Pigmentation in animals and humans is in part determined by the relative amounts of pheomelanin (red/yellow) and eumelanin (brown/black) in the hair/skin, as well as by the presence or absence of melanocytes within the hair follicles or interfollicular epidermis in different skin regions (Thody et al. 1991;Halaban & Moellmann 1993;Prota et al. 1995). Alterations in genes encoding for factors concerned with melanocyte survival (e.g., c-kit and c-kit ligand) and for enzymes involved in pigment production (including tyrosinase and P polypeptide) are responsible for certain well-recognized pigmentatory disorders (reviewed in Halaban & Moellmann 1993;Spritz 1994). In animals, expression of the agouti gene results in the preferential production of pheomelanin, with ectopic expression of this gene causing obesity, diabetes, and a predisposition to tumor formation, in addition to changes in coat color (Bultman et al. 1992). Conflicting views originally existed on whether the agouti product acts through the melanocortin 1 receptor (MC1R) or through its own specific receptor in directing the production of pheomelanin, but the evidence now suggests that agouti's effect on pigmentation is through its action as an inverse agonist at the MC1R (Conklin & Bourne 1993;Jackson 1993;Siegrist et al. 1997). Despite the variation in the cutaneous expression of agouti between and within animals of different coat colors, the level of expression of agouti seems similar in human skin from different ethnic backgrounds (Bultman et al. 1992;Vrieling et al. 1994;Wilson et al. 1995). Alpha-melanocyte stimulating hormone and other proopiomelanocortin peptides, which are agonists for MC1R, also alter the pheomelanin/eumelanin ratio, resulting in the preferential production of eumelanin (Burchill et al. 1986;Chhajlani & Wikberg 1992;Mountjoy et al. 1992). Although an exogenous supply of alpha-melanocyte stimulating hormone can affect the degree of pigmentation of humans and animals, levels of this hormone in the plasma and the skin are similar in individuals with different skin type (Lerner & McGuire 1961;Spiro et al. 1987).
The MC1R is a seven pass transmembrane G-protein coupled-receptor of 317 amino acids, which is expressed in several cell types, including melanocytes and keratinocytes (Chhajlani & Wikberg 1992;Mountjoy et al. 1992;Healy et al. 1998). Variants of this receptor, some of which are known to differ in their ability to activate adenylyl cyclase, are associated with various coat colors in mice, cattle, horses, foxes, and chickens, whereas the MC1R gene is deleted in the red guinea pig (Cone et al. 1996;Joerg et al. 1996;Marklund et al. 1996;Takeuchi et al. 1996;Vage et al. 1997). We have previously shown that variants of the human MC1R (especially the Asp294His variant, where aspartate is replaced by histidine at codon 294) are associated with red hair and fair skin in individuals from a (predominantly) British population, and this association of red hair with variants has recently been confirmed in a study of Australian monozygotic and dizygotic twins (Valverde et al. 1995;Box et al. 1997). The relation of MC1R variants to these phenotypic characteristics is likely to be due to the presence of (at least some of) these variants affecting the alpha-melanocyte stimulating hormone signaling pathway in follicular melanocytes so that pheomelanin is preferentially synthesized; this may also be the case in human skin, but the exact relationship between skin type and pheomelanin/eumelanin production in the interfollicular epidermis in humans does not seem straightforward (Thody et al. 1991;Hunt et al. 1995). MC1R variants (especially the Asp84Glu variant, where aspartate is replaced by glutamate at codon 84) are also associated with susceptibility to sporadic melanoma, a relationship that seems largely independent of skin type (Valverde et al. 1996).
The studies to date on MC1R variants in humans have identified three areas within the gene where variants cluster, including the first transmembrane domain/first intracellular loop/second transmembrane domain, the second intracellular loop, and the seventh transmembrane domain (Valverde et al. 1995,1996;Box et al. 1997;Koppula et al. 1997). The identification of an association between red hair/fair skin and MC1R variants has provided a potential mechanism by which the normal variation in human skin and hair color can be investigated; however, in our original studies, individuals were selected from the extremes of hair color or skin type, and therefore they did not provide an adequate basis for the calculation of relative risks, for study of the mode of inheritance of the pigmentory phenotype, or for formal testing of which variants are significant in their effect on phenotype. We have therefore looked for MC1R variants in a consecutive series of volunteers from an Irish population, a population noted for sensitivity to ultraviolet radiation (Beirn et al. 1970). In addition, because the relative risk of developing red hair with the Asp294 variant was high, and because this change was the most frequent alteration detected in our original study (Valverde et al. 1995) and is easily detected using restriction fragment length polymorphism (RFLP) analysis, the frequency of this variant and its association with red hair was investigated in individuals from The Netherlands and Sweden. Furthermore, as an additional test of any association between genotype and phenotype, we have examined the frequency of the Asp294His variant in a group of subjects with nonmelanoma skin cancer(NMSC) and controls.
MATERIALS AND METHODS
Subjects from an Irish population
One hundred and two consenting consecutive Caucasian individuals (patients with psoriasis and staff in the City of Dublin Skin & Cancer Hospital, Ireland) were recruited as volunteers for the study. None of the volunteers were known to be genetically related to any other volunteer, and individuals with skin cancer (melanoma and nonmelanoma) were excluded; patients with psoriasis were chosen because there is no known association between psoriasis and skin type/hair color, and such a group is unlikely to be biased with respect to referral for skin cancer or atypical moles or sun sensitivity. Skin type was assessed by detailed personal interview using our previously modifiedFitzpatrick (1988) classification: I, always burns, never tans; between I and II, always burns, does not tan after one exposure, but tans lightly after several exposures; II, always burns, tans lightly after one exposure and after several exposures; between II and III, always burns but tans well; III, seldom burns, tans well; between III and IV, burns after longer exposure but tans very deeply or never burns but tans lightly; and IV, nevers burns, tans deeply (Valverde et al. 1996). Subjects were also graded on a four point scale (no tan, light golden, medium brown, and dark brown) according to how well they tanned following repeated exposures to natural sunlight. Hair color throughout life was documented using a chart of hair color standards (courtesy of Professor Hans Schaeffer, L'Oréal, Centre de Recherche, Clichy, France), and then classified into agreed hair color classes ("red,""fair," and "dark"); red hair color included strawberry blonde and auburn as well as red, whereas fair included blonde, fair, and light brown. Dark hair color consisted of medium brown, dark brown, and black. Scalp hair color at 20 y was employed in the analysis with MC1R variants. Other variables that were recorded included eye color at the time of interview (including the background iris color, the central iris color, and the presence of flecks of pigment scattered throughout the iris), the ability to freckle, and the individual's ancestry. A venous blood sample was collected from each subject, and genomic DNA was isolated as described previously (Valverde et al. 1995).
Identification of variants
Polymerase chain reaction (PCR) for the MC1R gene was carried out and variants were identified using a combination of sequencing and RFLP analysis. Automated and/or manual cycle sequencing of codons 1–200, which includes the first transmembrane domain/first intracellular loop/second transmembrane domain, and the second intracellular loop, was carried out for 71 samples, including all red haired individuals and a representative selection of all phenotypes present in the group of 102 subjects. PCR products were also analyzed by RFLP analysis using the enzymes AvaII (for codon 84 in the second transmembrane domain) and TaqI (for codon 294 in the seventh transmembrane domain); RFLP analysis for variants at codons 84 and 294 was carried out on all 102 samples. The oligonucleotide primers used for the initial PCR were 5'CTGGAGGTG-TCCATCTCTGAC3' and 5'ATGAAGAGCGTGCTGAAGACGA3' for the second transmembrane region, 5'GGTCCACCAGGGCTTTGGCCTT3' and 5'TGCCCAGCACACTTAAAGCGCGTGCA3' for the seventh transmembrane region, and 5'AGCACCATGAACTAAGCAGGACACCT3' and 5'TGATCACGTCAATGACAT-TGT3' for codons 1–200. Examination of these areas and codons of the MC1R should detect over 95% of sequence changes so far described. Manual sequencing was performed using the Sequitherm Cycle Sequencing kit (Epicentre Technologies) according to the protocol using the above primers, and products were separated on a 6% polyacrylamide gel and visualized by autoradiography. Automated sequencing was carried out with an M13 Rev primer (on PCR products that had been originally amplified using an M13 Rev-linked primer) using dye primer chemistry (Perkin Elmer, Warrington, Cheshire, U.K.) according to the manufacturer's instructions, and products were run on an Applied Biosystems 377 (Warrington, Cheshire, U.K.) automated sequencer. All putative variants were confirmed by repeat PCR and sequencing or RFLP analysis from genomic DNA.
Subjects from other populations and individuals with NMSC
Genomic DNA samples were also extracted from venous blood from 95 individuals from The Netherlands and 91 individuals from Sweden, who had been phenotyped with regard to hair color and skin type, and RFLP with TaqI (for codon 294) was carried out on these samples. Genomic DNA was also extracted from 57 subjects with NMSC (clinical and histologically confirmed), including 46 with basal cell carcinoma, eight with squamous cell carcinoma, 15 with actinic keratoses, and five with Bowen's disease (some patients had more than one type of NMSC lesion) from a U.K. population. The hair color and skin type of these subjects were recorded, and RFLP with TaqI (for codon 294) was carried out on their DNA. The control group from the U.K. population included 25 individuals who were friends or spouses of the NMSC patients, and a previously reported group of 44 subjects with psoriasis (Valverde et al. 1996); subjects with skin cancer were excluded from the control group.
RESULTS
The wild-type MC1R sequence was that reported byChhajlani & Wikberg (1992), except for Ala164Arg (alanine rather than arginine at codon 164) as this difference was observed in all 71 samples sequenced. Fifty-three of the 71 (75%) Irish individuals who were sequenced contained a variant allele, with 21 of these 53 (30% of the 71 individuals) having two variants; this latter group included subjects with homozygous variants. None of the other 31 Irish individuals in whom RFLP for codons 84 and 294 had been performed contained variants at these codons. The list of variants detected in the study are outlined in Table 1. The presence of any MC1R variant was associated with red hair in the Irish population (Table 2), and three variants in particular were over-represented in this red-headed group; Arg151Cys (arginine altered to cysteine at codon 151), Arg160Trp (arginine to tryptophan at codon 160), and Asp294His (Figures 1, 2). All 13 individuals with red hair in comparison with 16 of 58 subjects without red hair contained one of these three variants (p < 0.001), with eight of the 13 red heads and none of the 58 non-red heads either heterozygous for any two of these variants or homozygous for one of these variants (p < 0.001). Although three of five males with the Arg151Cys, Arg160Trp, and Asp294His variants who did not have red scalp hair had red facial (i.e., beard) hair, this was not significantly different to the frequency of red facial hair in males without red scalp hair and without any of these three variants (seven of 21 males whose DNA was sequenced). No individual without red scalp hair at age 20 y had red scalp hair at any other age, or red axillary or red pubic hair. The Val60Leu variant (valine to leucine at codon 60) was also observed frequently in the 71 individuals who were sequenced, and was over-represented in people with fair scalp hair, although this association was not statistically significant.
Figure 1.
Sequence of the anti-sense strand of the MC1R gene in two Irish individuals. The sequence on the left is from a subject with a wild-type sequence, whereas the sequence on the right is from a subject heterozygous for the Arg151Cys variant (GCG altered to ACG, i.e., CGC altered to TGC on sense strand).
Full figure and legend (50K)Figure 2.
Association of MC1R variants with scalp hair color at age 20 in individuals from an Irish population.
Full figure (13K)Table 2 - Relation of MC1R variants to phenotypic characteristics in the Irish population.
MC1R variants were more frequent in Irish subjects with fairer skin type (I, I–II, and II) than in those with darker skin type (II–III, III, III–IV, and IV), with 37 of 45 subjects (82.2%) with fair skin and 16 of 26 subjects (61.5%) with darker skin having a variant, and the presence of two variants was particularly associated with fair skin (Table 2). All of the variants that were related to red hair color were more frequent in the fair skinned individuals, although only the Arg160Trp was statistically significant (p = 0.046); none the less the Arg151Cys and Asp294His were more common in those with light skin type [14 of 45 (31%) vs three of 26 (12%), and seven of 63 (11%) vs one of 39 (3%)], respectively. When the skin pigmentation was analyzed according to the degree of tanning following repeated exposure to natural sunlight, the presence of any variant and the Arg151Cys variant was significantly more common in individuals who did not tan or tanned poorly (Table 2). The Val60Leu variant was not related to skin type. MC1R variants (including the Arg151Cys, Arg160Trp, and Asp294His variants) were more frequent in individuals who had freckles (Table 2); however, the Arg151Cys and Asp294His variants were associated with a greater degree of freckling as assessed by the number of skin sites where freckling occurred (four or more of the following sites; face, neck, shoulders, upper limbs, back, chest, and lower limbs) (p = 0.03 and p = 0.009, respectively). There was no association between the presence of MC1R variants (or any particular variant) and eye color. Despite the associations outlined above, MC1R variants were found in some individuals from all hair color and all skin type categories.
Because the relative risk (odds ratio) of developing red hair with the Asp294His variant was high in the Irish population, and because this variant was the most frequent in red heads in our original study (Valverde et al. 1995), we subsequently examined for this variant in a group of 95 individuals (including 33 with red scalp hair) from The Netherlands, and in a group of 91 subjects (20 with red hair) from Sweden. This variant was significantly more common in red headed people from The Netherlands (six of 33 vs none of 62, p = 0.001), but this was not the case in the subjects from Sweden (one of 20 vs none of 71). In the British NMSC patients, the Asp294His variant was also over-represented, with seven NMSC patients containing this variant in contrast to its complete absence in the control group (p = 0.003).
DISCUSSION
This population-based genetic study of the contribution of MC1R variants to the pigmentary phenotype, in contrast to our previous studies, concerns a population that was relatively unselected and the results provide an adequate basis for the study of relative risks and the mode of inheritance of the pigmentary phenotype. The Irish population was chosen because of the known high frequency of sun sensitive individuals. Our results suggest that the Arg151Cys, Arg160Trp, and Asp294His variants are of key relevance in determining the red-haired phenotype, and that the Asp294His variant is also an important determinant of red hair in Dutch people (as well as in the British population as reported in our original study on MC1R variants) (Valverde et al. 1995). All three variants showed some relation to fair skin, either using the modified Fitzpatrick classification, or by analysis with the degree of tanning.
The weaker association with skin type than with hair color may be due to the limitations imposed by the use of the Fitzpatrick classification (even in its modified form), because sensitivity to ultraviolet radiation-induced erythema is an important component of this classification, yet the relation of sensitivity to ultraviolet radiation-induced erythema to cutaneous pigmentation is not straightforward (Rampen et al. 1988). The use of the degree of tanning may circumvent this problem, but whether the degree of tanning is determined by the absolute amounts of eumelanin or phaeomelanin or the phaeomelanin/eumelanin ratio in the skin is also unclear (Thody et al. 1991;Hunt et al. 1995); however, the association of the Asp294His variant with NMSC provides independent evidence of the role of this locus in determining sun sensitivity, this analysis avoiding any subjectivity of assessment that might occur in the recording of pigmentation. Although we did not test for the codon 151 and 160 variants in this group, we would expect them also to be over-represented in NMSC patients.
The association of red hair and fair skin with either one or two (particular) MC1R variants is striking: in all cases with two variants where this included a combination of Arg151Cys, Arg160Trp, or Asp294His, the hair color was red and the skin type was fair; however, the presence of the exact same two variants (e.g., Arg151Cys and Arg160Trp) could result in either a definite red, a strawberry blonde, or an auburn hair color. Equally important, although the Arg151Cys, Arg160Trp, and Asp294His variants were detected in subjects without red hair, none of these cases were homozygous for any of these variants or had more than one of these three variants. These results shed important light on several aspects of pigmentation genetics. First, they imply a recessive mode of inheritance for red hair at this locus. In addition, because the presence of the same single variant in some people was associated with red hair but in other people was associated with another hair color, it raises the possibility that the gene function from the second wild-type allele may be reduced by alternative mechanisms in the red heads, or that these alleles harbor mutations outwith the area examined in this study. Second, other loci are clearly important in determining the exact color of the hair (i.e., auburn versus red in individuals with two identical variants). Evidence that the agouti product (at least in animals) can act as a competitive antagonist or an inverse agonist at the MC1R suggests other ways in which the relation between genotype and phenotype may be mediated, and may allow a fuller and tighter understanding of the role of the MC1R as a control point in human pigmentation. Third, our study only suggests a functional role for the Arg151Cys, Arg160Trp, and Asp294His variants. It is not possible to exclude a role for the other changes, due to the weak power of statistical testing of rarer alleles, but, for instance, in this study no evidence of a association between pigmentation and codon 92 variants was found. Finally, the high frequency of apparent polymorphisms of the MC1R is intriguing and suggests that the gene may be of interest in studying wider aspects of human evolutionary adaptation to the environment.
References
- Beirn, SF, Judge, P, Urbach, F, MacCon, CF, Martin, F: Skin cancer in County Galway, Ireland. Proc Natl Cancer Conf 1970 6: 489–500,
- Box, NF, Wyeth, JR, O'gorman, LE, Martin, NG, Sturm, RA: Characterisation of melanocyte-stimulating hormone receptor variant alleles in twins with red hair. Hum Mol Genet 1997 6: 1891–1897, | Article | PubMed | ISI | ChemPort |
- Bultman, SJ, Michaud, EJ, Woychik, RP: Molecular characterization of the mouse agouti locus. Cell 1992 71: 1195–1204, | PubMed | ISI | ChemPort |
- Burchill, SA, Thody, AJ, Ito, S: Melanocyte-stimulating hormone, tyrosinase activity and the regulation of eumelanogenesis and phaeomelanogenesis in the hair follicular melanocytes of the mouse. J Endocrinol 1986 109: 15–21, | PubMed | ISI | ChemPort |
- Chhajlani, V & Wikberg, JES: Molecular cloning and expression of the human melanocyte stimulating hormone receptor cDNA. FEBS Lett 1992 309: 417–420, | Article | PubMed | ISI | ChemPort |
- Cone, RD, Lu, D, Koppula, S, et al. The melanocortin receptors: agonists, antagonists, and the hormonal control of pigmentation. Recent Prog Horm Res 1996 51: 287–317, | PubMed | ISI | ChemPort |
- Conklin, BR, Bourne, HR: Mouse coat colour reconsidered. Nature 1993 364: 110, | Article | PubMed | ISI | ChemPort |
- Fitzpatrick, TB: The validity and practicality of sun-reactive skin types I through VI. Arch Dermatol 1988 124: 869–871, | Article | PubMed | ISI | ChemPort |
- Halaban, R & Moellmann, G: White mutants in mice shedding light on humans. J Invest Dermatol 1993 100( Suppl. 2): 176S–185S, | Article | PubMed | ChemPort |
- Healy, E, Birch-machin, M, Rees, JL. The human MC1R. In: Lund DB, Cone RD (eds). The Melanocortin Receptors. Humana Press, New Jersey, 1998
- Hunt, G, Kyne, S, Ito, S, Wakamatsu, K, Todd, C, Thody, AJ: Eumelanin and phaeomelanin contents of human epidermis and cultured melanocytes. Pigment Cell Res 1995 8: 202–208, | PubMed | ISI | ChemPort |
- Jackson, IJ: Colour-coded switches. Nature 1993 362: 587–588, | Article | PubMed | ISI | ChemPort |
- Joerg, H, Fries, HR, Meijerink, E, Stranzinger, GF: Red coat color in holstein cattle is associated with a deletion in the MSHR gene. Mammalian Genome 1996 7: 317–319,
- Koppula, SV, Robbins, LS, Lu, D, Baack, E, White, CR Jr, Swanson, NA, Cone, RD: Identification of common polymorhpisms in the coding sequence of the human MSH receptor (MC1R) with possible biological effects. Hum Mutation 1997 9: 30–36, | Article | ISI | ChemPort |
- Lerner, AB, McGuire, JS: Effect of alpha- and beta-melanocyte stimulating hormones on the skin colour of man. Nature 1961 189: 176–179, | Article | PubMed | ISI | ChemPort |
- Marklund, L, Johansson, M, Sandberg, K, Andersson, L: A missense mutation in the gene for melanocyte-stimulating hormone receptor (MC1R) is associated with the chestnut coat color in horses. Mammalian Genome 1996 7: 895–899,
- Mountjoy, KG, Robbins, LS, Mortrud, MT, Cone, RD: The cloning of a family of genes that encode the melanocortin receptors. Science 1992 257: 1248–1251, | PubMed | ISI | ChemPort |
- Prota, G, Lamoreux, ML, Muller, J, et al. Comparative analysis of melanins and melanosomes produced by various coat color mutants. Pigment Cell Res 1995 8: 153–163, | PubMed | ISI | ChemPort |
- Rampen, FH, Fleuren, BA, de Boo, TM, Lemmens, WA: Unreliability of self-reported burning tendency and tanning ability. Arch Dernatol 1988 124: 885–888,
- Siegrist, W, Drozdz, R, Cotti, R, Willard, DH, Wilkison, WO, Eberle, AN: Interactions of alpha-melanotropin and agouti on B16 melanoma cells: evidence for inverse agonism of agouti. J Receptor Signal Transduction Res 1997 17: 75–98,
- Spiro, J, Parker, S, Oliver, I, Fraser, C, Marks, JM, Thody, AJ: Effect of PUVA on plasma and skin immunoreactive alpha-melanocyte stimulating hormone concentrations. Br J Dermatol 1987 117: 703–707,
- Spritz, RA: Molecular basis of human piebaldism. J Invest Dermatol 1994 103 (Suppl. 5): 137S–140S, | Article | PubMed | ChemPort |
- Takeuchi, S, Suzuki, H, Yabuuchi, M, Takahashi, S: A possible involvement of melanocortin 1-receptor in regulating feather color pigmentation in the chicken. Biochim Biophys Acta 1996 1308: 164–168, | Article | PubMed | ISI | ChemPort |
- Thody, AJ, Higgins, EM, Wakamatsu, K, Ito, S, Burchill, SA, Marks, JM: Pheomelanin as well as eumelanin is present in human epidermis. J Invest Dermatol 1991 97: 340–344, | PubMed | ISI | ChemPort |
- Vage, DI, Lu, D, Klungland, H, Lien, S, Adalsteinsson, S, Cone, RD: A non-epistatic interaction of agouti and extension in the fox, vulpes vulpes. Nature Genet 1997 15: 311–315, | Article |
- Valverde, P, Healy, E, Jackson, I, Rees, JL, Thody, AJ: Variants of the melanocyte-stimulating hormone receptor gene are associated with red hair and fair skin in humans: Nature Genet 1995 11: 328–330, | Article |
- Valverde, P, Healy, E, Sikkink, S, et al. The Asp84Glu variant of the melanocortin 1 receptor (MC1R) is associated with melanoma. Hum Mol Genet 1996 5: 1663–1666, | Article | PubMed | ISI | ChemPort |
- Vrieling, H, Duhl, DM, Millar, SE, Miller, KA, Barsh, GS: Differences in dorsal and ventral pigmentation result from regional expression of the mouse agouti gene. Proc Natl Acad Sci USA 1994 91: 5667–5671, | PubMed | ChemPort |
- Wilson, BD, Ollmann, MM, Kang, L, Stoffel, M, Bell, GI, Barsh, GS: Structure and function of ASP, the human homolog of the mouse agouti gene. Hum Mol Genet 1995 4: 223–230, | PubMed | ISI | ChemPort |
Acknowledgments
We are grateful to the staff of the City of Dublin Skin and Cancer Hospital for their assistance during this study. EH is a Medical Research Council Clinician Scientist Fellow.



