 Subjects and methods
Subjects and protocol
The protocol was approved by the local Ethics committee. Fifteen healthy non-obese male subjects with a mean age of 33.3 y (range 24-48 y) were investigated after they had given informed written consent. The BMI ranged from 21.9 to 25.1 kg/m2 and averaged 23.5.±0.3 (±s.e.m.) kg/m2. The subjects fasted overnight and arrived in the laboratory at 08:00 h. They rested in the sitting position for 30 min. Thereafter a blood sample was obtained from an antecubital vein.
The following parameters were recorded or measured: age (y), weight (kg), height (cm), BMI (body weight in kg/(height in m)2), the waist-hip ratio, serum cortisol and leptin. GCR,  2-adrenoceptor and c-fos mRNA concentrations were measured by RT-PCR and HPLC for separation of standard and unknown and for quantification.4,5
Isolation of lymphocytes
Blood for isolation of lymphocytes was sampled in tubes with EDTA as anticoagulant: mononuclear cells mainly lymphocytes were isolated by density centrifugation on LymphoprepÔ (Nycomed Pharma, Oslo, Norway). Initially blood was layered on LymphoprepÔ and centrifuged for 30 min at 1400 rpm (394 g) and 21°C. Lymphocytes were isolated and washed three times in RPMI 1640 medium with Hepes buffer (Life Technologies, Denmark) with bovine serum albumin (0.5%) at 4°C. Erythrocytes and 99% of the thrombocytes were removed by the isolation procedure. The lymphocyte cell concentration was adjusted to 5´106 cells per tube and resuspended in isotonic NaCl. Samples were then centrifuged, drained and frozen in liquid nitrogen and stored at -80°C.
Quantification of the GCR,  2-adrenoceptor and c-fos mRNA in lymphocytes
mRNA in lymphocytes was quantified by RT-PCR and HPLC. The technique has been described in detail elsewhere.4,5
Primers and the construction of internal standard
The oligonucleotide primers were synthesized at DNA Technology (Aarhus, Denmark). For quantification of GCR mRNA we used the following primers, which did not distinguish between differentially spliced  /2 and transcripts (U01351): 5' primer¾CAG-CAGGCCACTACAGGAGT (no. 1997-2016), and 3' primer¾CCCAGAGCAAATGCCATAAG (no. 2322-2303).
For quantification of 2-adrenoceptor mRNA we used the following primers (M15169): 5' primer¾CGCTTCCATGTCCAGAACCT (no. 2302-2321), and 3' primer¾CTGTTCCACGTGATATCCAC (no. 2697-2678).
For quantification of c-fos mRNA we used the following primers (V01512): 5' primer¾GGC-TTCAACGCAGACTACGAGG (no. 301-322); and 3' primer¾CTCCTGTCATGGTCTTCACAACG (no. 1393-1371).
An internal standard DNA for the GCR mRNA, 2-adrenoceptor mRNA and c-fos mRNA was constructed using the above-mentioned two sets of primers and the PCR-MIMICÔ construction kit from Clontech. The size of the internal standard was designed to be 596 bp for the GCR internal standard, 240 bp for the 2-adrenoceptor internal standard and 601 bp for the c-fos internal standard.
An internal standard RNA for the GCR mRNA, the 2-adrenoceptor mRNA and the c-fos mRNA was constructed mainly as described by Faure et al.6 The resulting internal standard RNA was quantified by UV-detection (Gene-Quant II, Pharmacia, Sweden). The resulting RT-PCR products were indistinguishable from the internal standard DNA.
The GCR primers mentioned above did not distinguish between the predominant /2 transcripts and the -transcript of the GCR-mRNA formed by differential splicing. We therefore also evaluated our results using a set of primers specific to the /2 form (U01351): 5' primer¾GTATTG AATTCCCCGAGATG (no. 2733-2752); and 3' primer¾ACAGACTTTGGGCACTGG (no. 3158-3141).
Isolation of RNA and determination of total RNA and DNA
RNA was isolated from lymphocytes using the RNeasy blood kit from Qiagen (Gmbh). After the lysis step 20  l were removed for the determination of DNA. Elution was with DEPC-H2O at a concentration of 107 mononuclear cells per ml. 70 m l were used for measuring the total RNA concentration by a Pharmacia Gene-Quant II.
The DNA concentration was measured by H33258 fluorescence (DyNAQuant 200 apparatus, Hoefer Pharmacia Biotech).
Reverse transcription
Before reverse transcription the RNA was treated with 1 IU RQ1 RNAse-free DNAse (Promega) for 15 min at 37°C. The DNAse was subsequently heat-inactivated by incubation at 60°C for 5 min. The reverse transcription mixture contained: RNA from 105 lymphocytes; internal standard RNA (see Table 1); 225 pmol 3'-primer; 1 mM of each dNTP, 60 U MMLV-RT (Promega), and 40 U RNA-guard in 25 l Promega RT-buffer (50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM DTT). Incubation was at 37°C for 60 min, and the cDNA was stored frozen at -80°C or used immediately.
PCR
For the PCR reactions 3 l cDNA aliquots were combined with 40 pmol of each primer, 150 M of each dNTP, 0.2 U Taq polymerase (Pharmacia) in the supplied PCR reaction buffer, at 0°C in a volume of 100 l, and overlayered with mineral oil. The amplification took place in a Perkin Elmer Model 480 thermocycler: after initial denaturation at 95°C for 2 min the reactions were cycled through 27 cycles consisting of 94°C for 45 s, annealing (Table 1) for 45 s and 72°C for 90 s. After the last cycle the incubation continued for 5 min, whereupon the temperature was lowered to 4°C. The PCR products were either used for HPLC immediately or stored frozen at -80°C.
Quantification of PCR products by HPLC
The HPLC system consisted of a TSKÒ DEAE-NPR column (4.6 mm i.d.´ 35 mm, with a short guard column), thermostated at 30°C. The mobile phase was a gradient: Buffer A¾25 mM Tris-HCl, pH 9.0, 1.0 M NaCl; buffer B¾25 mM Tris-HCl, pH 9.0. The gradient was from 25% to 54% A in 0.5 min, 54% to 59% A in 6.5 min, 59% to 70% A in 0.5 min, 70% A for 1.0 min, 70% to 25% A in 0.5 min, 25% A in at least 3.0 min, all with a flow of 1.0 ml/min. The pump was a Waters Model 616 gradient pump controlled by MillenniumÒ 32 software, which was also applied for data acquisition and processing. Detection was by an Applied Biosystems Model 759A UV-detector at 254 nm.
Ninety microliters were injected by a manual injector. The PCR product was quantified relative to the internal standard using areas and corrected for the different sizes of the two products. mRNA concentrations are expressed relative to the total (RNeasy) RNA content of the samples as amol mRNA/g total RNA.
Validation of the technique
The amplification rate was exponential up to at least 27 cycles for both standard and unknown. The amplification was close to the theoretical rate of 2n (n=number of cycles) which can be obtained. The standard curve was linear, provided the ratio of the cDNA/standard area was between 0.5 and 4. When the calculated ratio exceeded this limit the sample was reanalysed with a reduced amount of mRNA added to RT.
Controls with no RT and no cDNA were run frequently. No contamination of sample mRNA with genomic DNA was observed.
The sequence of the PCR-products were confirmed by dideoxy-sequencing using the Perkin-Elmer dRhodamine Terminator Cycle Sequencing Chemistry and an ABI 310 Applied Systems apparatus for separation and fluorescence detection.
The sensitivity of the assay was approximately 0.004 amol RNA corresponding to 5000 AU's.
Reproducibility. The Intra-assay coefficients of variations for the whole procedure (isolation of mRNA, RT and PCR) were 8.7% for the GCR receptor mRNA and 17% for the 2-adrenoceptor mRNA. The PCR procedure alone showed consistently a high degree of reproducibility (coefficient of variation=6%).
Measurements of serum cortisol and leptin
Serum leptin and cortisol were measured by radioimmunoassay. The cortisol assay was purchased from Diagnostic Systems Laboratories, Texas, USA. The intra-assay coefficient of variation was 6.1% for a serum cortisol value in the normal range. The human leptin RIA kit was purchased from DRG Instruments, Marburg, Germany. The intrassay coefficient of variation was 5.3% for a serum leptin value in the normal range.
Statistics
Correlations were performed using the Spearman Test (Rs). Linear regression (r) was also performed. Multiple regression analysis and backward stepwise regression were performed by the SigmaStat programme version 1.02. A P value <0.05 was considered significant.
| 
2-adrenoceptor mRNA and c-fos mRNA concentrations measured by RT-PCR-HPLC. 
g total RNA and 1.4±0.1 amol/
2-adrenoceptor mRNA and isoproterenol-induced relaxation of isolated uterine strips. J Endocrinol 1997; 153: 393-399.
g total RNA). Results were obtained in 15 normal-weight subjects.