TABLE 2
FROM:
Improved group-specific PCR primers for denaturing gradient gel electrophoresis analysis of the genetic diversity of complex microbial communities
Martin Mühling, John Woolven-Allen, J Colin Murrell and Ian Joint
BACK TO ARTICLETable 2. Nested PCR approach with DGGE primers
| Primers used for group-specific PCR | Primers used for re-PCR for DGGE a | AT (semi-) nested PCR (°C) | Denaturing gradient used for DGGE (%) b |
|---|---|---|---|
| Alf28f/Alf684r | 341f-GC/518r | 56 | 40–60 |
| Beta359f/Beta682r | 518f-GC/Beta682r | 60 | 40–55 |
| Gamma395f/Gamma871r | 518f-GC/785r | 56 | 40–60 |
| CFB555f/CFB968r | CFB555f-GC/907r | 64 | 40–60 |
| CYA361f/CYA785r | 518f-GC/CYA785r | 56 | 40–55 |
| Plancto352f/Plancto920r | 518f-GC/907r | 60 | 40–60 |
| Firm350f/Firm814r | 518f-GC/785r | 56 | 40–60 |
| 9bfm/1512uRc | 341f-GC/518r | 56 | 40–60 |
Abbreviations: AT, annealing temperature; DGGE, denaturing gradient gel electrophoresis.
PCR products produced with the group-specific primers were reamplified using a set of bacterial or universal DGGE primers.
a Nucleotide sequences of the primers, which have been published previously, and the GC clamp are: 341f, CCTACGGGAGGCAGCAG (Muyzer et al., 1993); 518f, CCAGCAGCCGCGGTAAT (Muyzer et al., 1993); 518r, ATTACCGCGGCTGCTGG (Muyzer et al., 1993); 785r, CTACCAGGGTATCTAATCC (Lee et al., 1993); 907r, CCGTCAATTCMTTTGAGTTT (Muyzer et al., 1998); GC clamp, CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG (Muyzer et al., 1993); Please note, the sequence of the bacterial primer 785r (E. coli position 785–803) matches 81.2% of all 16S rRNA gene sequences in the ROSE database, but only 1% of the Cyanobacteria/chloroplast 16S rRNA gene sequences.
b 100% denaturant contains 7 M urea and 40% (v/v) formamide.
c The approach taken for DGGE analysis of the domain bacteria involved reamplification also.
