TABLE 1
FROM:
Improved group-specific PCR primers for denaturing gradient gel electrophoresis analysis of the genetic diversity of complex microbial communities
Martin Mühling, John Woolven-Allen, J Colin Murrell and Ian Joint
BACK TO ARTICLETable 1. Summary of group-specific 16S rRNA gene PCR primers, their specificity towards taxonomic groups as revealed by in silico analysis and the annealing temperatures used in the PCR reactions
| Primer a | Target group |
Sequence (5'  3')
| Escherichia coli position | Includes variable regions | Identical matches within target group b | Percentage matches within the target group (%) c | Matches outside target group b | AT group-specific PCR for clone libraries (°C) | 16S rRNA gene fragment used for 'Probe Match' d | Reference |
|---|---|---|---|---|---|---|---|---|---|---|
| Alf28fe | Alphaproteobacteria | ARCGAACGCTGGCGGCA | 28–44 | V1–V4 | 891 | 81.2 (83.6) | 13 | 69 | 1–100 | Ashelford et al. (2002) f |
| Alf684re | Alphaproteobacteria | TACGAATTTYACCTCTACA | 684–702 | 1359 | 88.5 (89.3) | 242 | 650–750 | This study | ||
| Beta359f | Betaproteobacteria | GGGGAATTTTGGACAATGGG | 359–378 | V3–V4 | 851 | 93 0 (88.8) | 10 | 63 | 300–400 | Ashelford et al. (2002) f |
| Beta682r | Betaproteobacteria | ACGCATTTCACTGCTACACG | 682–701 | 701 | 86.4 (82.4) | 6 | 650–750 | Ashelford et al. (2002) f | ||
| Gamma395f | Gammaproteobacteria | CMATGCCGCGTGTGTGAA | 395–412 | V3–V5 | 1412 | 52.8 (59.1) | 203 | 54 | 350–450 | This study |
| Gamma871r | Gammaproteobacteria | ACTCCCCAGGCGGTCDACTTA | 871–891 | 1579 | 64.8 (62.1) | 50 | 850–950 | This study | ||
| CFB555f | Bacteroidetes | CCGGAWTYATTGGGTTTAAAGGG | 555–577 | V4–V5 | 549 | 83.9 (85.0) | 2 | 61 | 500–600 | This study |
| CFB968r | Bacteroidetes | GGTAAGGTTCCTCGCGTA | 968–985 | 573 | 90.5 (92.2) | 305 | 900–1000 | This study | ||
| CYA361f | Cyanobacteria, chloroplasts | GGAATTTTCCGCAATGGG | 361–378 | V3–V4 | 434 | 91.0 (92.2) | 16 | 59 | 300–400 | This study |
| CYA785r | Cyanobacteria, chloroplasts | GACTACWGGGGTATCTAATCC | 785–805 | 345 | 88.2 (87.8) | 42 | 750–850 | This study | ||
| Plancto352fe | Planctomycetes | GGCTGCAGTCGAGRATCT | 350–367 | V3–V5 | 209 | 84.0 (87.4) | 140 | 68 | 300–400 | This study |
| Plancto920re | Planctomycetes | TGTGTGAGCCCCCGTCAA | 920–937 | 103 | 98.1 (87.1) | 6 | 900–1000 | This study | ||
| Firm350fe | Firmicutes | GGCAGCAGTRGGGAATCTTC | 350–369 | V3–V4 | 1140 | 24.9 (37.7) | 7 | 57 | 300–400 | This study |
| Firm814re | Firmicutes | ACACYTAGYACTCATCGTTT | 814–833 | 1087 | 25.1 (30.2) | 17 | 750–850 | This study | ||
| 9bfm | Bacteria | GAGTTTGATYHTGGCTCAG | 9–27 | V1–V9 | 3101 | 77.7 (86.4) | 1 | 52 | 1–100 | This study |
| 1512uR | Universal (bacteria and archaea) | ACGGHTACCTTGTTACGACTT | 1492–1512 | 3284 | 78.5 (80.0) | 52 | 1450–1542 | Weisburg et al. (1991) |
Abbreviations: AT, annealing temperature; FISH, fluorescence in situ hybridization.
a The number in the primer name indicates the starting position of the primer sequence within the E. coli 16S rRNA gene sequence.
b Information based on analysis using the ROSE function within PRIMROSE; percentage of positive hits depends on number of sequences in the database with sufficient information; there is less information available for the termini compared to the centre of the 16S rRNA gene.
c Numbers in brackets indicate percentage matches within target group as obtained from using the online tool 'Probe Match' within the Ribosomal Database Project-II (RDP-II) database.
d Numbers indicate E. coli position; the longest 16S rRNA gene sequences in the RDP are 1542 bases.
e The template for the PCR was the PCR product obtained with primers 9bfm/1512uR.
f These primers were suggested for use as FISH probes by Ashelford et al. (2002), but have not yet been tested.
