Materials and methods

Chemicals

All chemicals used for high performance liquid chroma-tography were of analytical grade.

Cytokines, neurotrophins, antibodies

Recombinant human inter-feron- (IFN-) was from Genzyme (Munich, Germany). Recombinant human NT-4 and NT-3 were purchased from Sigma (Munich, Germany), and anti-NT-4 and anti-NT-3 antibodies were raised in chicken (from Promega, Madison, MA), or in goat (from R&D, Wiesbaden, Germany). Antichicken and antigoat antibodies and species-specific isotype control antibodies were from Dianova (Hamburg, Germany).The phorbol ester phorbol 12-myrisate 13-acetate (PMA) and dexamethasone were from Sigma.

Cell culture

Normal human keratinocytes (HNK) were prepared from neonatal foreskin as described previously and were maintained in culture using a defined keratinocyte growth medium (KSF-M; Gibco BRL, Karlsruhe, Germany) (^{Grewe et al. 1996}). For all experiments, fourth and fifth passage cells at subconfluency were used. Cells were cultured at 37°C in a humidified atmosphere containing 5% CO₂. For stimulation, cells were seeded for 24 h into 25 mm tissue culture plates (Falcon, Lincoln Park, NJ) at a density of 2.5  10⁵ cells per plate.

Fibroblasts were derived from skin biopsies from healthy individuals (^{Ahrens et al. 1997}). Cells were grown in Eagle's minimal essential medium (Bio Whittaker, Verviers, Belgium) with 15% fetal bovine serum (FBS) (Gibco BRL) up to subconfluency.

The neuroblastoma cell line SY5Y was a generous gift from B. Urmoneit (Department of Neuropathology, Heinrich-Heine-University of Düsseldorf, Germany). This cell line was subcloned from the cell line SK-N-SH (^{Biedler et al. 1973}) and was kept in culture in Ham's F12 and modified Eagle's medium (1:1) (PAA Laboratories, Martinsried, Germany) containing 1% nonessential amino acids, 1% antibiotics (penicillin G, streptomycin, amphotericin B) (all from Gibco BRL), and 10% FBS (Greiner, Frickenhausen, Germany), and 1% glutamine (Seromed, Berlin, Germany). Culture medium was changed every 2–3 d, and cells were split every 5 d. These cells were used for measuring growth-promoting NT-4-dependent bioactivity in supernatants of HNK. For this purpose SY5Y cells were seeded at a density of 6  10⁴, 8  10⁴, or 1 10⁵ cells per plate on 24 well plates and after 4 h the medium was changed to 1% FBS ('starving' conditions). After an additional 24 h, SY5Y cells were cultured in the presence of recombinant human NT-4 (50 ng per ml), or they were cultured in medium containing 20% HNK-conditioned culture supernatants that had been 1:20 concentrated with centricon-10 concentrators (Amicon, Witten, Germany). These incubations were also carried out in the presence of goat-derived neutralizing anti-NT-4 antibody or its isotype control antibody. After another 72 h, cell growth was assessed by using the cell proliferation reagent WST-1 (Boehringer Mannheim, Mannheim, Germany). The assay is based on the colorimetric measurement of the activity of the intramitochondrial enzyme succinate-tetrazolium reductase by addition of tetrazolium salts to the cell culture. The enzyme is only active in viable cells, and therefore its activity directly correlates with the number of metabolically active cells in culture. The test was performed according to the instructions of the supplier (Boehringer Mannheim).

Reverse transcriptase polymerase chain reaction (RT-PCR)

NT-3 and NT-4 mRNA expression was measured by semiquantitative RT-PCR as described previously (^{Henninger et al. 1993}). For investigation of NT mRNAs the following primer pairs were employed for NT-3, NT-4 and -actin as housekeeping gene (5' to 3'): NT-4, ATGCTCCCTCTTCAT-GC, TCA-GGCCCGGCCAGTCCGGC; NT-3, ATGTCCATCTTG-TTTTATGTG, TCATGTTCTTCCGATTTTTCTCG; -actin, GTG-GGGCGCCCCAGGCACCA, CTCCTTAATGTCACG-CACGATT-TC. Five micrograms of total RNA was reverse transcribed using mouse moloney leukemia virus reverse transcriptase and an oligo-dT₁₈ primer. Linear amplification conditions for each primer pair used were determined as described in detail previously (^{Henninger et al. 1993}). In brief, (i) identical amounts of cDNA were subjected to increasing cycle numbers of PCR to obtain the linear amplification range, and then, (ii) increasing amounts of cDNA (for up to 64-fold of the starting amount) were subjected to PCR of a given cycle number within the linear range to exclude that increased amounts of a specific cDNA led to disturbance of the linearity in PCR amplification. Amplification was found to be linear in the range up to 35 cycles for NT-3 and NT-4 and up to 31 cycles for the -actin primer pair. Therefore, for investigation of NT mRNAs, routinely one-third of total cDNA was subjected to 33 PCR cycles. For investigation of -actin mRNA as housekeeping gene, routinely 1/33 of total cDNA was subjected to 28 PCR cycles. Each PCR of each sample for each primer pair was carried out at least twice. Identity of products was established by performing specific endonuclease digestion assays of amplification products. For quantification, amplification products were directly subjected to ion-exchange chromatography connected to an on-line ultraviolet spectrophotometer (A260 nm), as described previously (^{Henninger et al. 1993;Grewe et al. 1994,1995}). Since -actin expression was used as housekeeping gene, amplification signals for NT-3 and NT-4 mRNAs were normalized to the respective amplification signals of -actin mRNA, as has been described previously (^{Henninger et al. 1993}). Based on cell numbers, amplification signals for -actin mRNA did not change by more than 12% between culture dishes regardless of their treatment. PCR without reverse transcription did not result in amplification signals.

Immunoprecipitation

Immunoprecipitation of human NT-4 was carried out using chicken antihuman NT-4 antibodies absorbed to agarose-immobilized antichicken IgY agarose-immobilized antichicken IgY antibodies from goat (Promega). For cell lysates, equal amounts of protein were immunoprecipitated, whereas for culture medium, equal volumes of supernatants were used. Immunoprecipitation was performed under conditions described in the instructions of the suppliers. Western blot analysis was carried out after a standard protocol (^{Sambrook et al. 1989}) using the chicken anti-NT-4 antibody and a goat antichicken IgY antibody coupled to horseradish peroxidase (Dianova), and chemiluminescence detection using the ECL system from Pharmacia (Freiburg, Germany).

Biopsies

Injection of human skin with IFN- and skin biopsies were carried out with human volunteers after written informed consent.

Recombinant human IFN- with a specific activity of 1.2  10⁷ U per mg was purchased from Rentschler (Laupheim, Germany). Three volunteers received an intradermal injection of 38,000 U IFN- diluted in sterile pyrogen-free water to defined areas on the buttock. After 24 h, 6 mm punch biopsies were obtained from IFN--injected or diluent-injected skin, respectively. Biopsies were snap frozen immediately and stored at -80°C.

Also, 6 mm punch biopsies were obtained from prurigo lesions of three atopic dermatitis patients and from nonlesional uninvolved skin of these atopic dermatitis patients.

Immunohistochemistry

Frozen specimens were embedded in Optimum Cutting Medium (OCT; Miles, Elkhar, IN) and 5 m serial sections were prepared using a Cryocut 2000 (Reichert & Jung, Nubach, Germany). Air-dried, acetone-fixed frozen sections were stained using a four-step immunohistochemistry assay (DAKO Diagnostica, Hamburg, Germany): (i) primary chicken antihuman NT-4 antibody, or chicken antihuman NT-3 antibody (each 1:400); (ii) biotin-conjugated goat antichicken IgG; (iii) peroxidase-conjugated streptavidin; (iv) diamino-benzidine as substrate. After staining the slides were mounted with glycergel. Positive staining was identified as a brown-red reaction product in light microscopy.

Results

Primary human fibroblasts constitutively expressed mRNA for NT-3 but not for NT-4. In marked contrast, HNK did not express NT-3 mRNA but did express high constitutive levels of NT-4 transcripts (Figure 1). Specificity of RT-PCR products of NT-4 transcripts was demonstrated by endonuclease digestion of the PCR product (data not shown). Expression of NT-4 mRNA was significantly induced by treatment of HNK with IFN- or PMA, while treatment with dexamethasone (Figure 2) or, as diluent controls, with 0.01% bovine serum albumin (BSA) and 0.1% ethanol failed to do so (data not shown). Induction of NT-4 transcripts after IFN- treatment lasted at least 48 h at which time the experiment was terminated (Figure 3). Treatment of HNK with 0.01% BSA for 24 and 48 h did not induce NT-4 mRNA expression (data not shown). As measured by immunoprecipitation/Western blotting, induction of NT-4 transcripts was accompanied by accumulation of intracellular NT-4 protein and its release into the culture supernatants for at least 72 h (Figure 4), whereas untreated or 0.1% BSA treated HNK, in accordance with lack of mRNA induction, did not show intracellular accumulation of NT-4 protein (Figure 4). Western blotting of immunoprecipitates revealed three bands reactive with the antibody used. This observation may be due to the presence of multimeres of NT-4. It cannot be excluded, however, that hitherto undefined neurotrophic factors cross-react with the antibodies. Recombinant human NT-4 was able to induce growth of SY5Y cells, which could be inhibited by the presence of neutralizing anti-NT-4 antibodies (Figure 5). Based upon this biologic responsiveness towards NT-4, keratinocyte-derived NT-4 was demonstrated to be biologically active, because supernatants of IFN--stimulated HNK induced growth of SY5Y cells, which was inhibited by a neutralizing anti-NT-4 antibody (Figure 5). These in vitro findings were corroborated and extended by in vivo studies, in which biopsy specimens of human skin were examined (Figure 6). Normal human skin showed a positive staining for NT-3 in the dermal compartment, but not in the epidermal layer. In contrast, NT-4 staining was observed in epidermal keratinocytes, while the dermis showed only a few cells positive for NT-4. This in situ expression pattern was more pronounced in IFN--injected skin: epidermal NT-4 expression was markedly increased, and dermal NT-3 expression appeared essentially unaltered. A very similar pattern was also observed for an IFN--driven inflammatory skin disease, i.e. atopic dermatitis. Prurigo lesions of atopic dermatitis showed a very strong epidermal but weak dermal staining for NT-4, while dermal NT-3 staining was nearly unchanged, compared with normal skin. Increase of epidermal NT-4 expression could not be observed in uninvolved skin of atopic dermatitis patients.

Figure 1.

Expression of mRNA for NT-3, NT-4, and -actin in HNK versus human dermal fibroblasts. Preparation and culture of HNK and fibroblasts, extraction of RNA, and RT-PCR were carried out as described in Materials and Methods. Ethidium-bromide-stained agarose gel of RT-PCR products specific for the housekeeping gene -actin in fibroblasts (lane 2) and HNK (lane 3), for NT-3 in fibroblasts (lane 4) and HNK (lane 5), and for NT-4 in fibroblasts (lane 6) and HNK (lane 7); lane 1, water control; M, 600 bp marker.

Full figure and legend (15K)

Figure 2.

Regulation of HNK NT-4 mRNA expression. HNK were treated for 24 h with 100 U per ml recombinant human IFN- (IFNg), 1 m PMA (PMA), 1 m dexamethasone (Dex), were left untreated (C). Total RNA was extracted and semiquantitative RT-PCR for NT-4 mRNA was carried out as described in Materials and Methods. Changes of NT-4 mRNA expression are given as fold increase of that in untreated cells (set as 1). Histograms represent means  SD of three independent experiments.

Full figure and legend (11K)

Figure 3.

Time kinetic of NT-4 mRNA expression in IFN--treated HNK in culture. HNK were kept in culture in the presence of 100 U per ml recombinant human IFN- (IFN) for the indicated time periods, or were left untreated (C). Total RNA was extracted and semiquantitative RT-PCR for NT-4 mRNA was carried out as described in Materials and Methods. NT-4 mRNA expression is given as arbitrary absorption units (AU). Values represent means  SD of three independent experiments.

Full figure and legend (7K)

Figure 4.

Immunoprecipitation/Western blotting of supernatants and lysates of IFN--treated or untreated HNK in culture. HNK were cultured in the presence of recombinant human IFN- (IFNg) or 0.01% BSA (BSA) for the indicated periods of time, or were left untreated (Medium). Supernatants were concentrated, immunoprecipitated, gel-electrophoresed, and Western-blotted as described in Materials and Methods. The arrow indicated as NT4 corresponds to approximately 38 kDa of a molecular weight marker.

Full figure and legend (35K)

Figure 5.

Detection of NT-4 bioactivity in supernatants of IFN--stimulated HNK. SY5Y cells were cultured in the presence of recombinant human NT-4 (50 ng per ml) (A), recombinant human NT-4 plus antihuman NT-4 antibodies (B), antihuman NT-4 antibodies (C), concentrated supernatants of unstimulated (D) and IFN--stimulated (E) HNK, or in the presence of these supernatants with addition of neutralizing antihuman NT-4 antibodies (F, G). As controls, SY5Y cells were cultured with concentrates of KSF-M medium (H), in the presence of 100 U per ml recombinant human (I), or were left untreated (K). Cell growth was measured colorimetrically by the WST-1 assay; results are given as absorption units and are means  SD of three independent experiments.

Full figure and legend (16K)

Figure 6.

Immunohistochemical detection of NT-4 in human skin. Skin biopsies and processing for immunohistochemical detection for NT-3 or NT-4 was carried out as described in Materials and Methods. Immunoreactivity for NT-4 in normal (a), IFN--injected skin (c), and prurigo lesion (e) is compared to NT-3 reactivity in the same biopsy samples (b, d, f); (h) NT-4 reactivity in uninvolved skin of an atopic dermatitis patient; (g) immunoreactivity of normal human skin for isotype control antibodies. Arrows indicate dermal immunoreactivity for NT-4 (a, c, e) or NT-3 (b, d); 100 magnification.

Full figure and legend (191K)

Discussion

We report that human epidermal keratinocytes express and secrete biologically active NT-4. This conclusion is based on (i) demonstration of expression of mRNA specific for NT-4; (ii) the presence of a protein reacting specific to antihuman NT-4 antibody in immunoprecipitates of HNK culture supernatants and HNK lysates, and (iii) the presence of a glioblastoma-growth-promoting biological activity in HNK culture supernatants, which was neutralized by anti-NT-4 antibodies. These in vitro findings were corroborated and extended by in vivo studies demonstrating immunoreactivity for NT-4 antibodies in keratinocytes of biopsy specimens from normal, IFN--injected, and diseased human skin.

In HNK cultures, keratinocyte NT-4 production was markedly induced by the proinflammatory cytokine IFN-. Furthermore, injection of recombinant human IFN- into healthy human skin upregulated NT-4 protein expression in epidermal keratinocytes, indicating that IFN- is a potent inducer for NT-4 in vivo as well. This finding demonstrates a close cause and effect relationship between immune and neurotrophic factors, suggestive for a pathophysiologic role of NT-4 in inflammatory skin diseases. IFN- induced NT-4 mRNA expression in HNK slowly within 24 h to 48 h, and protein expression of NT-4 HNK lasted for at least 3 d. We conclude from these observations that chronicity of skin inflammation might be crucial for induction and maintenance of increased HNK NT-4 expression. Thus, in human skin, a persistent change of the microenvironment during inflammation is probably responsible for modulation of skin innervation. In support of this assumption we have observed that NT-4 is highly expressed in a chronic inflammatory skin disease, i.e., atopic dermatitis. A clinical hallmark of atopic dermatitis is the intense, chronic pruritus, especially of prurigo lesions (^{Hardaway 1880;Hyde 1909;Rowland Payne et al. 1985}). These lesions are histologically characterized by increased numbers of sensoric nerve fibers (^{Pautrier et al. 1934;Liebner & Kovacs 1936;Cowan 1964;Vaalasti et al. 1989;Abadia Molina et al. 1992}). For the pathogenesis of atopic dermatitis, immunologic alterations of the skin immune system are of utmost importance (^{Kapp 1995;Grewe et al. 1998}). It could be demonstrated that the chronicity of eczematous lesions is determined by high expression of the T-cell-derived cytokine IFN- (^{Grewe et al. 1994,1995;Ohmen et al. 1995}). Increased IFN- expression in lesional atopic skin may well explain the observed overexpression of NT-4. Neurotrophic factors including NT-4 have been described to support nerve survival and outgrowth (^{Ibanez et al. 1993;Riddle et al. 1995}), and it is therefore intriguing to speculate that epidermis-derived NT-4 mediates the increased innervation. For ethical reasons, we were not allowed to inject recombinant human NT-4 into human kin in order to directly demonstrate changes of skin innervation. This assumption is supported, however, by the present in vitro observation that HNK-derived NT-4 has the capacity to increase growth of human neural-crest-derived cell type, the glioblastoma cell line SY5Y. In atopic dermatitis, NT-4 may represent a mediator of 'neuro-dermatitis' by maintaining the vicious circle of pruritus, scratching, and subsequent deterioration of eczema, resulting again in intense pruritus.

Demonstration of NT-4 in human skin adds another mediator to neurotrophic factors expressed in this organ (^{Yaar et al. 1991,1994,1996;Pincelli et al. 1994}; Botchkarev et al. 1998). It is remarkable, however, that expression of different neurotrophic factors is assigned to distinct compartments of human skin. As demonstrated by RT-PCR and immunohistochemistry, NT-4 is strongly expressed in keratinocytes and thereby predominantly expressed in the epidermis, whereas NT-3 expression occurs in fibroblasts with corresponding positive staining in the dermal compartment. This morphologic dichotomy is associated with a different response to IFN-. Epidermal NT-4 expression is markedly increased in IFN--injected skin as well as in atopic dermatitis lesions, whereas under both conditions NT-3 expression was nearly unaltered. Thus, NT-4 and NT-3 are not only differently expressed and regulated, but may also serve different functions. We propose that NT-4 is more relevant for regulation of innervation whereas NT-3 is more important for melanocyte growth (^{Yaar et al. 1994}).

Taken together, our data indicate that neurotrophic factors tightly control the development of the haptic apparatus of the skin under normal as well as selected inflammatory conditions. Thus, in human skin, NT-4 might serve as a molecular substrate linking the immune and the nerve system.

References

1. Abadia Molina, F, Burrows, NP, Russel Jones, R, Terenghi, G, Polak, JM: Increased sensory neuropeptides in nodular prurigo: a quantitative immunohistochemical analysis. Br J Dermatol 1992 127, 344–351,  | PubMed | ChemPort |
2. Ahrens, C, Grewe, M, Berneburg, M, et al: Photocarcinogenesis and inhibition of intercellular adhesion molecule 1 expression in cells of DNA-repair-defective individuals. Proc Natl Acad Sci USA 1997 94, 6837–6841,  | Article | PubMed | ChemPort |
3. Berkemeier, LR, Winslow, JW, Kaplan, DR, Nikolics, K, Goeddel, DV, Rosenthal, A: Neurotrophin-5: a novel neurotrophic factor that activates trk and trkB. Neuron 1991 7, 857–866,  | Article | PubMed | ISI | ChemPort |
4. Biedler, JL, Helson, L, Spengler, BA: Morphology and growth, tumorigenicity, and cytogenetics of human neuroblastoma cells in continuous culture. Cancer Res 1973 33, 2643–2652,  | PubMed | ISI | ChemPort |
5. Brill, G, Kahane, N, Carmeli, C, von Schack, D, Barde, YA, Kalcheim, C: Epithelial–mesenchymal conversion of dermatome progenitors requires neural tube-derived signals: characterization of the role of neurotrophin-3. Development 1995 121, 25583–2594,
6. Cowan, MA: Neurohistological changes in prurigo nodularis. Arch Dermatol 1964 89, 754–758,  | PubMed | ISI | ChemPort |
7. Grewe, M, Bruijnzeel-Koomen, CAFM, Schöpf, E, Thepen, T, Langeveld-Wildschut, AG, Ruzicka, T, Krutmann, J: A role for Th1 and Th2 cells in the immunopathogenesis of atopic dermatitis. Immunol Today 1998 19, 359–361, 10.1016/s0167-5699(98)01285-7 | Article | PubMed | ISI | ChemPort |
8. Grewe, M, Gyufko, K, Budnik, A, Ruzicka, T, Olaizola-Horn, S, Berneburg, M, Krutmann, J: Interleukin-1 receptors type I and type II are differentially regulated in human keratinocytes by ultraviolet B radiation. J Invest Dermatol 1996 107, 98–103,
9. Grewe, M, Gyufko, K, Schöpf, E, Krutmann, J: Lesional expression of interferon- in atopic eczema. Lancet 1994 343, 25–26,  | Article | PubMed | ISI | ChemPort |
10. Grewe, M, Walter, S, Gyufko, K, Czech, W, Schöpf, E, Krutmann, J: Analysis of the cytokine pattern expressed in situ in inhalant allergen patch test reactions of atopic dermatitis patients. J Invest Dermatol 1995 105, 407–411,  | Article | PubMed | ISI | ChemPort |
11. Hardaway, WA: A case of multiple tumours of the skin accompanied by intense itching. Arch Dermatol 1880 6, 129,
12. Henninger, HP, Hoffmann, R, Grewe, M, Schulze-Specking, A, Decker, K: Purification and quantitative analysis of nucleic acids by anion-exchange-high-performance liquid chromatography. Biol Chem Hoppe-Seyler 1993 374, 625–629,  | PubMed | ISI | ChemPort |
13. Hyde, JN: Prurigo Nodularis. In: Hyde JN, Montgomery FH, eds. A Practical Treatise on Diseases of the Skin for the Use of Students and Practitioners. 1909 Philadelphia PA. Lea and Febiger, 174–175,
14. Ibanez, CF, Ernfors, P, Timmusk, T, Ip, NY, Arenas, E, Yancopoulos, GD, Persson, H: Neurotrophin-4 is a target-derived neurotrophic factor for neurons of the trigeminal ganglion. Development 1993 117, 1345–1353,  | PubMed | ISI | ChemPort |
15. Ip, NY, Ibanez, CF, Nye, SH, et al: Mammalian neurotrophin-4: structure, chromosomal localization, tissue distribution, and receptor specificity. Proc Natl Acad Sci USA 1992 89, 3060–3064,  | PubMed | ChemPort |
16. Kapp, A: Atopic dermatitis – the skin manifestation of atopy. Clin Exp Allergy 1995 25, 210–219,  | PubMed | ISI | ChemPort |
17. Leung, DYM, Rhodes, AR, Geha, RS, Schneider, L, Ring, J: Atopic dermatitis (atopic eczema). In: Fitzpatrick TB, Eisen AZ, Wolff K, Freedberg IM, Austen KF, eds. Dermatology in General Medicine. 1993 4th edn. New York: McGraw-Hill, 1543–1564,
18. Liebner & Kovacs, E Nervenvermehrungen bei Prurigo nodularis Hyde. Ungarische Dermatologische Gesellschaft 1936 53, 225,
19. Maisonpierre, PC, Belluscio, L, Squinto, S, Ip, NY, Furth, ME, Lindsay, RM, Yancopoulos, GD: Neurotrophin-3: a neurotrophic factor related to NGF and BDNF. Science 1990 247, 1446–1451,  | PubMed | ISI | ChemPort |
20. Ohmen, JD, Hanifin, JM, Nickoloff, BJ, et al: Overexpression of IL-10 in atopic dermatitis: contrasting cytokine patterns with delayed-type hypersensitivity reactions. J Immunol 1995 154, 1956–61,  | PubMed | ISI | ChemPort |
21. Pautrier, LM & Le néurome de la lichénification circonscrite nodulaire chronique. Ann Dermatol Syph. 5, 897–919, 1934
22. Pincelli, C, Fantini, A, Gianetti, A: Neuropeptides, nerve growth factor and the skin. Path Biol 1996 44, 856–859,  | ISI | ChemPort |
23. Pincelli, C, Sevignani, C, Manfredini, R, et al: Expression and function of nerve growth factor and nerve growth factor receptor on cultured keratinocytes. J Invest Dermatol 1994 103, 13–18,  | Article | PubMed | ISI | ChemPort |
24. Riddle, DR, Lo, DC, Katz, LC: NT-4-mediated rescue of lateral geniculate neurons from effects of monocular deprivation. Nature 1995 378, 189–191,  | Article | PubMed | ISI | ChemPort |
25. Rowland Payne, CME, Wilkinson, JD, McKee, PH, et al: Nodular prurigo - a clinicopathological study of 46 patients. Br J Dermatol 1985 113, 431–439,  | PubMed | ChemPort |
26. Sambrook, J, Fritsch, EF, Maniatis, T: Transfer of proteins from SDS polyacrylamide gels to solid supports: immunological detection of immobilized proteins (Western blotting). In: Sambrook J, Fritsch EF, Maniatis T, eds. Molecular Cloning 1989 2nd edn. Cold Spring Harbor Laboratory Press,
27. Shibayama, E & Koizumi, H: Cellular localization of the trk neurotrophin receptor family in human non-neuronal tissues. Am J Pathol 1996 148, 1807–1818,  | PubMed | ISI | ChemPort |
28. Tron, VA, Coughlin, MD, Jang, DE, Stanisz, J, Sauder, DN: Expression and modulation of nerve growth factor in murine keratinocytes (PAM 212). J Clin Invest 1990 85, 1085–1089,  | PubMed | ISI | ChemPort |
29. Vaalasti, A, Suomalainen, H, Rechardt, L: Calcitonin gene-related peptide immunoreactivity in prurigo nodularis: a comparative study with neurodermatitis circumscripta. Br J Dermatol 1989 120, 619–623,  | PubMed | ISI | ChemPort |
30. Yaar, M, Eller, MS, DiBenedetto, P, et al: The trk family of receptors mediates nerve growth factor and neurotrophin-3 effects in melanocytes. J Clin Invest 1994 94, 1550–1562,  | PubMed | ISI | ChemPort |
31. Yaar, M, Grossman, K, Eller, M, Gilchrest, BA: Evidence for nerve growth factor-mediated paracrine effects in human epidermis. J Cell Biol 1991 115, 821–828,  | Article | PubMed | ISI | ChemPort |
32. Zhou, X-F & Rush, RA: Peripheral projections of primary sensory neurons immuno-reactive for neurotrophin 3. J Comp Neurol 1995 363, 69–77,  | Article | PubMed | ISI | ChemPort |