Materials and Methods

Cell culture

Human dermal fibroblasts derived from a 2-mo-old child (GM05756A) were obtained from Coriell Cell Repositories (Camden, NJ) and propagated in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS). Human adult dermal fibroblasts were obtained from healthy volunteers, following institutional approval and informed consent. Primary explant cultures were established in 25 cm² culture flasks in DMEM supplemented with 10% FBS, 2 mM L-glutamine, and 50 g amphotericin per ml. Fibroblast cultures independently isolated from different individuals were maintained as monolayers at 37°C in 90% air, 10% CO₂, and were studied between the third and sixth subpassages. Drosophila Schneider line 2 (SL2) cells were propagated as previously described (^{Courey & Tjian 1988}).

Transient transfections and chloramphenicol acetyltransferase assays

Drosophila Schneider cells were plated in 100 mm dishes at a density of 10⁷ per dish in M3 medium supplemented with 10% FBS and 1 mM glutamine. The following day the cells were transfected using the calcium phosphate technique as previously described (^{Ihn et al. 1996}) with 10 g of various promoter–chloramphenicol acetyltransferase (CAT) constructs and various amounts of pPac0, pPacSp1 (^{Courey & Tjian 1988}), pPacSp3, and pPacUSp3 (kindly provided by G. Suske) expression plasmids. With pPacUSp3, only the long Sp3 protein is made in Drosophila cells due to the presence of ultrabithorax leader sequence at the 5' end (^{Ihn & Trojanowska 1997}). Human dermal fibroblasts were also transfected with 10 g of various promoter–CAT constructs and various amounts of CMV-Sp1, CMV-Sp3, and pRC/CMV expression plasmids (kindly provided by G. Suske) (^{Hagen et al. 1994}), as described above. Cells were incubated for 48 h, harvested in 0.25 M tri(hydroxymethyl)-aminomethane (Tris)–HCl, pH 8, and fractured by freeze thawing. Extracts were heated to 65°C for 5 min, and cell debris was pelleted for 10 min in a microfuge. Protein contents in supernatants were equalized using the Bio-Rad reagent and incubated with butyryl-coenzyme A and [¹⁴C]chloramphenicol for 90 min at 37°C. Butyrated chloramphenicol was extracted using an organic solvent (2:1 mixture of tetramethylpentadecane and xylene) and quantitated by scintillation counting. Each experiment was performed in duplicate.

Preparation of nuclear extract

Nuclear extracts were prepared as described previously (^{Andrews & Faller 1991;Ihn et al. 1996}). Briefly, confluent cells from five 150 mm dishes were washed with phosphate-buffered saline and scraped into 1 ml of cold buffer A (10 mM HEPES-KOH, pH 7.9, at 4°C, 1.5 mM MgCl₂, 10 mM KCl, 1 mM dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride, 1 mM sodium orthovanadate). The cells were allowed to swell on ice for 10 min and then vortexed for 10 s. After centrifugation for 3 min, the supernatant was discarded. The pellet was resuspended in 80 l of cold buffer C (20 mM HEPES-KOH, pH 7.9, 25% glycerol, 420 mM NaCl, 1.5 mM MgCl₂, 0.2 mM ethylenediamine tetraacetic acid (EDTA), 1 mM sodium orthovanadate) and incubated on ice for 20 min for high salt extraction. Cellular debris was removed by centrifugation for 2 min at 4°C and the supernatant fraction was stored at -80°C until used. The protein concentration of the extract was determined using the Bio-Rad reagent.

DNA mobility shift assays

DNA mobility shift assays were performed as described previously (^{Ihn et al. 1997}). Radioactive probes (132-mer) were generated by polymerase chain reaction using [-³²P]adenosine-5'-triphosphate (ATP) end-labeled by primers or direct end-labeling of oligonucleotide probes. The binding reaction was carried out for 30 min in 20 l of binding buffer containing 10,000 cpm of labeled probe, 2 g of poly(dI-dC)poly(dI-dC), and nuclear extracts containing 5 g of protein. Where indicated, specific synthetic oligonucleotides were included in the reaction mixture. Separation of free radiolabeled DNA from DNA–protein complexes was carried out on a 5% nondenaturing polyacrylamide gel in a 0.5 Tris borate electrophoresis buffer at 200 V at 4°C. Autoradiography was performed by overnight exposure to Kodak X-OMAT film with intensifying screens at -80°C. The densities of bands were measured using a phosphoimager scanner. The identities of the nuclear protein complexes were determined using polyclonal anti-Sp1, anti-Sp3, and anti-CBF-B antibodies (Santa Cruz) in DNA mobility shift assays as described previously (^{Ihn et al. 1996,1997;Collins et al. 1997;Ihn & Trojanowska 1997}). We determined the DNA binding affinities of Sp1 and Sp3 in DNA mobility shift analyses where binding to radiolabeled probes was competed for by increasing amounts of unlabeled synthetic oligonucleotides. The shifted band and free probe were excised from the gel separately, and radioactivity of bound and free probe were quantitated. Scatchard transformation of these data was performed (^{D'Angelo et al. 1996}).

In vitro transcription

In vitro transcription assays were carried out as described previously (^{Liang et al. 1996;Ihn & Trojanowska 1997}). The reaction mixture for in vitro transcription contained 50 g of nuclear extract, 1 g of template DNA (-772 COL1A2/CAT;^{Ihn et al. 1997}), 20 mM HEPES-KOH, pH 7.9, and 600 M each of ATP, guanosine triphosphate, cytidine triphosphate and UTP, in a final volume of 25 l. Where indicated, specific synthetic oligonucleotides were included in the reaction mixture. The NTPs were added only after all other ingredients had been preincubated for 15 min at 30°C, and then reactions were allowed to proceed for 1 h at 30°C. Reactions were terminated by adding 175 l of stop solution (0.3 M Tris–HCl, pH 7.4, 0.3 M sodium acetate, 0.5% sodium dodecyl sulfate, 2 mM EDTA, 3 g of tRNA per ml). To detect newly synthesized transcripts, antisense oligonucleotide primers corresponding to a sequence in the CAT gene were generated. These primers were end-labeled with T4 polynucleotide kinase and [-³²P]ATP, hybridized to in vitro transcription products, and extended using avian myeloblastosis virus reverse transcriptase as previously described (^{Liang et al. 1996}). The primer extended products were analyzed on 8% polyacrylamide/7 M urea gel. Gels were dried and autoradiographed at -80°C with an intensifying screen. The densities of bands were measured using a phosphoimager scanner.

Results

Functional analysis of the Sp1 and Sp3 contributions to the activity of the human 2(I) collagen promoter

Several functional cis-regulatory elements located within the bp -303 and -34 region in the human 2(I) collagen promoter have been characterized (^{Inagaki et al. 1994;Tamaki et al. 1995;Ihn et al. 1996}). We have shown that Sp1 and Sp3 bind to three of the previously characterized cis-elements in this promoter, including two positive cis-elements between bp -303 and -271 and between bp -128 and -123, and a repressor site between bp -164 and -159 (^{Ihn & Trojanowska 1997}). Furthermore, functional analyses of Sp1 and Sp3 in Drosophila cells indicate that each protein transactivates the human 2(I) collagen promoter with equal potency, and, when tested together, they have an additive effect on the promoter activity. To test the functional role of Sp1 and Sp3 in the regulation of the human 2(I) collagen promoter in human dermal fibroblasts, we first performed cotransfection assays of the human -353 bp 2(I) collagen promoter fragment linked to the CAT reporter gene (^{Ihn et al. 1996}) with Sp1 (CMV-Sp1) and Sp3 (CMV-Sp3) expression vectors (^{Hagen et al. 1994}). These expression vectors, in which corresponding cDNA clones are fused to the CMV promoter/enhancer, have been shown to express Sp1 or Sp3 in mammalian cells. For comparison, pSV2CAT promoter linked to the CAT reporter gene was also cotransfected with the CMV-Sp1 or the CMV-Sp3 expression vectors. Consistent with previous reports (^{Hagen et al. 1994;Hasegawa et al. 1997;Ihn & Trojanowska 1997}), the early SV40 promoter was exclusively activated by Sp1 but not by Sp3 in human dermal fibroblasts (Table 1). Neither CMV-Sp1 nor CMV-Sp3 activated or suppressed the human 2(I) collagen promoter in human dermal fibroblasts (Table 1). These results indicate that the Sp1 or Sp3 level was saturated for the human 2(I) collagen promoter in the system of human dermal fibroblasts.

Table 1 - Effects of Sp1 and Sp3 overexpression on human 2(I) collagen and early SV40 promoter activities in human dermal fibroblasts: response to increasing doses of Sp1 or Sp3 .

Full table

Next we utilized Drosophila Schneider line 2 (SL2) cells which express very low levels of endogenous Sp1-like activity and thus provide a convenient system to study transcriptional regulation by Sp family proteins (^{Courey & Tjian 1988;Hagen et al. 1994}). To determine whether binding of Sp1 or Sp3 to the repressor site has functional consequences and to further analyze the contribution of Sp1 and Sp3 to the constitutive activity of the collagen promoter mediated by the positive cis-response elements using SL2 cells, we cotransfected Sp1 or Sp3 (pPacSp1 or pPacUSp3) expression vectors with various deletion mutants of the human 2(I) collagen promoter (Figure 1). These expression vectors bearing Drosophila promoter were constructed to express Sp1 or Sp3 in Drosophila tissue culture cells (^{Courey & Tjian 1988;Hagen et al. 1994}). pPacUSp3 was used because this plasmid has been shown to express higher levels of the Sp3 than pPacSp3 (^{Ihn & Trojanowska 1997}). Compared with the -353–bp wild type promoter construct, the deletion of the GC boxes (-264 bp deletion mutant) resulted in about a 50% decrease of the promoter activity. The deletion of the repressor site (the TCCCCC motif, -148 bp deletion mutant) had no effect on the transactivation potency of Sp1 or Sp3. Further deletion of the TCCTCC motif virtually eliminated the stimulatory effects of Sp1 and Sp3. These results indicate that Sp1 and Sp3 activate the human 2(I) collagen promoter via two cis-regulatory elements, the GC boxes and the TCCTCC motif. The previous study had shown that there are no functional binding sites for Sp1 or Sp3 within the proximal 108 bp of this promoter. Binding of either Sp1 or Sp3 to the repressor site, however, does not activate or repress the collagen promoter activity in this system.

Figure 1.

Functional analysis of the Sp1- and Sp3-dependent cis-regulatory elements in the human 2(I) collagen promoter. Plasmids containing various lengths of the 2(I) collagen promoter sequence were cloned upstream from the CAT reporter gene (^{Ihn et al. 1997}). An aliquot of 10 g of each plasmid was used in transient cotransfection assays with 200 ng of either pPacSp1 or pPacUSp3 expression vector. The diagrams on the left show the deletion end points. The promoter activity of each deletion construct relative to the -353 promoter construct, which was arbitrarily set at 100%, is shown at the right. The level of activation obtained for each deletion construct by expression of Sp1 or Sp3 is also shown as a ratio. The mean SE values for four separate experiments are shown. Comparisons of promoter activities between each deletion construct and the wild type promoter construct were made. Asterisks indicate statistically significant results (p < 0.01, Mann–Whitney U test).

Full figure and legend (13K)

Competitive binding analysis of the human 2(I) collagen promoter using DNA mobility shift assays

To test the specificity and affinity of the binding of Sp1 or Sp3 in the cis-regulatory elements of the human 2(I) collagen promoter, we performed a competitive binding analysis using DNA mobility shift assays. Gel shift assays were performed with a collagen promoter fragment from bp -313 to -183 (which contains the three GC boxes) and nuclear extracts from human dermal fibroblasts in the absence or presence of increasing amounts of the GC boxes or the TCCCCC motif (the repressor site) unlabeled synthetic oligonucleotide. As shown in Figure 2, shifted bands were competed by both the GC boxes and the TCCCCC motif oligonucleotides, and the affinity of binding for the GC boxes was greater than that for the TCCCCC motif (K_d = 1.79 nM vs 3.61 nM for Sp1, 3.4 nM vs 5.5 nM for Sp3). Another study was performed with a collagen promoter fragment from bp -135 to -116 (which contains the TCCTCC site) and nuclear extracts in the absence or presence of increasing amounts of the TCCTCC motif or the TCCCCC motif (the repressor site) unlabeled synthetic oligonucleotide. As shown in Figure 3, shifted bands were competed for by both the TCCTCC motif and the TCCCCC motif oligonucleotides, and the affinity of the binding for the TCCTCC motif was shown to be much greater than that for the TCCCCC motif (K_d = 0.71 nM vs 3.61 nM for Sp1, 1.25 nM vs 5.5 nM for Sp3). A further analysis was performed using the -94 to -74 bp segment (which contains the CBF binding site) of the 2(I) collagen promoter in the absence or presence of increasing amounts of the unlabeled cold probe or the TCCCCC motif (repressor site) oligonucleotide (Figure 4). The specific DNA–protein complex which is formed by the CBF homolog (^{Ihn et al. 1996}) was abolished by the CBF binding site oligonucleotide but not by the TCCCCC motif oligonucleotide.

Figure 2.

Competitive binding analysis of the GC boxes using DNA mobility shift assays. Gel shift assays were performed with a collagen promoter fragment from bp -313 to -183 which contains the three GC boxes with no nuclear extract (lanes 1 and 11), or nuclear extracts (5 g) from human dermal fibroblasts in the absence (lanes 2 and 12) or presence of increasing amounts (10- to 80-fold molar excess) of the GC boxes (bp -313 to -183) (lanes 3–6), the TCCCCC motif (bp -176 to -153) (lanes 7–10), or the Sp1 consensus recognition sequence (ATTCGATCGGGG- CGGGGCGAGC) (lanes 13–16) unlabeled synthetic oligonucleotides.

Full figure and legend (166K)

Figure 3.

Competitive binding analysis of the TCCTCC motif using DNA mobility shift assays. Gel shift assays were performed with a collagen promoter fragment from bp -135 to -166 which contains the TCCTCC motif with no nuclear extract (lanes 1 and 11), or nuclear extracts (5 g) from human dermal fibroblasts in the absence (lanes 2 and 12) or presence of increasing amounts (10- to 80-fold molar excess) of the TCCTCC motif (bp -135 to -116) (lanes 3–6), the TCCCCC motif (bp -176 to -153) (lanes 7–10), or the Sp1 consensus recognition sequence (lanes 13–16) unlabeled synthetic oligonucleotides.

Full figure and legend (130K)

Figure 4.

Competitive binding analysis of the CBF binding site using DNA mobility shift assays. Gel shift assays were performed with a collagen promoter fragment from bp -94 to -74 which contains the CBF binding site with no nuclear extract (lane 1), or nuclear extracts (5 g) from human dermal fibroblasts in the absence (lane 2) or presence of increasing amounts (10- to 80-fold molar excess) of the CBF binding site (bp -94 to -74) (lanes 3–6) or the TCCCCC motif (bp -176 to -153) (lanes 7–10) unlabeled synthetic oligonucleotides.

Full figure and legend (238K)

These results are consistent with our previous data. The previous study suggested that a repressor which binds to the TCCCCC motif interferes with the activation of the promoter via the GC boxes and the TCCTCC motif elements, but activation by the third positive response element that binds CBF seems to be unaffected by this repressor (^{Ihn et al. 1996}).

Comparison of the affinity of the binding between collagen promoter fragment and Sp1 consensus oligonucleotide

Other competitive binding analyses using DNA mobility shift assays were performed. Gel shift assays were again performed with promoter fragments from -313 to -183, from -176 to -153, or from -135 to -116 bp in the absence or presence of increasing amounts of the Sp1 consensus recognition sequence oligo- nucleotide. As shown in Figure 2, Figure 3, and Figure 5, the affinity of Sp1 or Sp3 for the Sp1 consensus recognition sequence oligonucleotide (K_d = 0.8 nM for Sp1, 3.17 nM for Sp3) was greater than that for the GC boxes (K_d = 1.79 nM for Sp1, 3.4 nM for Sp3) or the TCCCCC motif (K_d = 3.61 nM for Sp1, 5.5 nM for Sp3). Interestingly, the affinity of Sp1 or Sp3 was greater for the TCCTCC motif (K_d = 0.71 nM for Sp1, 1.25 nM for Sp3) than for the Sp1 consensus recognition sequence oligonucleotide (K_d = 0.8 nM for Sp1, 3.17 nM for Sp3) (Figure 3).

Figure 5.

Competitive binding analysis of the TCCCCC motif using DNA mobility shift assays. Gel shift assays were performed with a collagen promoter fragment from bp -176 to -153 which contains the TCCCCC motif with no nuclear extract (lane 1), or nuclear extracts (5 g) from human dermal fibroblasts in the absence (lane 2) or presence of increasing amounts (10- to 80-fold molar excess) of the TCCCCC motif (bp -176 to -153) (lanes 3–6) or the Sp1 consensus recognition sequence (lanes 7–10) unlabeled synthetic oligonucleotides.

Full figure and legend (178K)

Effect of oligonucleotide competition on in vitro transcrip- tion of the human 2(I) collagen promoter

Competitive binding analyses using DNA mobility shift assays suggested that the bindings of Sp1 and Sp3 to the GC box or the TCCTCC motif were abolished by the repressor site. Together with previous results, this indicates that the repressor site acts as a ''molecular sink'' to take away Sp1 or Sp3 from the activator sites. To test this point, in vitro transcription of the collagen promoter was studied in the absence or presence of various collagen promoter segments. As shown in Figure 6, the addition of each activator site oligonucleotide had an inhibitory effect (40%-60%). Furthermore, the addition of the repressor site oligonucleotide had a similar inhibitory effect (50% inhibition). These results strongly suggest that the repressor site regulates the transcription of the collagen gene by taking away Sp1 or Sp3 from activator sites.

Figure 6.

Effect of oligonucleotide competition on in vitro transcription of the human 2(I) collagen promoter. In vitro transcription was done in the absence (lanes 1 and 2) or presence of 0.7 pmol of unlabeled synthetic oligonucleotide using human dermal fibroblast nuclear extract as described in Materials and methods. The synthetic oligonucleotides used are the TCCCCC motif (lane 3), the CBF binding site (lane 4), the GC boxes (lane 5), the TCCTCC motif (lane 6) or Oct-1 consensus recognition sequence (TGTCGAATGCAAATCACTACAA) (lane 7). An arrow indicates the position of the primer-extension product (97 nucleotides) representing the in vitro transcription product initiated from the COL1A2 CAT promoter template. Lane 2 contains no nuclear extract.

Full figure and legend (26K)

Discussion

Previous studies demonstrated that Sp1 and Sp3 proteins interact with three previously characterized response elements within the -323 to -34 bp region of the human 2(I) collagen promoter (^{Inagaki et al. 1994;Tamaki et al. 1995;Ihn & Trojanowska 1997;Ihn et al. 1997}). These include the GC-rich region between bp -303 and -271, the TCCCCC motif between bp -164 and -159, and the TCCTCC motif between bp -128 and -123. Furthermore, our previous results suggested that the TCCCCC motif interferes with the activation of the promoter via the GC-rich region or the TCCTCC motif, but activation by the CCAAT motif seemed to be unaffected by this repressor (^{Ihn et al. 1996}). How the binding of Sp1 or Sp3 to the repressor site (the TCCCCC motif) interferes with the function of the activator sites has not been clarified.

Three mechanisms of transcription repression have been reported (^{Johnson 1995}): (i) repressors bind DNA and thereby exclude gene activator proteins from binding to an overlapping DNA site (^{Small et al. 1991;MacDonald et al. 1995}); (ii) repressors bind DNA near a DNA-bound activator and ''mask'' or ''quench'' its activating surface, thereby preventing it from stimulating the general transcription machinery (^{Diamond et al. 1990;Gray et al. 1994}); (iii) repressors bind DNA and interact with the general transcription machinery itself, preventing it from reaching a transcriptionally competent state (^{Liao et al. 1995}).

In this study, functional analyses of Sp1 and Sp3 in Drosophila SL cells confirmed that either protein can transactivate the human 2(I) collagen promoter (Figure 1). Furthermore, deletion analyses of the human 2(I) collagen promoter corroborate the previous results (^{Ihn et al. 1996;Ihn & Trojanowska 1997}) that Sp1 and Sp3 activate the human 2(I) collagen promoter via the GC boxes and the TCCTCC motif, but that binding of Sp1 or Sp3 to the repressor site (TCCCCC motif) does not activate or repress the collagen promoter activity (Figure 1). This result suggests that Sp1 or Sp3 does not play an active role in repressing transcription when binding to the repressor site. DNA mobility shift assays showed that the TCCCCC motif (the repressor site) oligonucleotide interferes with the binding of Sp1 and Sp3 to the GC boxes and the TCCTCC motif, but not the binding of CBF homolog to the CCAAT motif. Furthermore, in vitro transcription of the collagen promoter showed that the addition of the repressor site oligonucleotide as well as the addition of each activator site oligonucleotide had an inhibitory effect on the levels of in vitro transcription (Figure 6). These results suggest that the repressor site inhibits the transcription of the 2(I) collagen gene by interfering with the binding of Sp1 and Sp3 to the GC boxes and the TCCTCC motif.

At present, the nature of the additional binding protein interacting with the repressor site (the complex 2) is unknown. The complex 2 interacting TCCCCC motif may be either cKrox or BFCOL1, both of which have been characterized as binding factors interacting with the corresponding cis-regulatory element in the mouse 2(I) collagen promoter (^{Galera et al. 1994;Hasegawa et al. 1997}). The transcription factors c-Krox and BFCOL1 have been shown to transactivate murine 1(I) and 2(I) collagen promoters via several binding sites but how the binding of these proteins to the repressor site interferes with collagen promoter activity has not been clarified. Further studies with the human collagen promoter are required to clarify this point.

This study first demonstrated the affinity of the binding of Sp1 and Sp3 to these regions in the human 2(I) collagen promoter. Competitive binding analysis of the human 2(I) collagen promoter using DNA mobility shift assays showed that the affinity of Sp1 or Sp3 for the Sp1 consensus oligonucleotide was greater than that for the GC boxes or the TCCCCC motif. The affinity of Sp1 or Sp3 was greater for the TCCTCC motif, however, than for the Sp1 consensus oligonucleotide. This result suggests that a novel cis-element containing a TCCTCC motif has the highest affinity among these cis-elements. In vitro transcription analysis showed that the addition of each activator site oligonucleotide (GC boxes, TCCTCC motif, and CCAAT motif) had a similar inhibitory effect (40%-60%). This result demonstrates that each activator site can independently support 2(I) collagen transcription in human dermal fibroblasts.

In conclusion, this study showed that a novel cis-acting element containing a TCCTCC motif has the highest affinity for binding Sp1 and Sp3 among proximal collagen promoters and suggested that the repressor site (TCCTCC motif) inhibits the transcription of 2(I) collagen gene by interfering with the binding of Sp1 and Sp3 to the GC boxes and the TCCTCC motif.

References

1. Andrews, NC & Faller, DV: A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res, 1991 19, 2499,  | Article | PubMed | ISI | ChemPort |
2. Boast, S, Su, M-W, Ramirez, F, Sanchez, M, Avvedimento, EV: Functional analysis of cis-acting DNA sequences controlling transcription of the human type I collagen genes. J Biol Chem, 1990 265, 13351–13356,  | PubMed | ISI | ChemPort |
3. Bornstein, P & Sage, H: Structurally distinct collagen types. Annu Rev Biochem, 1980 49, 957–1003,  | Article | PubMed | ISI | ChemPort |
4. Chang, E & Goldberg, H: Requirements for transforming growth factor-beta regulation of the pro-alpha 2 (I) collagen and plasminogen activator inhibitor-1 promoters. J Biol Chem, 1995 270, 4473–4477,  | Article | PubMed | ISI | ChemPort |
5. Chung, KY, Agarwal, A, Uitto, J, Mauviel, A: An Ap-1 binding sequence is essential for regulation of the human 2 (I) collagen promoter activity by transforming growth factor-. J Biol Chem, 1996 271, 3272–3278,  | Article | PubMed | ISI | ChemPort |
6. Collins, M, Leaner, VD, Madikizela, M, Parker, MI: Regulation of the human 2 (I) procollagen gene by sequences adjacent to the CCAAT box. Biochem J, 1997 322, 199–206,  | PubMed | ISI | ChemPort |
7. Courey, AJ & Tjian, R: Analysis of Sp1 in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif. Cell, 1988 55, 887–898,  | Article | PubMed | ISI | ChemPort |
8. Coustry, F, Maity, SN, de Crombrugghe, B: Studies on transcription activation by the multimeric CCAAT-binding factor CBF. J Biol Chem, 1995 270, 468–475,  | PubMed | ISI | ChemPort |
9. D'angelo, DD, Oliver, BG, Davis, MG, McCluskey, TS, Dorn, GW: Novel role for Sp1 in phorbol ester enhancement of human platelet thromboxane receptor gene expression. J Biol Chem, 1996 271, 19696–19704,  | PubMed | ChemPort |
10. Diamond, MI, Miner, JN, Yoshinaga, SK, Yamamoto, KR: Transcription factor interactions: selectors of positive or negative regulation from a single DNA element. Science, 1990 249, 1266–1272,  | Article | PubMed | ISI | ChemPort |
11. Galera, P, Musso, M, Ducy, P, Karsenty, G: c-Krox, a transcriptional regulator of type I collagen gene expression, is preferentially expressed in skin. Proc Natl Acad Sci USA, 1994 91, 9372–9376,  | Article | PubMed | ChemPort |
12. Gray, S, Szymanski, P, Levine, M: Short-range repression permits multiple enhancers to function autonomously within a complex promoter. Genes Dev, 1994 8, 1829–1838,  | PubMed | ISI | ChemPort |
13. Hagen, G, Muller, S, Beato, M, Suske, G: Sp1-mediated transcriptional activation is repressed by Sp3. EMBO J, 1994 13, 3843–3851,  | PubMed | ISI | ChemPort |
14. Hasegawa, T, Takeuchi, A, Miyaishi, O, Isobe, K, de Crombrugghe, B: Cloning and characterization of a transcription factor that binds to the proximal promoters of the two mouse type I collagen genes. J Biol Chem, 1997 272, 4915–4923,  | Article | PubMed | ISI | ChemPort |
15. Ihn, H, LeRoy, EC, Trojanowska, M: Oncostatin M stimulates transcription of the human 2 (I) collagen gene via the Sp1/Sp3-binding site. J Biol Chem, 1997 272, 24666–24672,  | Article | PubMed | ISI | ChemPort |
16. Ihn, H, Ohnishi, K, Tamaki, T, LeRoy, EC, Trojanowska, M: Transcriptional regulation of the human 2 (I) collagen gene: combined action of upstream stimulatory and inhibitory cis-acting elements. J Biol Chem, 1996 271, 26717–26723,  | Article | PubMed | ISI | ChemPort |
17. Ihn, H & Trojanowska, M: Sp3 is a transcriptional activator of the human 2 (I) collagen gene. Nucleic Acids Res, 1997 25, 3712–3717,  | Article | PubMed | ISI | ChemPort |
18. Inagaki, Y, Truter, S, Ramirez, F: Transforming growth factor- stimulates 2 (I) collagen gene expression through a cis-acting element that contains an Sp1-binding site. J Biol Chem, 1994 269, 14828–14834,  | PubMed | ISI | ChemPort |
19. Inagaki, Y, Truter, S, Tanaka, S, DiLiberto, M, Ramirez, F: Overlapping pathways mediate the opposing actions of tumor necrosis factor- and transforming growth factor- on 2 (I) collagen gene transcription. J Biol Chem, 1995 269, 3353–3358,
20. Johnson, AD: The price of repression. Cell, 1995 81, 655–658,  | Article | PubMed | ISI | ChemPort |
21. Karsenty, G & de Crombrugghe, B: Conservation of binding sites for regulatory factors in the coordinately expressed 1 (I) and 2 (I) collagen promoters. Biochem Biophys Res Commun, 1991 177, 538–544,  | Article | PubMed | ISI | ChemPort |
22. Karsenty, G & de Crombrugghe, B: Two different negative and one positive regulatory factors interact with a short promoter segment of the 2 (I) collagen gene. J Biol Chem, 1990 265, 9934–9942,  | PubMed | ISI | ChemPort |
23. Karsenty, G, Golumbek, P, de Crombrugghe, B: Point mutations and small substitution mutations in three different upstream elements inhibit the activity of the mouse 2 (I) collagen promoter. J Biol Chem, 1988 263, 13909–13915,  | PubMed | ISI | ChemPort |
24. Liang, Y, Robinson, DF, Denning, J, Suske, G & Fahl We: Transcriptional regulation of the SIS/PDGF-B gene in human osteosarcoma cells by the Sp family of transcription factors. J Biol Chem, 1996 271, 11792–11797,  | Article | PubMed | ISI | ChemPort |
25. Liao, SM, Zhang, J, Jeffery, DA: et al. A kinase-cyclin pair in the RNA polymerase II holoenzyme. Nature, 1995 374, 193–196,  | Article | PubMed | ISI | ChemPort |
26. MacDonald, GH, Itoh-Lindstrom, Y, Ting, JP: The transcriptional regulatory protein, YB-1, promotes single-strand regions in the DRA promoter. J Biol Chem, 1995 270, 3527–3533,  | PubMed | ISI | ChemPort |
27. Maity, SN, Golumbek, PT, Karsenty, G, de Crombrugghe, B: Selective activation of transcription by a novel CCAAT binding factor. Science, 1988 241, 582–585,  | PubMed | ISI | ChemPort |
28. Ramirez, F & DiLiberto, M: Complex and diversified regulatory programs control the expression of vertebrate collagen genes. FASEB J, 1990 4, 16116–16123,
29. Rossi, P, Karsenty, G, Roberts, AB, Roche, NS, Sporn, MB, de Crombrugghe, B: A nuclear factor I binding site mediates the transcriptional activation of a type I collagen promoter by transforming growth factor-. Cell, 1988 52, 405–415,  | Article | PubMed | ISI | ChemPort |
30. Small, S, Kraut, R, Hoey, T, Warrior, R, Levine, M: Transcriptional regulation of a pair-rule stripe in Drosophila. Genes Dev, 1991 5, 827–839,  | PubMed | ISI | ChemPort |
31. Tamaki, T, Ohnishi, K, Hartl, C, LeRoy, EC, Trojanowska, M: Characterization of a GC-rich region containing Sp1 binding site (s) as a constitutive responsive element of the 2 (I) collagen gene in human fibroblasts. J Biol Chem, 1995 270, 4299–4304,  | PubMed | ISI | ChemPort |
32. Vuorio, E & de Crombrugghe, B: The family of collagen genes. Annu Rev Biochem, 1990 59, 832–837,

Acknowledgments

This work was supported by a grant for scientific research from the Ministry of Education, Japan (10770391), and by the Lydia O'Learly Memorial Foundation, Japan.