Original Article

Journal of Investigative Dermatology (1998) 111, 194–198; doi:10.1046/j.1523-1747.1998.00266.x

Heat Shock Transcription Factor-1 Regulates Heat Shock Protein-72 Expression in Human Keratinocytes Exposed to Ultraviolet B Light

Xiwu Zhou, Victor A Tron, Gang Li* and Martin J Trotter

  1. Department of Pathology, Vancouver General Hospital, University of British Columbia and Skin Cancer Research Laboratory, Jack Bell Research Center, Vancouver, British Columbia, Canada
  2. *Division of Dermatology, Vancouver General Hospital, University of British Columbia and Skin Cancer Research Laboratory, Jack Bell Research Center, Vancouver, British Columbia, Canada

Correspondence: Dr Martin J. Trotter, Department of Pathology (Anatomical Pathology), Vancouver General Hospital, 910 West 10th Avenue, Vancouver, B.C., Canada V5Z 1 L8.

Received 22 July 1997; Revised 19 March 1998; Accepted 3 April 1998.

Top

Abstract

In response to ultraviolet radiation (UVR), skin keratinocytes increase expression of heat shock proteins that can protect cells from stress-induced damage. This heat shock response is known to be transcriptionally regulated in eukaryotic cells exposed to certain forms of environmental stress. In the skin, absorption of ultraviolet B light occurs primarily in the epidermis, and therefore, using primary cultures of normal human epidermal keratinocytes, we have examined whether transcriptional activation of the hsp72 gene occurs following UVB irradiation. Cultured keratinocytes were exposed to UVB (290–320 nm, 300 J per m2) and then incubated at 37°C for various intervals before harvesting. Immediately following UV exposure, the heat shock transcription factor 1 (HSF1) dissociated from HSP72-HSF1 complexes, underwent trimerization and phosphorylation, and demonstrated DNA binding activity to the heat shock element in the promoter region of the hsp72 gene. UVB also increased hsp72 mRNA, with peak levels observed 1–3 h post-UVR. HSP72 protein was constitutively expressed in keratinocytes, and its expression was increased by UVB, with maximum levels at 6 h post-UVR. The stress response may be extremely important in the protection of human skin from UVB radiation, and modulation of heat shock protein expression and/or function offers a potential therapeutic target in the prevention of photoaging and skin cancer.

Keywords:

stress response, ultraviolet light

Abbreviations:

HSE, heat shock element; HSF, heat shock transcription factor; HSP, heat shock protein

Ultraviolet radiation (UVR) can significantly damage human skin and is strongly implicated in the pathogenesis of skin cancer (Young 1990;Kelfkens et al. 1990). Protection of epidermal cells from UVR-induced injury is mediated by several mechanisms including repair of DNA damage, activation of antioxidant enzymes, increased melanin pigmentation, and the expression of heat shock proteins (HSP) (Maytin 1992; Peak et al. 1993). HSP are a family of proteins whose expression is induced or enhanced in response to various environmental stressors. HSP70, the most abundant HSP family in eukaryotes, consists of both constituitive and stress-inducible forms (e.g., HSP72) (Tavaria et al. 1996). The expression of HSP72 can be induced by a range of stressors, including heat shock, hypoxia, heavy metals, and UVR. Numerous studies have suggested that HSP play a general protective role in cells subjected to stress (Liu et al. 1992;Morimoto et al. 1994). It has been shown that HSP72 binds to unfolded or misfolded proteins and assists in proper refolding, acting as a "molecular chaperone" (Georgopoulos & Welsh 1993;Becker & Craig 1994).

In human keratinocytes, HSP72 is apparently constitutively expressed (Trautinger et al. 1993) and is further induced by many different stressors, including heat (Maytin et al. 1990;Edwards et al. 1991;Muramatsu et al. 1992;Trautinger et al. 1993,1995), cold (Holland et al. 1993), psoralen plus ultraviolet A light (Muramatsu et al. 1993), and ultraviolet B (UVB) irradiation (Muramatsu et al. 1992;Garmyn et al. 1995). The hypothesis that the heat shock response might protect keratinocytes against UVR-mediated damage is supported by the observation that hyperthermia induces resistance to UVB in keratinocytes in vitro (Maytin et al. 1990,1993;Trautinger et al. 1995) and in vivo (Kane & Maytin 1995). HSP72 has been implicated as the mediator of this protective effect (Trautinger et al. 1995;Simon et al. 1995).

The regulation of UVR-induced expression of HSP72 in human keratinocytes is poorly understood, as are the mechanisms by which HSP72 protects the cell against UVR-mediated damage. Transcriptional regulation of heat shock genes in response to heat stress is well characterized in eukaryotic systems and is offered as a paradigm for inducible genomic responses (Sorger 1991;Morimoto et al. 1992,Morimoto 1993). Regulation of heat shock gene expression is mediated by heat shock transcription factor (HSF) that binds to specific sequences in the promoter region of heat shock genes called heat shock element (HSE). This model postulates that in the unstressed cell, HSF is maintained in a monomeric, non-DNA binding form, likely through interaction with HSP72, which may stabilize this inactive HSF conformation (Abravaya et al. 1992;Nunes & Calderwood 1995). Stress causes HSP72 binding to denatured proteins, allowing trimerization of HSF, its translocation to the nucleus, and binding to HSE. Phosphorylation of the HSF trimer is required to initiate gene transcription (Cotto et al. 1996). The resulting increased levels of hsp72 mRNA and subsequently HSP72 protein allow reformation of HSF-HSP72 complexes, thus negatively regulating the response.

The current model of transcriptional regulation of HSP genes is supported by data obtained using immortalized human cell lines and stressors such as heat shock, toxic chemicals, or osmotic shock (Baler et al. 1993;Huang et al. 1995). To our knowledge, this model has not been tested in primary cultures of non-transformed human cells, nor has it been established that induction of HSP expression by UVB occurs via this pathway. This stress response may be extremely important in the protection of human skin from UVB-induced injury. An age-related decrease in the induction of HSP72 has recently been demonstrated in normal human skin (Muramatsu et al. 1996). A suboptimal stress response in keratinocytes may predispose skin to photoaging and cancer development, although this hypothesis has yet to be proven, and the possibility that inhibition of UV-induced cell death might even enhance photocarcinogenesis must be considered. Nevertheless, HSP function offers a potential therapeutic target for modulation of sun-induced skin aging and carcinogenesis. Therefore, as a first step in understanding the mechanisms by which HSP protect the skin from UV damage, we have examined the transcriptional regulation of HSP72 gene expression by HSF1 in primary cultures of human epidermal keratinocytes.

Top

MATERIALS AND METHODS

Cell culture and UV irradiation

Primary human keratinocyte cultures (Clonetics, San Diego, CA) were grown in keratinocyte basal medium (Clonetics) containing bovine pituitary extract (30 ng per ml), human epidermal growth factor (0.1 ng per ml), insulin (5 ng per ml), hydrocortisone (0.5 ng per ml), and antibiotics (50 mug gentamicin per ml, 50 ng amphotericin-B per ml) at 37°C in air with 5% CO2. When cultures reached 80% confluence, medium was removed and plates rinsed twice with phosphate-buffered saline (PBS) at 37°C. Cells were immediately subjected to ultraviolet B (UVB) irradiation (290–320 nm), using a bank of four unfiltered FS40 T12 sunlamps (Westinghouse, Bloomfield, NJ). The intensity of the UV light was measured by an IL 700 radiometer fitted with a WN 320 filter and an A127 quartz diffuser (International Light, Newburyport, MA). Cells were irradiated with an intermediate dose of UVB, 300 J per m2 (Cotton & Spandau 1997), which in monolayer cultures of primary human keratinocytes results in 20% cell killing as measured using propidium iodide nuclear staining and morphologic evaluation of cell death (V. Tron, unpublished observations). Following UVB exposure, fresh medium was added and cells were incubated at 37°C for various intervals before harvesting.

Western blotting analysis
 

Keratinocyte cultures were washed three times with ice-cold PBS and lyzed in RIPA buffer [1% Nonidin P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 100 mug phenylmethylsulfonylfluoride per ml, and 2 mM NaVO4 in PBS] on ice for 30 min. Cell lysates were centrifuged at 14,000 timesg for 15 min at 4°C. The supernatant was recovered as the whole-cell lysate, and its protein concentration was determined using BCA protein assay reagent (Sigma, St. Louis, MO). Proteins in the whole-cell lysates were fractionated using SDS-polyacrylamide gel electrophoresis (10% separating gel), transferred onto nitrocellulose membrane, and incubated in a blocking solution of 3% non-fat milk powder in PBS-T (0.8% Tween 20) for 3 h. Blots were then incubated with either polyclonal anti-HSP72 antibody (Santa Cruz Biotechnology, Santa Cruz, CA, 1:1000 dilution) or polyclonal anti-HSF1 antibody (Affinity Bioreagents, Golden, CO; 1:1000 dilution), and subsequently with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (Santa Cruz Biotechnology). The antigen-antibody complex was detected using enhanced chemiluminescence (ECL, Amersham, Arlington Heights, IL). For protein dephosphorylation experiments, 50 mug of cell lysate (in the absence of phosphatase inhibitor NaVO4) were incubated with 15 units of alkaline phosphatase (Boehringer, Laval, Canada) and protease inhibitors (2 mug aprotinin per ml, 2 mug phenylmethylsulfonylfluoride per ml, and 20 mug leupeptin per ml) at 37°C for 1 h, and the reaction mixtures were subjected to SDS-polyacrylamide gel electrophoresis. For determining the formation of HSF1 oligomers post-UVB, 3 mM ethylene glycol-bis(succinimidylsuccinate) (Pierce, Rockford, IL) was added to 100 mug of protein extract. Reaction was carried out at room temperature for 30 min, and then quenched by addition of 150 mM Tris buffer (pH 7.4). Protein samples were analyzed by western blot.

Immunoprecipitation
 

Keratinocyte cultures were washed twice with ice-cold PBS and lysed in RIPA buffer (1 ml for each 75 cm2 flask). To each sample, 2 mug of anti-HSF1 antibody was added and incubated at 4°C for 2 h. Subsequently, the samples were combined with 2 mg of protein A-agarose, incubated at 4°C for 1 h, and centrifuged at 14,000 timesg for 20 s. The pellet was collected, washed three times with RIPA buffer and once with PBS, and was finally dissolved in SDS-gel sample buffer and subjected to western blot analysis.

Northern blotting analysis
 

Total RNA was isolated from keratinocytes using TriZol reagent (Life Technologies, Mississauga, Canada). Equal amounts (15 mug) from each sample were electrophoresed on a 1% formaldehyde-denatured agarose gel, and transferred onto Hybond-N nylon membrane (Amersham) using the alkaline downward transfer method (Chomczynski 1992). The membrane was stained with 0.3% methylene blue to visualize the 28S and 18S rRNA, which were used as internal controls to confirm equality of RNA loading. The membrane was incubated in prehybridization solution [6timessodium citrate/chloride buffer (1timessodium citrate/chloride buffer containing 0.15 M sodium chloride and 0.015 M sodium citrate, pH 7.0), 10 mM Tris, pH 7.5, 10 mM ethylenediamine tetraacetic acid, 0.5% SDS, 100 mug yeast RNA per ml, and 1timesDenhardt's reagent] for 1 h at 60°C and subsequently in hybridization solution (prehybridization solution containing 32P-labeled human hsp72 gene probe) for 16 h at 60°C. The human hsp72 gene probe was a 760 bp Hind III fragment excised from a 4 kb cDNA clone (Stressgen, Victoria, Canada), and labeled with 32P-dCTP (Amersham) using a Random Primers Labeling kit (Life Technologies). Following hybridization, the membrane was washed once in a solution containing 2timessodium citrate/chloride buffer and 0.1% SDS at room temperature for 30 min and twice in a solution containing 0.2timessodium citrate/chloride buffer and 0.1% SDS at 60°C for 20 min each. The membrane was briefly dried and autoradiographed with Kodak XAR film.

Gel mobility shift assay
 

Nuclear extracts from keratinocytes were prepared using a previously described method (Li et al. 1991). Briefly, cells were washed twice with ice-cold PBS and harvested in buffer A [10 mM HEPES (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol, and 1 mM NaVO4[, passed through a 28-gauge needle 15 times on ice, and centrifuged at 14,000 timesg for 8 s. The pellet was suspended in ice-cold buffer C [20 mM HEPES (pH 7.9), 25% glycerol, 420 mM KCl, 1.5 mM MgCl2, 0.2 mM ethylenediamine tetraacetic acid, 0.5 mM dithiothreitol, 1 mM phenylmethylsulfonylfluoride, and 1 mM NaVO4[ and incubated on ice for 20 min. An equal volume of buffer D (buffer C without KCl and Mg2Cl) was added, and the lysate was centrifuged at 14,000timesg for 15 min at 4°C. The supernatant was recovered as nuclear extract and stored at –80°C. Protein concentrations in the nuclear extracts were measured using BCA protein assay reagent (Sigma). The DNA-protein binding reaction using a band shift assay kit (Pharmacia Biotechnology, Uppsala, Sweden) was carried out by incubating 15 mug of the nuclear extracts with 10 mul reaction buffer solution [20 mM HEPES (pH 7.9), 10% glycerol, 3 mug of poly(dI-dC)(dI-dC), 1 mug of denatured calf thymus DNA, 100 mM NaCl, and 1 mM ethylenediamine tetraacetic acid] and 100,000 cpm of 32P-labeled HSE that was labeled by the method of 5' filling-in using the Klenow enzyme (Sambrook et al. 1988). Mutant HSE sequence (see below) was used as a negative control. For competition experiments, 50timesmolar excess of unlabeled HSE or HSE-mutant was incubated with 15 mug of the nuclear extracts for 15 min on ice prior to adding the reaction buffer solution and 32P-labeled HSE. The oligonucleotides corresponding to the sequences of human HSE (the sequence between –107 to –84 of human hsp72 gene, 5' TATGCGAAACCCCTGGAATATTCC 3' and its complementary strand; the underlines denote the consensus NGAAN sequence of HSE) and a mutant form of the HSE (HSE-M) (5' TATGCTAAACCGCTGCAATACTCC 3' and its complementary strand, the underlines denote the mutant positions) were synthesized in the Department of Biochemistry, University of British Columbia. Reaction mixtures were incubated for 25 min at room temperature followed by electrophoresis in a 4.5% native polyacrylamide gel in 0.5timesTBE buffer (44.5 mM Tris, pH 8.0, 1 mM ethylenediamine tetraacetic acid, and 44.5 mM boric acid) for 2 h at 150 V. The gel was dried and autoradiographed with Kodak XAR film.

Top

RESULTS

HSF is activated by UVB irradiation

The activation of HSF1 has been shown to be involved in the induction of HSP expression by several environmental stressors (e.g., heat shock and osmotic shock) (Baler et al. 1993;Huang et al. 1995). UVB irradiation activated HSF1 in human keratinocytes as evidenced by HSF phosphorylation and binding of this transcription factor to the HSE in the hsp72 gene promoter region. Using western blotting analysis, HSF1 demonstrated reduced electrophoretic mobility following UVB, indicative of protein phosphorylation (Sarge et al. 1993). HSF1 phosphorylation occurred immediately after UV treatment, lasted for 3 h, and disappeared 6 h after UV treatment (Figure 1a). Dephosphorylation using alkaline phosphatase treatment of the 1 h post-UVB sample resulted in increased mobility of the HSF1 band to control levels (data not shown). In addition, using a native gradient gel, we observed the formation of an HSF1 trimer following UVB irradiation, with a similar time course as HSF1 phosphorylation and increased DNA binding activity (Figure 1b). As demonstrated using gel mobility shift assay, HSF1 acquired DNA binding activity following UVB irradiation. This activity was maximal 30 min to 1 h after irradiation, and decreased at 3 h post-UVB (Figure 2). The time course of HSF1 phosphorylation correlated well with induction of the DNA binding activity of this transcription factor.

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Activation of HSF1 by UVB irradiation. Human keratinocytes were irradiated with UVB (300 J per m2) and then harvested at various times: lane 2, 5 min;lane 3, 15 min;lane 4, 30 min;lane 5, 1 h;lane 6, 3 h; and lane 7, 6 h. Lane 1, control (without UVB treatment). (A) Western blot analysis using a polyclonal antibody against HSF1. A shift of gel mobility of HSF1 is noted following UVB irradiation, indicative of phosphorylation of HSF1. * and ** indicate the unphosphorylated (80 kDa) and phosphorylated HSF1 (88 kDa), respectively. (B) Trimerization of HSF1 following UVB irradiation. HSF1 was cross-linked and analyzed using western blot analysis.

Full figure and legend (38K)

Figure 2.
Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Gel mobility shift assay of the DNA-binding activity of HSF1. Human keratinocytes were treated with UVB (300 J per m2) and then harvested at various times: lane 2, 5 min;lane 3, 30 min;lane 4, 1 h; and lane 5, 3 h. Lane 1, control (without UVB treatment). Binding of HSF1 in the nuclear extract to 32P-labeled HSE results in retardation of HSE mobility.

Full figure and legend (48K)

UVB increases hsp72 mRNA and hsp72 protein expression in keratinocytes

The effect of UVB irradiation, at a physiologically relevant dose (300 J per m2), on HSP72 expression in primary cultures of human epidermal keratinocytes is shown in Figure 3. Human keratinocytes constitutively expressed low levels of HSP72, an inducible member of the HSP70 family in other eukaryotic cells. HSP72 protein expression increased in response to UVB irradiation, peaking at 6 h post-UVB (Figure 3b). Hsp72 mRNA was also constitutively expressed at low levels, and UVB increased the expression of this message with maximum levels observed 1–3 h after irradiation (Figure 3a). The levels of both HSP72 protein and its mRNA decreased to control levels 24 h after UVB irradiation.

Figure 3.
Figure 3 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Induction ofhsp72mRNA and protein by UVB irradiation. Human keratinocytes were treated with UVB (300 J per m2) and harvested at various times: lane 2, 30 min;lane 3, 1 h;lane 4, 3 h;lane 5, 6 h; and lane 6, 24 h. Lane 1, control (without UVB treatment). (A) Northern blot analysis of hsp72 mRNA from keratinocyte samples. A 32P-labeled DNA probe containing the coding sequence of human hsp72 gene was used to detect message. (B) Western blot analysis using a polyclonal antibody against HSP72.

Full figure and legend (30K)

UVB causes dissociation of HSF and HSP72

As demonstrated above, HSF1 was activated immediately by UVB irradiation in human keratinocytes. To study the mechanism by which HSF1 protein was rapidly mobilized for activation, we examined the possible association between HSF1 and other proteins, in particular HSP72. Immunoprecipitation experiments using anti-HSF1 antibody demonstrated HSP72 coimmunoprecipitation with HSF1 in unirradiated or sham-irradiated human keratinocytes. Immediately following UVB irradiation, however, the levels of HSP72 coimmunoprecipitated with HSF1 substantially decreased (Figure 4), suggesting dissociation of an HSP72-HSF1 complex. Levels of coimmunoprecipitated HSP72 returned to near pre-UVB levels 24 h after UVB treatment. Although we cannot completely rule out a nonspecific anti-HSF1 and HSP72 interaction, the initial decreasing levels of HSP72 post-UVB irradiation and the subsequent rise at 24 h would be inconsistent with this.

Figure 4.
Figure 4 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Association between HSF1 with HSP72. Human keratinocytes were treated with UVB (300 J per m2) and harvested at various times: lane 2, 5 min;lane 3, 15 min;lane 4, 1 h;lane 5, 3 h;lane 6, 6 h; and lane 7, 24 h. Lane 1, control (without UVB treatment). HSF1 was immunoprecipitated from the total protein samples, and the immunoprecipitates were analyzed by western blot using antibody against HSP72. HSP72 coimmunoprecipitated with HSF1 in control samples, and UVB treatment immediately disrupted this coimmunoprecipitation. Twenty-four hours following UVB treatment, the coimmunoprecipitation of HSP72 with HSF1 was again observed, suggesting reassociation of this complex.

Full figure and legend (17K)

Top

DISCUSSION

As the major damaging component of natural sunlight, UVB has been reported to initiate the stress response in human keratinocytes, characterized by the expression of various HSP in mouse keratinocytes (Maytin 1992), and induction of HSP72 in mouse epidermis (Brunet & Giacomoni 1989), human keratinocyte cell cultures (Garmyn et al. 1995), and organ cultured normal human skin (Muramatsu et al. 1992). Our study demonstrates that UVB, like stressors such as heat shock, activates HSP expression through transcriptional regulation and that this mechanism is active in primary cultures of nontransformed human cells.

Under normal conditions, prior to UVB irradiation, our coimmunoprecipitation data suggest that HSF1 is associated with HSP72. UVB treatment resulted in rapid dissociation of the HSP72-HSF1 complex. The association between HSF1 and HSP72 in the resting state may act to modulate HSF1 transcriptional activity, possibly through control of HSF trimer formation (Rabindran et al. 1994). Dissociation of the HSP72-HSF complex occurs when cells are exposed to UVB radiation, and subsequently, HSF1 undergoes trimerization, phosphorylation, and increased binding activity to HSE, in the hsp72 promoter region. These three aspects of HSF1 activation are known to be required for activation of hsp72 gene transcription following heat shock or osmotic shock (Baler et al. 1993;Huang et al. 1995).

Following activation of HSF1 by UVB, hsp72 gene expression and protein levels were increased in human keratinocytes. The time course of these two events was well correlated with that of HSF1 activation. The enhanced expression of HSP72 protein in keratinocytes was maximal 6 h after UVB treatment, a result identical to previous studies using heat shock as a stressor in keratinocytes (Maytin 1992; Maytin et al. 1993). This time course is very different from that for HSP72 induction in human lymphocytes by heat, in which maximum expression is observed at 2 h following stress (Hansen et al. 1991). Unlike other human cell types such as lymphocytes or hepatocytes (Hansen et al. 1991;Heydari et al. 1993), human keratinocytes constitutively express HSP72 at low levels (Trautinger et al. 1993), a finding confirmed in this study. This feature may reflect the physiologic importance of HSP72 in human keratinocytes, a cell type exposed to various environmental stressors and possibly requiring the constant presence of HSP. The relative delay in HSP72 induction in keratinocytes may simply reflect a replenishment of cell HSP72 stores, rather than an acute stress response. Alternatively, HSP72 may play a role in delayed cell recovery following UVB, a process that includes post-replication repair and recovery of DNA synthesis. Such a function of UVR-induced HSP72 expression has been proposed in human fibroblasts exposed to UVC irradiation (Suzuki & Watanabe 1992).

The physiologic significance of UVB-induced HSP expression in normal human keratinocytes is not known. It is anticipated that the enhanced expression of HSP72 will protect other cellular proteins from damage caused by UV irradiation, allowing the keratinocytes to efficiently cope with stress. Skin exposed to an elevated temperature (40°C) prior to UVB irradiation exhibits a reduced rate of epidermal cell apoptosis (Kane & Maytin 1995). Rates of HSP72 synthesis parallel the development and decline of UVB resistance following heat treatment in keratinocytes (Maytin et al. 1993), and HSP72 has been shown to mediate the effect of preheat treatment in the protection of myocardial cells from ischemic/reperfusion damage (Plumier & Currie 1996). There is direct evidence that HSP72 may play a role in the protection from UVB-induced injury in human epidermoid carcinoma cells (Trautinger et al. 1995) and in murine fibrosarcoma cells (Simon et al. 1995).

Finally, little is known about the signal transduction pathways involved in the response of keratinocytes to UVB, specifically, what factors regulate HSF1/HSP72 interactions and HSF1 phosphorylation. Mammalian cells respond to UVC radiation by a rapid and selective increase in gene expression mediated by the transcription factor AP-1, following activation of c-Jun (Devary et al. 1991). c-Jun is phosphorylated by c-Jun NH2-terminal kinase (JNK1) (Hibi et al. 1993), also known as stress-activated protein kinase (SAPK), a member of the mitogen-activated protein kinase (MAPK) family (Dérijard et al. 1994). We have recently observed that SAPK is phosphorylated post-UVB in primary cultures of human keratinocytes (X. Zhou, unpublished data), implicating this signal transduction pathway in the response of normal human cells to UVR. Whereas MAPK has been shown to negatively regulate the heat shock response in NIH3T3 cells, presumably by hyperphosphorylating HSF1 (Mivechi & Giaccia 1995 ), the possible role of SAPK in regulating HSF activity is not known. The importance of these stress-activated signaling pathways to the UVR-induced heat shock response remains to be elucidated.

In summary, this study demonstrates transcriptional regulation of HSP72 expression induced by UVB irradiation in normal human keratinocytes, in keeping with previous results obtained in transformed cells using other environmental stressors. The mechanisms by which HSP72 protects keratinocytes against UV damage and the signaling pathways involved in mediating this UVB-induced stress response remain to be resolved. The UV-induced heat shock response in human skin may be a potential target in future preventative strategies against photoaging and skin cancer.

Top

References

  1. Abravaya, K, Meyers, MP, Murphy, SP, Morimoto, RI The human heat shock protein hsp70 interacts with HSF, the transcription factor that regulates heat shock gene expression. Genes Dev, 1992 6, 1153–1164,  | PubMed | ISI | ChemPort |
  2. Baler, R, Dahl, G, Voellmy, R Activation of human heat shock gene is accompanied by oligomerization, modification, and rapid translocation of heat shock transcription factor HSF1. Mol Cell Biol, 1993 13, 2486–2496,  | PubMed | ISI | ChemPort |
  3. Becker, J & Craig, EA Heat shock proteins as molecular chaperones. Eur J Biochem, 1994 219, 11–23,  | PubMed | ISI | ChemPort |
  4. Brunet, S & Giacomoni, PU Heat shock mRNA in mouse epidermis after UV irradiation. Mutation Res, 1989 219, 217–224,
  5. Chomczynski, P One-hour downward alkaline capillary transfer for blotting of DNA and RNA. Anal Biochem, 1992 201, 134–139,  | PubMed | ISI | ChemPort |
  6. Cotto, JJ, Kline, M, Morimoto, RI Activation of heat shock factor 1 DNA binding precedes stress-induced serine phosphorylation. Evidence for a multistep pathway of regulation. J Biol Chem, 1996 271, 3355–3358,  | Article | PubMed | ISI | ChemPort |
  7. Cotton, J & Spandau, DF Ultraviolet B-radiation dose influences the induction of apoptosis and p53 in human keratinocytes. Radiat Res, 1997 147, 148–155,  | PubMed |
  8. Dérijard, B, Hibi, M, Wu, I-H et al. JNK1: A protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell, 1994 76, 1025–1037,  | Article | PubMed | ISI | ChemPort |
  9. Devary, Y, Gottlieb, RA, Lau, LF, Karin, M Rapid and preferential activation of the c-jun gene during the mammalian UV response. Mol Cell Biol, 1991 11, 2804–2811,  | PubMed | ISI | ChemPort |
  10. Edwards, MJ, Marks, R, Dykes, PJ, Merrett, VR, Morgan, HE, O'donovan, MR Heat shock proteins in cultured human keratinocytes and fibroblasts. J Invest Dermatol, 1991 96, 392–396,  | Article | PubMed | ISI | ChemPort |
  11. Garmyn, M, Degreef, H, Gilchrest, BA The effect of acute and chronic photodamage on gene expression in human keratinocytes. Dermatology, 1995 190, 305–308,
  12. Georgopoulos, C & Welsh, WJ Role of the major heat shock proteins as molecular chaperones. Ann Rev Cell Biol, 1993 9, 601–634,  | Article |
  13. Hansen, LK, Houchins, JP, Leary, JJ Differential regulation of HSC70, HSP70, HSP90, and HSP90 mRNA express by mitogen activation and heat shock in human lymphocytes. Exp Cell Res, 1991 192, 587–596,  | PubMed |
  14. Heydari, AR, Wu, B, Takahashi, R, Strong, R, Richardson, A Expression of heat shock protein 70 is altered by age and diet at the level of transcription. Mol Cell Biol, 1993 13, 2909–2918,  | PubMed | ISI | ChemPort |
  15. Hibi, M, Lin, A, Smeal, T, Minden, A, Karin, M Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-Jun activation domain. Genes Dev, 1993 7, 2135–2148,  | PubMed | ISI | ChemPort |
  16. Holland, DB, Roberts, SG, Wood, EJ, Cuncliffe, WJ Cold shock induces the synthesis of stress proteins in human keratinocytes. J Invest Dermatol, 1993 101, 196–199,
  17. Huang, LE, Caruccio, L, Liu, AY, Cheng, KY Rapid activation of the heat shock transcription factor, HSF1, by hypo-osmotic stress in mammalian cells. Biochem J, 1995 307, 347–352,
  18. Kane, KS & Maytin, EV Ultraviolet B-induced apoptosis of keratinocytes in murine skin is reduced by mild local hyperthermia. J Invest Dermatol, 1995 104, 62–67,  | Article | PubMed | ISI | ChemPort |
  19. Kelfkens, G, de Gruijl, FR, van der Leun, JC Ozone depletion and increase in the annual carcinogeneic ultraviolet dose. Photochem Photobiol, 1990 52, 819–823,
  20. Li, Y, Ross, J, Scheppler, JA, Franza, BR An in vitro transcription analysis of early responses of the human immunodeficiency virus type1 long terminal repeat to different transcriptional activators. Mol Cell Biol, 1991 11, 1883–1893,
  21. Liu, RY, Li, X, Li, L, Li, GC Expression of human HSP70 in rat fibroblasts enhances cell survival and facilitates recovery from translational and transcriptional inhibition following heat shock. Cancer Res, 1992 52, 3667–3673,
  22. Maytin, EV Differential effects of heat shock and UVB light upon stress protein expression in epidermal keratinocytes. J Biol Chem, 1992 267, 23189–23196,  | PubMed | ISI | ChemPort |
  23. Maytin, EV, Murphy, LA, Merrill, MA Hyperthermia induces resistance to ultraviolet light B in primary and immortalized epidermal keratinocytes. Cancer Res, 1993 53, 4952–4959,  | PubMed | ISI | ChemPort |
  24. Maytin, EV, Wimberly, JM, Anderson, RR Thermotolerance and the heat shock response in normal keratinocytes in culture. J Invest Dermatol, 1990 95, 635–642,  | Article | PubMed | ISI | ChemPort |
  25. Mivechi, NF & Giaccia, AJ Mitogen-activated protein kinase acts as a negative regulator of the heat shock response in NIH3T3 cells. Cancer Res, 1995 55, 5512–5519,  | PubMed | ISI | ChemPort |
  26. Morimoto, RI Cells in stress: transcriptional activation of heat shock genes. Science, 1993 259, 1409–1410,  | PubMed | ISI | ChemPort |
  27. Morimoto, RI, Sarge, KD, Abravaya, K Transcriptional regulation of heat shock genes. A paradigm for inducible genomic responses. J Biol Chem, 1992 267, 21987–21990,  | PubMed | ISI | ChemPort |
  28. Morimoto, RI, Tissieres, A, Georgopoulos, C Stress protein in biology and medicine. In: Morimoto RI, Tissieres A, Georgopoulos C (eds). Stress Protein in Biology and Medicine. 1994 Cold Spring Harbor Laboratory Press, New York, pp. 1–36.
  29. Muramatsu, T, Hatoko, M, Tada, H, Shirai, T, Ohnishi, T Age-related decrease in the inductability of heat shock protein 72 in normal human skin. Br J Dermatol, 1996 134, 1035–1038,
  30. Muramatsu, T, Tada, H, Kobayashi, N, Yamji, M, Shirai, T, Ohnishi, T Induction of the 72-kD heat shock protein in organ-cultured normal human skin. J Invest Dermatol, 1992 98, 786–790,
  31. Muramatsu, T, Yamashina, Y, Tada, H et al. 8-methoxypsoralen plus UVA induces the 72 kDa heat shock protein in organ-cultured normal human skin. Photochem Photobiol, 1993 58, 809–812,
  32. Nunes, SL & Calderwood, SK Heat shock factor-1 and the heat shock cognate 70 protein associate in high molecular weight complexes in the cytoplasm of NIH-3T3 cells. Biochem Biophys Res Comm, 1995 213, 1–6,
  33. Peak, MJ, Peak, JG, Kochever, IE Solar ultraviolet effects on mammalian cell DNA. In: Fuchs J, Packer L (eds). Oxidative Stress in Dermatology. 1993 Marcel Dekker, New York, pp. 169–186.
  34. Plumier, JCL & Currie, RW Heat shock induced myocardial protection against ischemic injury: a role for HSP70? Cell Stress Chaperones, 1996 1, 13–17,  | Article | PubMed | ISI | ChemPort |
  35. Rabindran, SK, Wisniewski, J, Li, L, Li, GC, Wu, C Interaction between heat shock factor and hsp70 is insufficient to suppress induction of DNA-binding activity in vivo. Mol Cell Biol, 1994 14, 6552–6560,  | PubMed | ISI | ChemPort |
  36. Sambrook, JEF, Fritsch, F, Maniatis, T Molecular Cloning: A Laboratory Manual. 1988 Cold Spring Harbor Laboratory Press, New York, .
  37. Sarge, KD, Murphy, SP, Morimoto, RI Activation of heat shock transcription by heat shock factor 1 involves oligomerization, acquisition of DNA-binding activity, and nuclear localization and can occur in the absence of stress. Mol Cell Biol, 1993 13, 1392–1407,  | PubMed | ISI | ChemPort |
  38. Simon, MM, Reikerstorfer, A, Schwarz, A, Krone, C, Luger, TA, Jaattela, M, Schwarz, T Heat shock protein 70 overexpression affects the response to ultraviolet light in murine fibroblasts. Evidence for increased cell viability and suppression of cytokine release. J Clin Invest, 1995 95, 926–933,  | PubMed | ISI | ChemPort |
  39. Sorger, PK Heat shock factor and the heat shock response. Cell, 1991 65, 363–366,  | Article | PubMed | ISI | ChemPort |
  40. Suzuki, K & Watanabe, M Augmented expression of HSP72 protein in normal human fibroblasts irradiated with ultraviolet light. Biochem Biophys Res Comm, 1992 186, 1257–1264,
  41. Tavaria, M, Gabriele, T, Kola, I, Anderson, RL A hitchhiker's guide to the human Hsp70 family. Cell Stress Chaperones, 1996 1, 23–28,  | Article | PubMed | ISI | ChemPort |
  42. Trautinger, F, Kindås-mügge, I, Barlan, B, Neuner, P, Knobler, RM 72-kD heat shock protein is a mediator of resistance to ultraviolet B light. J Invest Dermatol, 1995 105, 160–162,  | Article | PubMed | ISI | ChemPort |
  43. Trautinger, F, Trautinger, I, Kindås-mügge, I, Metze, D, Luger, TA Human keratinocytes in vivo and in vitro constitutively express the 72-kD heat shock protein. J Invest Dermatol, 1993 101, 334–338,  | Article | PubMed | ISI | ChemPort |
  44. Young, AR Cumulative effects of ultraviolet radiation on the skin: Cancer and photoaging. Semin Dermatol, 1990 9, 25–31,  | PubMed | ISI | ChemPort |
Top

Acknowledgments

We gratefully acknowledge the technical assistance of Hong Ying Li and helpful discussions with Liren Tang. Caron Fournier assisted with preparation of the figures. Supported by grants from the Medical Research Council of Canada and from the Canadian Dermatology Foundation.

Extra navigation

.
ADVERTISEMENT