotting of Triton X-100 extracts of normal kidney tissue. Extracts of normal human kidney (see Materials and Methods) were separated by SDS-PAGE and processed for immuno-blotting. The blots were reacted with the following antibodies: lane A, mAb HD-pKe#192-C.1; lane B, mAb HD-pKe#192-C.2; lane C, anti-pKe#192-C rabbit IgG; lane D, anti-pKe#192 peptide rabbit IgG; lane E, normal rabbit IgG; lane F, Isotype-matched (IgG1) mAb.
Full figure and legend (110K)Figure 4.
Detection of pKe#192/MAP17 in human kidney and normal human epidermis and bullous dermatoses by immunofluorescence staining with mAb against pKe#192/MAP17. (a) pKe#192/MAP17-COS cell transfectans were used as positive control. (b) Negative control of COS cell transfectans. (c) Labeling of the proximal tubules of human kidney. (d) Labeling of plantar skin demonstrated a broadened staining pattern for pKe#192/MAP17 corresponding to the enlarged stratum granulosum in this skin area. (e) Detection in the stratum granulosum of normal human skin. (f–g) Double-staining with Involucrin (red/f) showed colocalization (yellow/g). In the bullous diseases pemphigus vulgaris (h) and bullous pemphigoid (i) pKe#192/MAP17 is expressed in the periphery of blisters (b).
Full figure and legend (98K)Localization of pKe#192/MAP17 in the upper stratum granulosum of normal epidermis
The location of pKe#192/MAP17 in normal human epidermis was analyzed by immunofluorescence. PKe#192/MAP17 was located in the stratum granulosum Figure 4d, e. In areas with a broadened stratum granulosum, e.g., in the plantar skin, pKe#192/MAP17-specific staining was increased Figure 4d. The same results were obtained by using antipeptide- and antirecombinant pKe#192-C rabbit IgG. In order to analyze the distribution pattern of pKe#192/MAP17 in more detail we analyzed colocalization of pKe#192/MAP17 with involucrin. PKe#192/MAP17-specific and involucrin-specific stainings were found to be colocalized Figure 4g.
Upregulation of pKe#192/MAP17 in lesional epidermis in vivo
We analyzed the expression of pKe#192/MAP17 in bullous dermatoses by using immunohistochemistry. Frozen sections of bullous pemphigoid and pemphigus vulgaris were stained with the pKe#192-specific mono- and polyclonal antibodies. In this blistering diseases an upregulation of pKe#192/MAP17 was found in cells surrounding the blister Figure 4h, i.
Detection of pKe#192/MAP17 in human kidney and epidermis by immunoprecipitation
In order to corroborate the findings obtained by immunofluorescence staining, we performed immunoprecipitation experiments on human kidney and epidermal tissue. As detailed under Materials and Methods, protein was extracted from these tissues by homogenization with a tissue grinder in PBS containing Triton X-100. From kidney tissue pKe#192/MAP17 could be solubilized by these conditions. In epidermal tissue, however, pKe#192/MAP17 remained insoluble. Solubilization was achieved by resuspending the pellet in PBS containing 5 mM Tris/MgCl2. PKe#192/MAP17 was detected in transfected COS cells and in immunoprecipitates of kidney and epidermis extracts Figure 5.
Figure 5.
Determination of pKe#192/MAP17 in human kidney and epidermis by immunoprecipitation. Lysates of human kidney and epidermis were prepared and subjected to immunoprecipitation as described under Materials and Methods. The precipitates were subjected to SDS-PAGE and subsequent immuno-blotted using rabbit anti-pKe#192-C IgG. As a positive control, lysates of pKe#192-C-expressing COS cells transfectans (lane A) were analyzed. Lane B, kidney lysates with Triton-X 100 containing pKe#192/MAP17; lane C, epidermis lysates with Triton-X 100; lane D, kidney lysates with MgCl2 buffer; lane E, epidermis lysates with MgCl2 buffer containing pKe#192/MAP17.
Full figure and legend (88K)Discussion
By using subtraction cloning we analyzed the activation reaction induced in cultured keratinocytes by dispase-mediated detachment from their growth substratum (Schaefer et al. 1996,2000). We identified a transcript that we denominated ''pKe#192''. Computer-assisted molecular analysis of the pKe#192-specific open reading frame revealed identity with DD96/MAP17, a molecule previously identified in human kidney tissue byKocher et al. (1995, 1996); thus, the term ''MAP17'' will be used in the following. By employing novel mono- and polyclonal antibodies we obtained evidence that MAP17 is expressed in cultured epidermal keratinocytes and is present in the normal human epidermis, where it is colocalized with the epidermal differentiation marker involucrin. Moreover, we provide evidence for upregulation in involved keratinocytes in lesional epidermis of bullous pemphigoid and pemphigus vulgaris. MAP17 was initially discovered by Kocher et al. in an attempt to identify tumor-specific gene transcripts in renal carcinoma by the differential display technique. Its expression was then analyzed in normal and malignant tissues by northern blotting and immuno-histochemistry, the latter by using an antiserum against a synthetic peptide corresponding to the C-terminus of the molecule. MAP17 was localized in the proximal tubular cells of the kidney and expressed in various carcinoma cell lines originating from kidney, colon, lung, and breast. Our data extend these findings by providing evidence that MAP17 is also expressed in epidermal keratinocytes: (i) MAP17-specific cDNA was isolated from a library that was prepared from mRNA derived from cultured normal human epidermal keratinocytes (compare Figure 1); (ii) expression of MAP17-specific mRNA was demonstrated by RT-PCR in cultured human epidermal keratinocytes after detachment from the growth substratum (compare Figure 2); (iii) immunoprecipitation combined with immunoblotting revealed the presence of MAP17 protein in the latter cells (compare Figure 5); (iv) immunohistology of skin biopsies derived from different locations of the human body indicated the presence of MAP17 in the stratum granulosum of the normal epidermis (compare Figure 4d, e); and finally (v) we provide evidence that MAP17 is upregulated in lesional epidermis of bullous diseases (compare Figure 4h, i).
Our finding that keratinocytes express MAP17-specific mRNA is at some variance with Kocher's original northern blot analysis (Kocher et al. 1995), in which MAP17-specific mRNA was not disclosed in this cell type. At present we can only speculate on the reasons for this discrepancy. First, our findings suggest that MAP17 in keratinocytes is subject to regulation, be it by detachment-induced activation (see Figure 2) or, as suggested by the immunohistologic findings in the epidermis Figure 4d, e, by differentiation and lesion formation (Figure 4h, i. Therefore, the amount of MAP17-specific mRNA may strongly differ with the actual state of the keratinocyte culture used for mRNA isolation. This is one reason that may account for the difference between Kocher's and our own data. Second, MAP17-specific transcripts appear to be rare in keratinocytes: (i) we obtained only very weak signals by conventional northern blotting and (ii) we were unable to detect MAP17 in keratinocytes by immuno-blotting without prior enrichment via immunoprecipitation.
Our immunohistologic stainings of normal epidermis revealed a linear decoration in the area of cell/cell contacts in the stratum granulosum. Although these stainings do not have the necessary degree of resolution to allow precise subcellular localization, the staining pattern is compatible with the idea that MAP17 is involved in the formation of cellular junctions in the stratum granulosum of the normal epidermis. It remains to be explored whether MAP17 could be part of the cadherin-related junctional apparatus, thereby contributing to the spatial arrangement of epithelial cells.
Previously,Kocher et al. (1996) provided evidence that MAP17 is involved in the control of cellular proliferation. Transfection experiments with MAP17 in the colon carcinoma cell line HT29 downregulated cell proliferation in vitro and tumor growth in vivo (Kocher et al. 1996). A further step towards elucidation of the molecular basis of MAP17 function was made by two hybrid selection experiments, in which the intracytoplasmic domain of MAP17 was used as a bait to screen a human kidney library. By this approach, a novel protein containing so-called PDZ interaction domains was identified (Kocher et al. 1998). Molecules containing PDZ domains have diverse biologic functions, including the control of cell proliferation, cell differentiation, and synaptic organization (Woods & Bryant, 1991;Cho et al. 1992;Li & January 1992;Kim et al. 1995;Poulat et al. 1997). Kocher and colleagues speculated that PDZK1 likely represents the link between MAP17 in the cell membrane and other cytoplasmic proteins that still remain to be identified (Kocher et al. 1998). At present we are exploring whether PDZK1 is also expressed in keratinocytes.
We demonstrate that in the human epidermis MAP17 is present in the stratum granulosum, in which epidermal keratinocytes have left the proliferation compartment, the basal epidermal cell layer, and have progressed to an advanced stage of differentiation, which also involves apoptosis. This allows to discuss a possible role of MAP17 in programmed cell death. Originally we identified MAP17 in an subtractive cloning experiment in which transcripts upregulated upon loss of cell matrix contact were enriched (Schaefer et al. 2000). Our immunohistologic data in bullous diseases provide evidence that MAP17 is also subject to upregulation under in vivo conditions, in which pericellular, i.e., cell/matrix Figure 4i or cell/cell Figure 4h, interactions are disturbed. There is ample evidence that the loss of pericellular contacts leads to induction of programmed cell death (for review seeIshida-Yamamoto et al. (1999)). Taken together, it appears tempting to speculate that MAP17 is involved in the regulation of programmed cell death in keratinocytes and it remains to be explored whether previously described antiproliferative activity of MAP17 (Kocher et al. 1996) provides a link to this cell biologic phenomenon.
In conclusion, we provide evidence for the expression of MAP17 in human epidermal keratinocytes, which merits further studies into the above-mentioned possible role in keratinocyte physiology and pathopysiology.
References
| 1. | Bruyns E, Marie-Cardine A & Kirchgessner H. et al T cell receptor (TCR) interacting molecule (TRIM), a novel disulfide-linked dimer associated with the TCR-CD3-X complex, recruits intracellular signaling proteins to the plasma membrane. J Exp Med (1998) 188: 561–575. | Article | PubMed | ISI | ChemPort | |
| 2. | Cho K, Hunt CA & Kennedy MB. The rat brain postsynaptic density fraction contains a homolog of the Drosophila discs-large tunor suppressor protein. Neuron (1992) 9: 929–942. | Article | PubMed | ISI | ChemPort | |
| 3. | Chomoczynski P & Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem (1986) 162: 156–159. | Article | ISI | |
| 4. | Coulombe PA. Towards a molecular definition of keratinocyte activation after acute injury to stratified epithelia. Biochem Biophys Res Commun (1997) 236: 231–238 10.1006/bbrc.1997.6945. | Article | PubMed | ISI | ChemPort | |
| 5. | Dale BA, Holbrook KA, Kimball JR, Hoff M & Sun TT. Expression of epidermal keratins and filaggrin during human fetal skin development. J Cell Biol (1985) 101: 1257–1269. | Article | PubMed | ISI | ChemPort | |
| 6. | Gefter ML, Margulies DH & Scharff MD. A simple method for polyethylene glycol promoted hybridization of mouse myeloma cells. Cell Genet (1977) 3: 231–236. | ChemPort | |
| 7. | Grondahl-Hansen J, Lund LR, Ralfkiaer E, Ottevanger V & Dano K. Urokinase- and tissue-type plasminogen activators in keratinocytes during wound reepithelialization in vivo. J Invest Dermatol (1988) 90: 790–795. | Article | PubMed | ISI | ChemPort | |
| 8. | Haymerle H, Herz J, Bressan GM, Frank R & Stanley KK. Efficient construction of cDNA libraries in plasmid expression vectors using an adaptor strategy. Nucleic Acids Res 11 (1986) 14: 8615–8624. | ChemPort | |
| 9. | Ishida-Yamamoto A, Tanaka H, Nakane H, Takahashi H, Hashimoto Y & Iizuka H. Programmed cell death in normal epidermis and loricrin kerato-derma. Multiple functions of profilaggrin in keratinization. J Invest Dermatol Symp Proceedings of The (1999) 4: 145–149. | ChemPort | |
| 10. | Kim E, Niethammer M, Rothschild A, January YN & Sheng M. Clustering of shaker-type K+ channels by interaction with a family of membrane-associated guanylate kinases. Nature (1995) 378: 85–88. | Article | PubMed | ISI | ChemPort | |
| 11. | Kocher O, Cheresh P, Brown LF & Lee SW. Identification of a novel gene, selectively up-regulated in human carcinomas, using the differential display technique. Clin Cancer Research (1995) 1: 1209–1215. | ISI | ChemPort | |
| 12. | Kocher O, Cheresh P & Lee SW. Identification and partial chatacterization of a novel membrane-associated protein (MAP17) up-regulated in human carcinomas and modulating cell replication and tumor growth. Am J Pathol (1996) 149: 493–500. | PubMed | ISI | ChemPort | |
| 13. | Kocher O, Comella N, Tognazzi K & Brown LF. Identification and partial characterization of PDZK1: a novel protein containing PDZ interaction domains. Laboratory Invest (1998) 78: 117–125. | ISI | ChemPort | |
| 14. | Kohler G & Milstein C. Continuous cultures of fused cells secreting antibody of predefined specificity. Nature (1975) 256: 495–497. | Article | PubMed | ISI | ChemPort | |
| 15. | Li M & January LY. Specification of subunits and multiple members of the PSD-95 family of membrane-associated guanylate kinases. J Neurosci (1992) 16: 2157–2163. |
| 16. | McNeil H & Jensen PJ. A high-affinity receptor for urokinase plasminogen activator on human keratinocytes: characterization and potential modulation during migration. Cell Regul (1990) 1: 843–852. | PubMed | ISI | ChemPort | |
| 17. | Posnett DN & Tam JP. Multiple antigenic peptide method for producing antipeptide site-specific anitbodies. Methods-Enzymol (1998) 178: 739–746. |
| 18. | Poulat F, de Santa Barbara P & Desclozeaux M. et al The human testis determining factor SRY binds a nuclear factor containing PDZ protein interaction domains. J Biol Chem (1997) 272: 716–7172. |
| 19. | Rheinwald JG & Green H. Serial cultivation of strains of human epidermal keratinocytes: the formation of keratinizing colonies from single cells. Cell (1975) 6: 331–344. | Article | PubMed | ISI | ChemPort | |
| 20. | Romer J, Lund LR & Eriksen J. et al Differential expression of urokinase-type plasminogen activator and its type-1 inhibitor during healing of mouse skin wounds. J Invest Dermatol (1991) 97: 803–811. | Article | PubMed | ISI | ChemPort | |
| 21. | Romer J, Lund LR, Eriksen J, Pyke C, Kristensen P & Dano K. The receptor for urokinase-type plasminogen activator is expressed by keratinocytes at the leading edge during re-epithelialization of mouse skin wounds. J Invest Dermatol (1994) 102: 519–522. | Article | PubMed | ISI | ChemPort | |
| 22. | Rosen CF, Poon R & Drucker DJ UVB. radiation-activated genes induced by transcriptional and posttranscriptional mechanisms in rat keratinocytes. Am J Physiol (1995) 268: C846–C855. | PubMed | ISI | ChemPort | |
| 23. | Schaefer BM, Reinartz J, Bechtel MJ, Inndorf S, Lang E & Kramer MD. Dispase-mediated basal detachment of cultured keratinocytes induces urokinase-type plasminogen activator (uPA) and its receptor (uPA-R, CD87). Exp Cell Res (1996) 228: 246–253 10.1006/excr.1996.0323. | Article | PubMed | ISI | ChemPort | |
| 24. | Schaefer BM, Wallich R, Schmolke K, Fink W, Bechtel M, Reinartz J & Kramer JD. Immunohistochemical and molecular characterization of cultured keratinocytes after dispase-mediated detachment from the growth substratum. Exp Dermatol (2000) 9: 58–64. | Article | PubMed | ISI | ChemPort | |
| 25. | Smith DB, Davern KM, Board PG, Tiu WU & Garcia EG. Metchell. Mr 26,000 antigen of Schistosoma japonicum recognized by resistant WEHI 129/J mice is a parasite glutathione S-transferase. Proc Natl Acad Sci (1986) 83: 8703–8707. | PubMed | ChemPort | |
| 26. | Smith DB & Johnson KS. Single-step purification of polypeptides expressed in Escherichia coli as fusion with glutathione S-transferase. Gene (1988) 67: 31–40. | Article | PubMed | ISI | ChemPort | |
| 27. | Watt FM & Green H. Stratification and terminal differentiation of cultured epidermal cells. Nature (1982) 295: 434–436. | Article | PubMed | ISI | ChemPort | |
| 28. | Woods DF & Bryant PJ. The discs-large tumor suppressor gene of Drosophila encodes a guanylate kinase homolog localized at septate junctions. Cell (1991) 66: 451–464. | Article | PubMed | ISI | ChemPort | |
Acknowledgments
The authors are grateful to Christiane Brenner and Jeanette Reinartz for helpful advice and Sabine Wentrup for the immunohistologic stainings. This work has been supported by a grant of the Deutsche Forschungsgemeinschaft (Kr 931/3–3).
