Regular Article

Journal of Investigative Dermatology (2000) 114, 998–1004; doi:10.1046/j.1523-1747.2000.00893.x

IgG Autoantibodies from Bullous Pemphigoid Patients Recognize Multiple Antigenic Reactive Sites Located Predominantly Within the B and C Subdomains of the COOH-Terminus of BP230

Mouna Skaria, Fabienne Jaunin, Thomas Hunziker*, Sara Riou, Hauke Schumann†, Leena Bruckner-Tuderman†, Michael Hertl‡, Philippe Bernard§, Jean-Hilaire Saurat, Bertrand Favre and Luca Borradori

  1. Department of Dermatology, DHURDV, University Hospital, Geneva, Switzerland
  2. *Department of Dermatology, University Hospital, Berne, Switzerland
  3. †Department of Dermatology, University of Münster, Münster, Germany
  4. ‡Department of Dermatology, University Hospital, Erlangen, Germany
  5. §Department of Dermatology, University of Reims, France

Correspondence: Dr Luca Borradori, Clinique de Dermatologie, Hôpital Cantonal Universitaire, Rue Micheli du Crest 26, CH-1211 Genève, Switzerland. Email: Luca.Borradori@hcuge.ch

Received 20 September 1999; Revised 23 November 1999; Accepted 25 November 1999.

Top

Abstract

Bullous pemphigoid is a subepidermal bullous disorder characterized by an autoantibody response against the bullous pemphigoid antigen 230 (BP230) and the bullous pemphigoid antigen 180 (BP180), a cytoplasmic component and a transmembrane component, respectively, of hemidesmosomes. Although immunodominant sequences within the extracellular domain of BP180 have been identified, characterization of the antigenic sites on BP230 is still incomplete. To identify autoantibody-reactive sites on BP230 and to examine whether the targeted regions are contained within functionally important domains, recombinant fragments encompassing almost the entire BP230 were used to assess the reactivity of 25 bullous pemphigoid sera by immunoblotting. Our results demonstrate that (i) the region bearing the B and C subdomains of the COOH-terminus of BP230 contains immunodominant sequences recognized by the majority of bullous pemphigoid sera; (ii) additional autoantibody- reactive sites are present over extended regions of the NH2-terminal half of BP230 without evidence for antigenic cross-reactivity between the NH2- and COOH-termini of BP230; and, finally, (iii) autoantibodies reacting with the BP230 tail predominantly belong to the IgG4 and IgG1 subclasses, suggesting that both autoreactive TH2 and autoreactive TH1 cells regulate the autoantibody response to immunodominant sequences of BP230. As the COOH- terminus of BP230 mediates the attachment of keratin intermediate filaments to the hemidesmosomal plaque, whereas its NH2-terminus contains sequences important for its interaction with other constituents of hemidesmosomes, autoantibodies to BP230 might precipitate subepidermal blister formation and perpetuate the disease not only by eliciting an inflammatory reaction but also by interfering with the function of BP230 and thus the stability of hemidesmosomes.

Keywords:

antigenic site, autoimmunity, BP180, BP230, bullous pemphigoid, epitope

Abbreviations:

BP, bullous pemphigoid; BP180, bullous pemphigoid antigen 180; BP230, bullous pemphigoid antigen 230; ECD, extracellular domain; HD, hemidesmosomes

Bullous pemphigoid (BP) is an autoimmune subepidermal blistering disease usually affecting the elderly (Lever & Pemphigus. 1953). A hallmark of this disorder is the presence of autoantibodies targeting the bullous pemphigoid antigen 180 (BP180, also termed bullous pemphigoid antigen 2, or type XVII collagen) and the bullous pemphigoid antigen 230 (BP230, or bullous pemphigoid antigen 1) (Stanley et al. 1981,1984;Labib et al. 1986;Mueller et al. 1989), two components of hemidesmosomes (HD). HD are multiprotein junctional complexes that promote adhesion of epithelial cells to the underlying basement membrane in stratified and other complex epithelia, such as skin and mucous membranes (Green & Jones 1996;Borradori & Sonnenberg 1999).

BP180 is a type II transmembrane molecule with a collagenous extracellular domain (ECD) serving as cell-surface receptor (Giudice et al. 1991; 1992;Hopkinson et al. 1992;Li et al. 1993). This idea is supported by the observation that mutations in the BP180 gene cause generalized atrophic benign epidermolysis bullosa, an inherited skin blistering disorder characterized by impaired dermo-epidermal cohesion (Jonkman et al. 1995;McGrath et al. 1995). Recent studies have identified sequences of BP180 important for its interaction with the alpha6beta4 integrin (Hopkinson et al. 1995;Borradori et al. 1997;Aho & Uitto 1998;Schaapveld et al. 1998), the other transmembrane component of HD, and BP230 (Borradori et al. 1998).1, 2 BP230, a cytoplasmic component belonging to the plakin family of proteins (Stanley et al. 1988;Sawamura et al. 1991;Green et al. 1992;Ruhrberg & Watt 1997), is predicted to have a central coiled-coil region flanked by two globular end domains with several distinct subregions (Green et al. 1992;Ruhrberg & Watt 1997) (Figure 1). The COOH-terminal domain of BP230 associates with keratin intermediate filaments (Yang et al. 1996), whereas its NH2-terminus might interact, in addition to BP180, with the beta4 subunit of the alpha6beta4 integrin1 (Koster J. and Favre B., unpublished results).

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Schematic representation of wild-type and mutant forms of BP230. For wild-type BP230, the various subdomains represented in white for the NH2-terminus, in gray for the coiled-coil domain, and in dotted boxes for the COOH-terminus are based on the predicted secondary structure (Green et al. 1992). The clones for recombinants A to E have been tagged at their 5' end with c-myc, whereas recombinants F and G are fused to the COOH-terminus of the green fluorescent protein (GFP). The amino acid range of the segment of BP230 that is covered by the recombinant is indicated. The protein sequence of BP230 is numbered according toSawamura et al. (1991).

Full figure and legend (17K)

Immunoblot and immunoprecipitation studies have shown that almost all BP sera exhibit reactivity to BP230, and up to 60% to BP180 (Stanley et al. 1981;Labib et al. 1986;Bernard et al. 1989;Mueller et al. 1989). Although the majority of BP sera recognize immunodominant sequences located within the extracellular NC16A domain close to the transmembrane region, additional antigenic sites exist on both the ECD and the intracellular domain of BP180 (Giudice et al. 1993,1994;Balding et al. 1996;Matsumura et al. 1996;Zillikens et al. 1997;Perriard et al. 1999). In contrast, the characterization of the autoantibody response to BP230 is poor. Initial studies have demonstrated significant reactivity against the COOH-terminal region of BP230. Nevertheless, these studies (i) have been limited by the use of either bacterial fusion proteins and synthetic peptides covering small portions of BP230 or by cDNAs encoding for murine BP230, and (ii) did not allow any conclusions to be drawn about the exact distribution of the major autoantibody-reactive sites on the entire autoantigen (Rico et al. 1990; 1996;Tanaka et al. 1991;Miller et al. 1993;Gaucherand et al. 1995;Ide et al. 1995).

Recently, it has been shown that rabbit antibodies raised against the murine BP180 ECD induce a blistering disorder mimicking BP (Liu et al. 1993,1995) when passively transferred to neonatal mice. In contrast, autoantibodies against BP230 cause an inflammatory reaction in rabbits only after additional injury to their epidermis (Hall et al. 1993). These observations have led to the speculation that antibodies against the ECD of BP180 are pathogenetically critical, whereas the appearance of antibodies against intracellular antigenic determinants on BP230 (and on the intracellular domain of BP180) represents a secondary event. Even if this model is confirmed by experimental data, the presence of autoantibodies to BP230 may still be important for the perpetuation of the disease following membrane damage by either eliciting an inflammatory reaction and/or inhibiting the function of BP230.

To extend our understanding of the pathophysiology of BP, we examined more rigorously whether BP autoantibodies target functionally important regions of BP230 and determined their IgG subclass distribution. The reactivity of BP patients' sera was assessed by immunoblotting using a series of novel recombinants covering almost the entire BP230 that were expressed either by an in vitro translation system or by using extracts of transfected COS-7 cells.

Top

Materials and Methods

Human sera

Serum samples were obtained from adult patients with BP (n = 25), pemphigus vulgaris (n = 6), and healthy volunteers (n = 12). The clinical diagnosis of BP was confirmed by histology, direct immunofluorescence microscopy (deposits of IgG and/or C3 in epidermal basement membrane), and indirect immunofluorescence microscopy (autoantibodies binding to the epidermal side of 1 M NaCl-separated normal human skin at titers of 1:20 or more) (Gammon et al. 1984). The serum samples from BP patients were selected for the study on the basis of their reactivity with BP230 by immunoblotting of keratinocyte extracts (Bernard et al. 1989). In addition, 10 of these BP sera also contained antibodies targeting BP180 (sera uniformly diluted at 1:20).

Antibodies

The following antibodies were used: the monoclonal antibody (MoAb) MYC 1–9E10.2 against a defined c-myc epitope (Evan et al. 1985); a rabbit antiserum raised against a BP230 recombinant encompassing residues 1722–2114 of BP230 between the coiled-coil and the B subdomain (kindly provided by Dr. J. R. Stanley, University of Pennsylvania, Philadelphia) (Tanaka et al. 1990); the human MoAb 5E binding to the linker region between the B and C subdomains of the BP230 tail (generously given by Dr. T. Hashimoto, Keyo University School of Medicine, Tokyo) (Hashimoto et al. 1993); the anti-GFP polyclonal antibody (Clontech Laboratories, Palo Alto, CA). The MoAb against IgG subclasses included clone NL6 for IgG1 (IUIS/WHO code HP6012; working dilution 1:200), clone GOM 1 for IgG2 (HP6008; dilution 1:200), clone ZG4 for IgG3 (HP6010; dilution 1:1000), and clone RJ4 for IgG4 (HP6011; 1:1000) (Oxoid, Basel, Switzerland). These MoAb were chosen on the basis of their specificities, extensively evaluated in previous analyses (Jefferis et al. 1985). In addition, these MoAb had been used in previous studies to examine the IgG subclass distribution in the BP group of disorders (Bird et al. 1986;Kelly et al. 1989;Bernard et al. 1989). The sensitivity of the MoAb at their working dilutions was pretested in immunoblotting experiments using IgG1-4 purified from myeloma proteins.

cDNA constructs

The human BP230 nucleotide and protein sequences are numbered according to the published sequence of human BP230 (GenBank accession number M69225) and toSawamura et al. (1991), respectively. For cloning procedures, the cDNA constructs DN86and DN157(Stanley et al. 1988;Elgart & Stanley 1993) as well as pcBPA-10 and pcBPA-4 (Sawamura et al. 1991), which were isolated in a lambdagt11 library screen, were used. To generate clone A, pcBPA-10 was utilized as a template in polymerase chain reaction (PCR) with recombinant PfuTurbo DNA polymerase (Stratagene, La Jolla, CA) using a 5' primer that contained a Not I, Sal I, and a Sma I site (underlined), and the nucleotides corresponding to sequences 39–61 of BP230including the endogenous initiation starting codon (GCCGGCGGCCGCAGGTCGACCCGGG-ATGCACAGTAGTAGTTATAGTTA), whereas the 3' end primer contained a Not I site, a stop codon (bold), and nucleotides corresponding to sequences 1682–1703 of BP230(CGATGCGGCCGC-TTAATTCCTTGGCTTCAGTTGAATT). The generated fragment was digested with Not I and cloned in frame into a Not I-opened modified pcDNA 3 vector (Invitrogen, San Diego, CA), which at the 5' end of its multiple cloning site contained a sequence encoding the c-myc epitope (MEQKLISQQDL) (kindly provided by Dr. E. Sander, The Netherlands Cancer Institute, Amsterdam). Clone B was derived from DN157, a clone spanning nucleotides 2023–3960 of BP230. DN157was used as a template in PCR using a 5' primer that contained a Not I and the nucleotides corresponding to sequence 2024–2047 of BP230(GCCGGCGGCCGC-AATTCGAGCTAGCAATGTGGCTTC), whereas the 3' end primer contained a Not I site, a stop codon (bold), and nucleotides corresponding to sequences 3894–3917 of BP230(CGATGCGGCCGCTTACTGCTT TATCAGC TTCAAGAGTTC). After Not I-digestion the PCR fragment was cloned in frame into the Not I-opened modified pcDNA3 vector. For generation of cDNA clones C and D, a first cDNA fragment was isolated by digestion with EcoR I from clone DN86(positions 4813 and 6645 of BP230) (Stanley et al. 1988;Elgart & Stanley 1993), and a second cDNA fragment was obtained by digestion of pcBPA-4 (Sawamura et al. 1991) using EcoRI (position 6645) and Sac II (position 8921). The two isolated cDNA fragments were then ligated in frame in the eukaryotic expression vector pGFP-C3 (Clontech Laboratories). For construction of clone C, the novel pGFP-C3 plasmid was cut with Ecl 136 II and EcoR V (cutting in the 5' end of the multiple cloning site of pGFP-C3 and at 8060 of BP230, respectively). The Ecl 136 II-EcoR V fragment was then implanted in frame into the blunt-ended Not I site of the modified pcDNA3 plasmid. As clone DN86contained a 2 bp deletion (position 5713–5714) resulting in a premature termination codon after four additional residues, the correct coding sequence encompassed nucleotides 4813–5711. For generation of clone D, the pGFP-C3 plasmid was digested with Xho I and Apa I (cutting at 5874 of BP230and in the 3' end region of the multiple cloning site of the vector, respectively). The Xho I-Apa I fragment was then cloned in frame into the Xho I and Apa I sites of the modified pcDNA 3 vector. For generation of clone E, construct pcBPA-4 was first digested with EcoR 1 (position 6645) and EcoR V (position 8060). The purified EcoR I and EcoR V fragment from this clone was then implanted in frame in the EcoR I and EcoR V sites of the modified pcDNA3 vector. Clone F was generated by ligating the BP230fragment from BsaB I (at 6265) to BsrF I (at 7345), blunt-ended with PfuTurbo DNA polymerase (Stratagene), into pEGFP-C3 (Clontech Laboratories) cut with Sma I. This plasmid was then digested with Bgl II, the overhangs filled in with PfuTurbo DNA polymerase (Stratagene), and religated together to put the BP230protein sequence in frame with the GFP. Clone G was prepared by inserting the BP230fragment from Mun I (at 7270) to EcoRI (at 8930) into pEGFP-C3 digested with EcoR I. The correctness of the cloning sites and of the sequences corresponding to the used primers was verified by sequence analysis. cDNAs encoding the ECD (residues 490–1497) and the intracellular domain (residues 1–466) of BP180have been described previously (Borradori et al. 1997;Perriard et al. 1999).

In vitro translation

BP230 mutants were produced by an in vitro transcription and translation system according to the manufacturer's advice (TNT T7 Coupled Reticulocyte Lysate System, Promega, Madison, WI). Each reaction tube contained rabbit reticulocyte lysate, TNT T7 RNA polymerase, RNasin ribonuclease inhibitor, a 20 muM amino acid mixture, and 0.5 mug of plasmid in a final volume of 50 mul. For radioactive control reaction, an amino acid mixture minus methionine with 40 muCi of [35S]methionine was used. After incubation at 30°C for 90 min, the translation reaction was mixed with a sodium dodecyl sulfate (SDS) sample buffer and heated at 100°C for 3 min before use.

Transfection experiments

The African monkey kidney cell line COS-7, which does not express endogenous BP230 and BP180 (Borradori et al. 1997), was transfected using the DEAE-dextran method as previously described (Cullen 1987). Gene expression was assayed after 48 h. Cells were lyzed with 1% SDS in 25 mM Tris(hydroxymethyl)-aminomethane (Tris) HCl, pH 7.5, 4 mM ethylenediamine tetraacetic acid, 100 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 10 mug leupeptin per ml, and 10 mug soybean trypsin inhibitor per ml. Protein concentration in the cell lysates was determined using the DC Protein assay (Biorad, Glattbrugg, Switzerland).

Western blot analysis

Ten microliters of the denatured translation reaction or 50–100 mug of extracts of transfected COS-7 cells were subsequently loaded per well on a 5% or 7.5% SDS-polyacrylamide gel, separated, and electrophoretically transferred to nitrocellulose sheets (Sonnenberg et al. 1993). The nitrocellulose paper was cut into strips and incubated with a 1:20 dilution of each tested serum in Tris-buffered saline-0.5% Nonidet P40 for 2 h at room temperature. After washing in Tris-buffered saline-0.5% Nonidet P40, the strips were then incubated with peroxidase-conjugated goat antihuman IgG (H + L) antibody (Institut Pasteur, Marnes la Coquette, France), goat antimouse Ig (Amersham Life Sciences, Zürich, Switzerland), or goat antirabbit IgG Fab' fragment (Cappel, Durham, NC). For IgG subclass determination, the strips were incubated for 1.5 h in an intermediate step with the various IgG-subclass-specific MoAb diluted (see above) in washing buffer. After washing, the strips were developed with 3,3'-diamino-benzidine-4 HCl (0.5 mg per ml) in 100 mM Tris-HCl, pH 7.4, containing 0.01% H2O2.

Top

Results and Discussion

Generation of recombinant fragments of BP230 for epitope mapping

Previous studies have only provided a suggestion that the autoantibody reactivity to BP230 is restricted to its COOH-terminal domain, as large regions within both the NH2-terminal and the central coiled-coil regions of BP230 were not systematically assayed. To more rigorously identify antigenic sites on BP230, we generated cDNA constructs for BP230 that were used for the production of recombinant fragments encompassing almost the entire 2649-amino acid autoantigen with an in vitro translation system (Figure 1). This approach was chosen as (i) the expression of BP230 recombinants using various cell lines has proved to be difficult, most probably due to an instability of the proteins (Yang et al. 1996; personal observations); and (ii) it allowed the harsh and time-consuming extraction procedure for purifying (large) bacterial BP230 recombinants to be avoided (Tanaka et al. 1990,1991).

Circulating IgG from BP patients predominantly bind to the COOH-terminal region of BP230

The reactivity of 25 BP sera was assessed against the generated BP230 recombinant fragments by immunoblotting analyses. The results demonstrate that BP autoantibodies recognize multiple antigenic sites located not only on the COOH-terminus but also within the central coiled-coil and NH2-terminal region of BP230 (Table 1). In extension to previous studies (Tanaka et al. 1991;Miller et al. 1993;Gaucherand et al. 1995;Ide et al. 1995), our findings demonstrate that the major autoantibody-reactive sites are indeed contained within the COOH-terminal region of BP230, at least as assessed under the denaturing conditions of the immunoblot technique. Twenty-one (84%) and 16 of 25 (64%) BP sera reacted with recombinant fragments D and E corresponding to distal 704- and 447-residue stretches, respectively, of the BP230 tail (Figure 2). None of the control serum samples from normal volunteers (n = 12) and pemphigus patients (n = 6) showed binding to these recombinant proteins. Similar reactivities were observed by Tanaka et al. who found that 84% and 61% of BP sera immunoblotted two recombinants encompassing 997-residue and 507-residue segments, respectively, of the tail of murine BP230 (Tanaka et al. 1991), as well as by Ide et al. utilizing an enzyme-linked immunosorbent assay (ELISA) with these same recombinant proteins (Ide et al. 1995). Our results indicate that the antigenic sites are predominantly located downstream of residue 1891 of BP230, because the more proximal region close to the coiled-coil region covered by recombinant C (covering residues 1593–1891), to which only one of 25 (4%) BP sera bound, exhibits poor reactivity. Although this idea is supported by findings obtained with sera from Japanese BP patients, Rico et al. found that 48% of BP sera from the United States (but only 5% of control sera) immunoblotted a bacterial recombinant containing residues 1623–1812 of BP230 (Rico et al. 1996). Differences in the studied BP populations and in their immunogenetic restriction may account for these discordant results. Finally, recombinants D and E were recognized by the MoAb 5E (Hashimoto et al. 1993), whereas a rabbit antiserum to BP230 (Tanaka et al. 1990) reacted with recombinants C and D (not shown).

Figure 2.
Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

BP sera react with multiple antigenic epitopes throughout BP230. Reactivity of 25 BP sera was assessed by immunoblotting as described in Materials and Methods against BP230 recombinants (listed in Figure 1) that were expressed by an in vitro translation system. Reactivity against recombinants A (A), B (B), C (C), D (D), and E (E). Lanes 1–8 correspond to MoAb 9E10 anti-c-myc-epitope, and sera from BP patients BP3, BP7, BP10, BP13, BP17, and two normal volunteers, respectively. The apparent molecular weights of the recombinants (arrow), each epitope tagged with c-myc at their 5' end, were slightly smaller than the sizes predicted on the basis of the corresponding sequences, i.e., 63 kDa, 75 kDa, 35 kDa, 79 kDa, and 50 kDa for recombinant A, B, C, D, and E, consistent with the abnormal electrophoretic migration of BP230 and other plakins (Wiche et al. 1993). Each of the 5 BP sera exhibits a different pattern of immunoreactivity and is representative of the reactivity patterns observed with other BP sera. Note that some additional reactive bands were occasionally found with both experimental and control sera and most probably represented either unspecific background or reactivity against proteins in the lysate translation system. Samples were separated by 7.5% SDS-PAGE under nonreducing conditions.

Full figure and legend (81K)


BP sera also react with multiple antigenic reactive sites on the NH2-terminal half of BP230

Our study shows that a substantial number of BP230-reactive sera display IgG reactivity to the head of BP230 (Table 1). Eight (32%) of 25 of the BP sera had IgG that recognized recombinant A containing a 555-residue NH2-terminal stretch of BP230, whereas the same percentage of BP sera bound to recombinant B, a more distal fragment close to the coiled-coil domain (Figure 2). In line with the latter findings, a bacterial fusion protein encompassing residues 1003–1193 adjacent to the NH2-terminal end of the coiled-coil region was bound by 38% of the BP sera (Rico et al. 1996). To exclude the possibility that autoantibodies directed against the COOH-terminus of BP230 cross-reacted with its NH2-terminus, IgG from a representative patient with autoantibodies binding both the NH2- and COOH-terminus of BP230 was affinity-purified against recombinant D and tested against recombinant A. Patient IgG affinity-purified against the COOH-terminus of BP230 did not immunoblot the NH2-terminus of BP230 (not shown), indicating that there was no antigenic cross-reactivity between the NH2- and COOH-termini of BP230. This idea was further supported by the observation that two of 25 (8%) BP sera had an antibody response restricted to the NH2-terminal half of BP230 (BP10 and BP25). Based on these findings, it can be anticipated that screening of BP sera utilizing recombinant fragments encompassing only the BP230 tail would miss some autoreactivities. Finally, the observation that one of the tested sera (BP22) did not bind to BP230 recombinants A to E suggests that this patient's autoantibodies reacted with sequences not present in the expressed recombinant fragments, or, alternatively, reflects loss of reactivity due to sample storage. Preliminary findings indicate that immunoblot analysis using BP230 recombinants expressed by an in vitro translation system has a sensitivity at least comparable to that of conventional immunoblotting using keratinocyte extracts.

Autoantibody-reactive sites are clustered within the B and C subdomains of BP230

To better characterize the location of the immunodominant sequences within the tail of BP230, we expressed recombinant fragments encompassing either the B subdomain with the linker region (recombinant F) or the C subdomain alone (recombinant G) in transfected COS-7 cells. For this purpose, the recombinants were fused to a green fluorescent protein to increase their stability (Smith & Fuchs 1998). Our results showed that 18 of 21 (85.7%) BP sera reacting with recombinant D also immunoblotted recombinant F, a segment of 361 amino acids, whereas 16 (76%) sera bound to the 238-residue recombinant G (Table 2, Figure 3). None of the control normal human sera (n = 8) exhibited binding to these recombinant fragments. Interestingly, the segment spanning the B, the linker, and the C subdomains contains several amino acid stretches (residues 2285–2288, 2295–2297, 2344–2347, 2394–2397, 2467–2469, 2493–2498, 2595–2598, and 2607–2611) predicted to have a high antigenic index (Jameson & Wolf 1988). In line with this prediction, a synthetic peptide encompassing residues 2287–2302 was found to be recognized by 35% of 37 BP sera in an ELISA (Rico et al. 1990). Moreover, the linker region of BP230 and of the other plakin members envoplakin, periplakin, and desmoplakin, which show high homology with each other, is frequently targeted by autoantibodies from patients with paraneoplastic pemphigus (Mahoney et al. 1998), an autoimmune mucocutaneous disease with a peculiar autoantibody response to plakins. Together with these findings, our results provide strong evidence that the region between the B and C subdomains of BP230 harbors several clustered antigenic sites.

Figure 3.
Figure 3 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Immunodominant sequences are located within the B domain, the linker, and the C domain of BP230. Reactivity of the 21 BP sera binding to the COOH-terminal domain (recombinant D) were assayed by immunoblotting as described in Materials and Methods against recombinants F and G (Figure 1) that were expressed by transfected COS-7 cells. Reactivity against recombinants F (F) and G (G). Lanes 1–8 correspond to rabbit anti-GFP, and sera from BP patients BP3, BP7, BP12, BP17, BP21, and two normal volunteers, respectively. Proteins close to their predicted mass of 61 kDa and 45 kDa, respectively, are recognized by the rabbit antiserum against GFP. The 5 BP sera are representative of the reactivity patterns observed with other BP sera. Note that some additional reactive bands were occasionally found with both experimental and control sera and most probably represented either unspecific background or reactivity against proteins in COS-7 extracts. Samples were separated by 7.5% SDS-PAGE under nonreducing conditions.

Full figure and legend (32K)


IgG autoantibodies binding to the BP230 tail predominantly belong to the IgG4 and IgG1 subclasses

Previous studies have reported a predominance of the IgG4 and IgG1 subclasses in circulating BP autoantibodies (Bird et al. 1986;Yamada et al. 1989;Bernard et al. 1990;Soh et al. 1991). The specific subclass pattern of autoantibodies to either BP230 or BP180, however, was not investigated except in one study. Therefore, we qualitatively assessed the IgG subclass distribution of the autoantibody response in all but one BP serum sample reactive with the immunodominant BP230 tail (recombinant D). Seventeen (85%) and 16 (80%) of the 20 BP sera available for testing exhibited autoantibodies of the IgG4 and IgG1 subclass, respectively, binding to recombinant D (Figure 4). In 14 patients, both IgG4 and IgG1 were present. Only one (5%) BP serum contained IgG2 autoantibodies, whereas five of 20 sera (25%) had autoantibodies of the IgG3 subclass. Our findings are in apparent contrast with a previous study, in which a predominant IgG4 restriction for BP230 was found (Bernard et al. 1990). As the MoAb utilized were the same, such difference is most probably due to the fact that the latter study tested BP sera at higher dilutions (1:100), providing support to the idea that IgG4 is present in higher concentrations than IgG1. Nevertheless, the presence of IgG1 and IgG4 suggests that both autoreactive Th1 and autoreactive Th2 cells (Romagnani 1992) are involved in the regulation of the autoantibody response to the immunodominant region of BP230. In fact, Th2 cytokines such as IL-4 and IL-13 have been shown to regulate the secretion of IgG4, whereas the Th1 cytokine interferon-gamma induces the secretion of IgG1 (reviewed inRomagnani 1992;Büdinger et al. 1998). Although no data are yet available for BP230, BP180-specific autoreactive T cell lines were found to produce both Th2 and Th1 cytokines (Büdinger et al. 1998) in keeping with the observation that IgG4 and IgG1 are also the major subclasses in autoreactivity to BP180 (Bernard et al. 1990).

Figure 4.
Figure 4 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

IgG autoantibodies binding to the BP230 tail belong predominantly to the IgG4 and IgG1 subclasses. The subclass distribution of the IgG autoantibody response to recombinant D was assessed by immunoblotting as described in Materials and Methods for 20 BP sera. Reactivity with MoAb 9E10, lane 1; with BP7 serum, lanes 2–6; and with BP18 serum, lanes 5–8. The sera were probed for IgG1 (lanes 2 and 5), for IgG2 (lanes 3 and 7), for IgG3 (lanes 4 and 8), and for IgG4 (lanes 5 and 9). Samples were separated by 7.5% SDS-PAGE under nonreducing conditions.

Full figure and legend (13K)

''Epitope spreading,'' BP230 antigenic sites, and disease activity

In the course of an autoimmune disease, B and T cell responses are not restricted to a unique ''immunodominant'' epitope, but recognize additional ''secondary'' epitopes within the same protein or distinct molecules that might play a key role for the progression and perpetuation of the disease (Vanderlugt & Miller 1996;Chan et al. 1998). Hence, the identification of several antigenic sites throughout BP230 (and BP180) in the present and previous studies most probably reflects this ''epitope spreading'' phenomenon. It remains unclear, however, which epitopes of BP180 and/or BP230 are crucial for disease initiation. In this retrospective analysis, no obvious correlation could be established between disease duration and activity and the epitope reactivity of anti-BP230 autoantibodies (Table 1). Prospective studies utilizing more sensitive techniques such as ELISA, in which the antigens are assayed under native conditions allowing detection of auto- antibodies against conformational epitopes, together with investigations of T cell responses against BP230 and BP180 will hopefully provide insights crucial for the identification of pathogenetically relevant epitopes. The idea that conformation-dependent epitopes on BP230 exist is indeed supported by the observation that immunoprecipitation studies, in which the antigen-antibody reaction occurs before the denaturation of SDS polyacrylamide gel electrophoresis (PAGE), were found to be more sensitive than immunoblotting for detecting immunoreactivity with BP230 (Mueller et al. 1989).

The targeted domains of BP230 are functionally important

It is tempting to correlate our epitope mapping results with recent cell biologic studies. A 768-residue stretch of the BP230 tail has been shown to contain sequences required for the interaction of BP230 with the intermediate filament cytoskeleton (Yang et al. 1996). In line with these findings, BP230-null mutant mice exhibit an impaired anchorage of keratin intermediate filaments to HD in basal keratinocytes with discrete signs of blistering, most probably because of reduced mechanical strength (Guo et al. 1995). In contrast, the NH2-terminal domain of BP230 appears to be important for the localization of the molecule to HD, by containing binding site(s) critical for its association with the cytoplasmic domain of BP180 and the beta4 subunit of the alpha6beta4 integrin (Figure 1). Based on these findings, it is conceivable that upon tissue injury – or even by penetrating intact cells (Alarcón-Segovia et al. 1996) – autoantibodies to BP230 get into the cell, bind to the target antigen, and contribute to subepidermal blister formation and disease perpetuation not only by eliciting an inflammatory response but also by interfering with the function and molecular interactions of BP230, and, by this means, with HD stability. Electron microscopy studies showing disappearance of the cytoplasmic plaque of HD and anchoring filaments with degenerative alterations within the cytoplasm of basal cells in noninflammatory bullae of BP do not exclude this possibility (Jakubowicz et al. 1970).

In conclusion, our study represents a comprehensive epitope mapping analysis of BP230 utilizing recombinants encompassing almost the entire autoantigen. Multiple reactive antigenic sites exist over the entire molecule. Nevertheless, the region spanning from the B to the C subdomain within the BP230 tail contains immunodominant sequences recognized by the majority of BP sera. The identification of autoantibodies predominantly belonging to the IgG4 and IgG1 subclasses suggests that both autoreactive TH2 and autoreactive TH1 cells are involved in the regulation of the autoantibody response against the immunodominant BP230 tail. These results provide additional insights relevant for our understanding of the pathophysiology of BP.

Top

Notes

1 Koster J, Favre B, Geerts D, Sonnenberg A, Borradori L: Characterization of domains within the bullous pemphigoid antigen 230 important for the assembly of hemidesmosomes. Arch Dermatol Res 291:120 1999 (abstr.)

2 Hopkinson SB, Jones JCR: BPAG2 (type XVII collagen) associates with the N-terminal domain of BPAG1 in hemidesmosomal plaques. J Invest Dermatol 112:527 1999 (abstr.)

Top

References

  1. Aho, S & Uitto, J: Direct interaction between the intracellular domains of bullous pemphigoid antigen 2 (BP180) and beta4 integrin, hemidesmosomal components of basal keratinocytes. Biochem Biophys Res Commun, 1998 243, 694–699, 10.1006/bbrc.1998.8162 | Article | PubMed | ISI | ChemPort |
  2. Alarcón-Segovia, D, Ruiz-Argüelles, A, Llorente, L: Broken dogma: penetration of autoantibodies into living cells. Immunol Today, 1996 17, 163–164, 10.1016/0167-5699(96)80613-x | PubMed |
  3. Balding, SD, Prost, C, Diaz, LA, Bernard, P, Bedane, C, Aberdam, D, Giudice, GJ: Cicatricial pemphigoid autoantibodies react with multiple sites on the BP180 extracellular domain. J Invest Dermatol, 1996 106, 141–146,  | Article | PubMed | ISI | ChemPort |
  4. Bernard, P, Aucouturier, P, Denis, F, Bonnetblanc, JM: Immunoblot analysis of IgG subclass of circulating antibodies in bullous pemphigoid. Clin Immunol Immunopath 1990 1993, 484–494,
  5. Bernard, P, Didierjean, L, Denis, F, Saurat, JH, Bonnetblanc, JM: Heterogeneous bullous pemphigoid antibodies: detection and characterization by immunoblotting when absent by indirect immunofluorescence. J Invest Dermatol, 1989 92, 171–174,  | Article | PubMed | ISI | ChemPort |
  6. Bird, P, Friedmann, PS, Ling, N, Bird, AG, Thomson, RA: Subclass distribution of IgG autoantibodies in bullous pemphigoid. J Invest Dermatol, 1986 86, 21–25,  | Article | PubMed | ISI | ChemPort |
  7. Borradori, L, Chavanas, S, Schaapveld, RQJ, Gagnoux-Palacios, L, Calafat, J, Meneguzzi, G, Sonnenberg, A: Role of the bullous pemphigoid 180 (BP180) in the assembly of hemidesmosomes and cell adhesion. Re-expression of BP180 in generalized atrophic benign epidermolysis bullosa keratinocytes. Exp Cell Res, 1998 239, 463–476, 10.1006/excr.1997.3923 | Article | PubMed | ISI | ChemPort |
  8. Borradori, L, Koch, PJ, Niessen, CM, Erkeland, S, van Leusden, MR, Sonnenberg, A: The localization of bullous pemphigoid antigen 180 (BP180) in hemidesmosomes is mediated by its cytoplasmic domain and seems to be regulated by the beta4 integrin subunit. J Cell Biol, 1997 136, 1333–1347,  | Article | PubMed | ISI | ChemPort |
  9. Borradori, L & Sonnenberg, A: Structure and function of hemidesmosomes: more than simple adhesion complexes. J Invest Dermatol, 1999 112, 411–418, 10.1046/j.1523-1747.1999.00546.x | Article | PubMed | ISI | ChemPort |
  10. Büdinger, L, Borradori, L, Yee, C: et al. Identification and characterization of autoreactive T cell responses to bullous pemphigoid antigen 2 in patients and healthy controls. J Clin Invest, 1998 102, 2082–2089,  | PubMed | ISI | ChemPort |
  11. Chan, LS, Vanderlugt, CJ, Hashimoto, T: et al. Epitope spreading: lessons from autoimmune skin diseases. J Invest Dermatol, 1998 110, 103–109,  | Article | PubMed | ISI | ChemPort |
  12. Cullen, BR: Use of eukaryotic expression technology in the functional analysis of cloned genes. Meth Enzymol, 1987 152, 684–703,  | PubMed | ISI | ChemPort |
  13. Elgart, GW & Stanley, JR: Cloning of the 5' mRNA for the 230-kD bullous pemphigoid antigen by rapid amplification of cDNA ends. J Invest Dermatol, 1993 101, 244–246,  | Article | PubMed | ISI | ChemPort |
  14. Evan, GI, Lewis, GK, Ramsay, G, Rutter, WA: Isolation of monoclonal-antibodies specific for human c-myc protooncogene product. Mol Cell Biol, 1985 5, 3610–3616,  | PubMed | ISI | ChemPort |
  15. Gammon, WR, Briggaman, RA, Inman, A, Queen, LL, Wheeler, LE: Differentiating anti-lamina lucida and anti-sub lamina densa anti-BMZ antibodies by indirect immunofluorescence on 1.0 M sodium chloride-separated skin. J Invest Dermatol, 1984 82, 139–144,  | Article | PubMed | ISI | ChemPort |
  16. Gaucherand, M, Nicolas, J-F, Paranhos Baccala, G: et al. Major antigenic epitopes of bullous pemphigoid 230 kDa antigen map within the C-terminal end of the protein. Evidence using a 55 kDa recombinant protein. Br J Dermatol, 1995 132, 190–196,  | PubMed | ISI | ChemPort |
  17. Giudice, GJ, Emery, DJ, Diaz, LA: Cloning and primary structural analysis of the bullous pemphigoid autoantigen BP180. J Invest Dermatol, 1992 99, 243–250,  | Article | PubMed | ISI | ChemPort |
  18. Giudice, GJ, Emery, DJ, Zelickson, BD, Anhalt, GJ, Liu, Z, Diaz, LA: Bullous pemphigoid and herpes gestationis autoantibodies recognize a common non-collagenous site on the BP180 ectodomain. J Immunol, 1993 151, 5742–5750,  | PubMed | ISI | ChemPort |
  19. Giudice, GJ, Squiquera, HL, Elias, PM, Diaz, LA: Identification of two collagen domains within the bullous pemphigoid autoantigen, BP180. J Clin Invest, 1991 87, 734–738,  | PubMed | ISI | ChemPort |
  20. Giudice, GJ, Wilske, KC, Anhalt, GJ: et al. Development of an ELISA to detect anti-BP180 autoantibodies in bullous pemphigoid and herpes gestationis. J Invest Dermatol, 1994 102, 878–881,  | Article | PubMed | ISI | ChemPort |
  21. Green, KJ & Jones, JCR: Desmosomes and hemidesmosomes: structure and function of molecular components. FASEB J, 1996 10, 871–881,  | PubMed | ISI | ChemPort |
  22. Green, KJ, Virata, MLA, Elgart, GW, Stanley, JR, Parry, DAD: Comparative structural analysis of desmoplakin, bullous pemphigoid antigen and plectin: members of a new gene family involved in organization of intermediate filaments. Int J Biol Macromol, 1992 14, 145–153,  | Article | PubMed | ISI | ChemPort |
  23. Guo, L, Degenstein, L, Dowling, J, Yu, Q-C, Wollmann, R, Perman, B, Fuchs, E: Gene targeting of BPAG1: abnormalities in mechanical strength and cell migration in stratified epithelia and neurologic degeneration. Cell, 1995 81, 233–243,  | Article | PubMed | ISI | ChemPort |
  24. Hall, RPI, Murray, JC, McCord, MM, Rico, JM, Streilein, RD: Rabbits immunized with a peptide encoded for by the 230-kd bullous pemphigoid antigen cDNA develop an enhanced inflammatory response to UVB irradiation: a potential animal model for bullous pemphigoid. J Invest Dermatol, 1993 101, 9–14,  | PubMed | ISI | ChemPort |
  25. Hashimoto, T, Amagai, M, Ebihara, T: et al. Further analyses of epitopes for human monoclonal anti-basement membrane zone antibodies produced by stable human hybridoma cell lines constructed with Epstein-Barr virus transformants. J Invest Dermatol, 1993 100, 310–315,  | Article | PubMed | ISI | ChemPort |
  26. Hopkinson, SB, Baker, SE, Jones, JCR: Molecular genetic studies of a human epidermal autoantigen (the 180-kD bullous pemphigoid antigen/BP180): identification of functionally important sequences within the BP180 molecule and evidence for an interaction between BP180 and alpha6 integrin. J Cell Biol, 1995 130, 117–125,  | Article | PubMed | ISI | ChemPort |
  27. Hopkinson, SB, Riddelle, KS, Jones, JCR: Cytoplasmic domain of the 180-kD bullous pemphigoid antigen, a hemidesmosomal component: molecular and cell biologic characterization. J Invest Dermatol, 1992 99, 264–270,  | Article | PubMed | ISI | ChemPort |
  28. Ide, A, Hashimoto, T, Amagai, M, Tanaka, M, Nishikawa, T: Detection of autoantibodies against the bullous pemphigoid and pemphigus antigens by an enzyme-linked immunosorbent assay using the bacterial recombinant proteins. Exp Dermatol, 1995 5, 112–116,
  29. Jakubowicz, K, Dabrowski, J, Maciejewski, W: Elektronenmikroskopische Untersuchungen beim bullösem Pemphigoid und Dermatitis herpetiformis Duhring. Arch Klin Exp Dermatol, 1970 238, 272–284,  | Article | PubMed | ISI | ChemPort |
  30. Jameson, BA & Wolf, H: The antigenic index: a novel algorithm for predicting antigenic determinants. Comput Appl Biosci, 1988 4, 181–186,  | PubMed | ISI | ChemPort |
  31. Jefferis, R, Reimer, CB, Skvaril, F: Evaluation of monoclonal antibodies having specificity for human IgG subclasses: results of an IUIS/WHO collaborative study. Immunol Lett, 1985 10, 223–252,  | Article | PubMed | ISI | ChemPort |
  32. Jonkman, MF, de Jong, MCJM, Heeres, K: et al. 180-kD bullous pemphigoid antigen (BP180) is deficient in generalized atrophic benign epidermolysis bullosa. J Clin Invest, 1995 95, 1345–1352,  | PubMed | ISI | ChemPort |
  33. Kelly, SE, Cerio, R, Bhogal, BS, Black, MM: The distribution of the IgG subclass in pemphigoid gestationis: PG facto is an IgG1 autoantibody. J Invest Dermatol, 1989 92, 695–698,  | Article | PubMed | ISI | ChemPort |
  34. Labib, RS, Anhalt, GJ, Patel, HP, Mutasim, DF, Diaz, LA: Molecular heterogeneity of the bullous pemphigoid antigens as detected by immunoblotting. J Immunol, 1986 136, 1231–1235,  | PubMed | ISI | ChemPort |
  35. Lever, WF & Pemphigus. Medicine, 1953 32, 1–123,  | PubMed | ISI | ChemPort |
  36. Li, K, Tamai, K, Tan, EML, Uitto, J: Cloning of type XVII collagen. Complementary and genomic DNA sequences of mouse 180-kilodalton bullous pemphigoid antigen (BPAG2) predict an interrupted collagenous domain, a transmembrane segment, and unusual features in the 5'-end of the gene and the 3'-untranslated region of the mRNA. J Biol Chem, 1993 268, 8825–8834,  | PubMed | ISI | ChemPort |
  37. Liu, Z, Diaz, LA, Swartz, SJ, Troy, JL, Fairley, JA, Giudice, GJ: Molecular mapping of a pathogenically relevant BP180 epitope associated with experimentally induced murine bullous pemphigoid. J Immunol, 1995 155, 5449–5454,  | PubMed | ISI | ChemPort |
  38. Liu, Z, Diaz, LA, Troy, JL, Taylor, AF, Emery, DJ, Fairley, JA, Giudice, GJ: A passive transfer model of the organ-specific autoimmune disease, bullous pemphigoid, using antibodies generated against the hemidesmosomal antigen, BP180. J Clin Invest, 1993 92, 2480–2488,  | PubMed | ISI | ChemPort |
  39. Mahoney, MG, Aho, S, Uitto, J, Stanley, JR: The members of the plakin family of proteins recognized by paraneoplastic pemphigus antibodies include periplakin. J Invest Dermatol, 1998 11, 308–313,
  40. Matsumura, K, Amagai, M, Nishikawa, T, Hashimoto, T: The majority of bullous pemphigoid and herpes gestationis sera react with the NC16a domain of the 180-kDa bullous pemphigoid antigen. Arch Dermatol Res, 1996 288, 507–509, 10.1007/s004030050093 | Article | PubMed | ISI | ChemPort |
  41. McGrath, JA, Gatalica, B, Christiano, AM: et al. Mutations in the 180-kD bullous pemphigoid antigen (BPAG2), a hemidesmosomal transmembrane collagen (COL17A1), in generalized atrophic benign epidermolysis bullosa. Nature Genet, 1995 11, 83–86,  | Article |
  42. Miller, JE, Rico, JM, Hall, RP: IgG antibodies from patients with bullous pemphigoid bind to fusion proteins encoded by BPAg1 cDNA. J Invest Dermatol, 1993 101, 779–782,  | Article | PubMed | ISI | ChemPort |
  43. Mueller, S, Klaus-Kovtun, V, Stanley, JR A: 230 kD basic protein is the major bullous pemphigoid antigen. J Invest Dermatol, 1989 92, 32–38,
  44. Perriard, J, Jaunin, F, Favre, B, Büdinger, L, Hertl, M, Saurat, J-H, Borradori, L: IgG autoantibodies from bullous pemphigoid (BP) patients bind antigenic sites on both the extracellular and the intracellular domain of the BP antigen 180. J Invest Dermatol, 1999 112, 141–147, 10.1046/j.1523-1747.1999.00497.x | Article | PubMed | ISI | ChemPort |
  45. Rico, MJ, Hashimoto, T, Watanabe, K, Hall, RP, Clark, RB, Nishikawa, T: Comparative epitope mapping of sera from United States (US) and Japanese patients with bullous pemphigoid (BP) to fusion proteins encoded by BPAG1. J Dermatol Sci, 1996 12, 238–245, 10.1016/0923-1811(95)00479-3 | Article | PubMed | ISI | ChemPort |
  46. Rico, MJ, Korman, NJ, Stanley, JR, Tanaka, T, Hall, RP: IgG antibodies from patients with bullous pemphigoid bind to localized epitopes on synthetic peptides encoded bullous pemphigoid antigen cDNA. J Immunol, 1990 145, 3728–3733,  | PubMed | ISI | ChemPort |
  47. Romagnani, S: Human Th1 and Th2 subsets: regulation of differentiation and role in protection and immunopathology. Int Arch Allergy Appl Immunol, 1992 98, 279–285,  | ChemPort |
  48. Ruhrberg, C & Watt, FM: The plakin family, versitile organizer of cytoskeletal architecture. Curr Op Gen Dev, 1997 7, 392–397,  | ISI | ChemPort |
  49. Sawamura, D, Li, K, Chu, ML, Uitto, J: Human bullous pemphigoid antigen (BPAG1). Amino acid sequences deduced from cloned cDNAs predict biologically important peptide segments and protein domains. J Biol Chem, 1991 266, 17784–17790,  | PubMed | ISI | ChemPort |
  50. Schaapveld, RQJ, Borradori, L, Geerts, D: et al. Hemidesmosomes formation is initiated by the beta4 integrin subunit, requires complex formation with HD1/plectin and involves a direct interaction between beta4 and the bullous pemphigoid antigen 180. J Cell Biol, 1998 142, 271–284, . | Article | PubMed | ISI | ChemPort |
  51. Smith, EA & Fuchs, E: Defining the interactions between intermediate filaments and desmosomes. J Cell Biol, 1998 141, 1229–1241,  | Article | PubMed | ISI | ChemPort |
  52. Soh, H, Hosokawa, H, Miyauchi, H, Izumi, H, Asada, Y: The distribution of IgG subclass autoantibodies in bullous pemphigoid analysed by immunofluorescence and immunoblotting. Arch Dermatol, 1991 283, 400–404,  | ISI | ChemPort |
  53. Sonnenberg, A, de Melker, AA, Martinez de Velasco, AM, Janssen, H, Calafat, J, Niessen, CM: Formation of hemidesmosomes in cells of a transformed murine mammary tumor cell line and mechanisms involved in adherence of these cells to laminin and kalinin. J Cell Sci, 1993 106, 1083–1102,  | PubMed | ISI | ChemPort |
  54. Stanley, JR, Hawley-Nelson, P, Yuspa, SH, Shevach, EM, Katz, SI: Characterization of bullous pemphigoid antigen: a unique basement membrane protein of stratified squamous epithelia. Cell, 1981 24, 897–903,  | Article | PubMed | ISI | ChemPort |
  55. Stanley, JR, Tanaka, T, Mueller, S, Klaus-Kovtun, V, Roop, D: Isolation of complementary DNA for bullous pemphigoid antigen by use of patients' autoantibodies. J Clin Invest, 1988 82, 1864–1870,  | PubMed | ISI | ChemPort |
  56. Stanley, JR, Woodley, DT, Katz, SI: Identification and partial characterization of pemphigoid antigen extracted from normal human skin. J Invest Dermatol, 1984 82, 108–111,  | Article | PubMed | ISI | ChemPort |
  57. Tanaka, M, Hashimoto, T, Amagai, M: et al. Characterization of bullous pemphigoid antibodies by use of recombinant bullous pemphigoid antigen proteins. J Invest Dermatol, 1991 97, 725–728,  | Article | PubMed | ISI | ChemPort |
  58. Tanaka, T, Korman, NJ, Shimizu, H, Eady, RAJ, Klaus-Kovtun, V, Cehrs, K, Stanley, JR: Production of rabbit antibodies against carboxy-terminal epitopes encoded by bullous pemphigoid cDNA. J Invest Dermatol, 1990 94, 617–623,  | Article | PubMed | ISI | ChemPort |
  59. Vanderlugt, CJ & Miller, SD: Epitope spreading. Curr Opin Immunol, 1996 8, 831–836,  | Article | PubMed | ISI | ChemPort |
  60. Wiche, G, Gromov, D, Donovan, A, Castanon, MJ, Fuchs, E: Expression of plectin mutant cDNA in cultured cells indicates a role of COOH-terminal domain in intermediate filament association. J Cell Biol, 1993 121, 607–619,  | Article | PubMed | ISI | ChemPort |
  61. Yamada, H, Hashimoto, T, Nishikawa, T: IgG subclass of intercellular and basement membrane zone antibodies: the relationship to the capability of complement fixation. J Invest Dermatol, 1989 92, 585–587,  | Article | PubMed | ISI | ChemPort |
  62. Yang, Y, Dowling, J, Yu, Q-C, Kouklis, P, Cleveland, DW, Fuchs, E: An essential cytoskeletal linker protein connecting actin microfilaments to intermediate filaments. Cell, 1996 86, 655–665,  | Article | PubMed | ISI | ChemPort |
  63. Zillikens, D, Rose, PA, Balding, SD, Liu, Z, Olague-Marchan, M, Diaz, LA, Giudice, GJ: Tight clustering of extracellular BP180 epitopes recognized by bullous pemphigoid antibodies. J Invest Dermatol, 1997 109, 573–579,  | Article | PubMed | ISI | ChemPort |
Top

Acknowledgments

This work has been supported by a grant from the Swiss National Foundation for Scientific Research (32–51083.97 to L.B.) and by the German Research Council (grants 1604/5–1 and 1604/5–2 to M.H., and SFB 293/B3 to L.B-T.). L.B. is the recipient of grants of the Fondation Touraine (Paris), TELETHON Action Suisse (Aubonne), and the Fondation de Reuter (Genève). The authors are particularly indebted to Dr. J.R. Stanley (University of Pennsylvania, Phildelphia) and Dr. J. Uitto (Jefferson Medical College, Philadelphia), who generously provided cDNAs for human BP230.

Extra navigation

.
ADVERTISEMENT