Introduction

Diseases caused by human immunodeficiency virus (HIV) and human papillomaviruses (HPV) are endemic in man, and a considerable cause of mortality. It has been estimated that there were approximately 30 million HIV-infected individuals worldwide at the beginning of 1998.¹ Papillomavirus (PV) infection is related to cervical cancer, the second commonest cause of cancer death among women worldwide.² Both HPV and HIV are sexually transmitted viruses, and it is therefore reasonable to generate a vaccine that could prevent infection with both viruses. For most developing countries, a safe and effective vaccine offers the only hope of controlling the spread of diseases caused by HPV and HIV. Such a vaccine should, in addition to inducing neutralizing antibody to reduce primary infection, elicit CTL at entry sites that could help to clear virus infected cells.³

Papillomavirus major capsid proteins can self-assemble into virus-like particles (VLP) when expressed in eukaryotic cells.^{4, 5, 6} Papillomavirus VLP have been used to elicit high titres of systemic neutralizing antibodies, which provide protection from experimental challenge with an infectious virus in animal PV models.⁷ A C-terminal truncation mutant of L1 protein can form VLP,⁸ and up to 60 amino acids (aa) can be fused into this region without disrupting its ability to form VLP,⁹ although not all sequence modifications preserve the ability of L1 to form VLP. We have previously fused an H-2^d restricted HIV1 P18 CTL epitope and an H-2^b restricted HPV16E7 epitope to the C-terminal of BPV1L1.^{10, 11} Expression in insect cells of chimeric recombinant BPV1L1 proteins results in VLP with morphology similar to that of wild-type L1 VLP, and these VLP elicit specific antibody and CTL responses when administered systemically to mice.¹¹ Chimeric HPV16 VLP with HPV16E7 fused to L2 protein could induce tumour protective immunity against E7 in an HPV16 tumour model.¹² BPV1 VLP incorporating a HPV 16E7 CTL epitope could also elicit systemic CTL responses when administered intranasally.¹³ Here, we investigate whether mucosal administration of chimeric PV VLP could elicit mucosal cellular and humoral immune responses to VLP and incorporated epitopes, and whether the mucosal and T-cell responses were dependent on the assembly of chimeric L1 protein into VLP.

Materials and Methods

Mice and cell lines

Four to eight-week-old female BALB/c (H-2^d) mice were purchased from the Animal Resource Centre (ARC; Perth, WA, Australia). The P815 mastocytoma cell line (H-2^d) was maintained in complete RPMI-1640 medium plus 10% foetal bovine serum (FBS; CSL, Melbourne, Vic., Australia). The Sf-9 cell line was cultured in Sf-900II medium (Life Technologies, Grand Island, NY, USA) with 10% FBS. HIV1 P18 peptides RIQRGPGRAFVTIGK (single letter amino acid code) and RGPGRAFVTI were synthesized by Chiron (Melbourne, Vic., Australia).

Construction of recombinant baculovirus transfer vectors

Construction of a baculovirus encoding a BPV1/HIV1 P18 chimeric recombinant protein has been described elsewhere.¹¹ To construct a recombinant baculovirus encoding a fusion protein of BPVL1 and the 42 aa of the HIV-1 V3 loop, two primers: GATGGGATATCCAATCTGTAGAAATTAATTGTACAAGACCCAAGAAC and TAGCCGATATCTCTAGATTACTTTTTCTTCTTCTTGTTACAATGTGCTTGTCTCATATTT were designed to amplify the V3 loop of HIV I IIIb. The forward primer has an EcoR V site and the backward primer has an EcoR V and an XbaI site, underlined. These primers were used to amplify the V3 loop sequence of gp120 of HIV1 IIIb. The PCR product was digested with EcoR V and ligated into plasmid pUCBPVL1,⁸ previously digested with EcoR V to remove the sequence encoding aa 471–495 from the BPV-1 L1 gene. A successful ligation product was cloned and amplified, and the BPV1L1HIV-V3 fusion gene was cut from the resultant plasmid with BamHI. The chimeric L1-V3 gene was ligated into the BamHI site of baculovirus expression plasmid pvL1393 Figure 1). The orientation of the inserted V3 fragment was checked using the XbaI site at the C-terminal of the V3 loop and sequenced. The DNA sequencing demonstrated a three amino acid difference from the P18I10 CTL epitope.

Figure 1.

Construction of a BPV1 L1 – HIV1 IIIb V3 chimeric protein baculovirus expression vector. The relevant HIV1 IIIb V3 sequence was amplified by PCR and inserted into an EcoR V restriction site at the C-terminal of the BPV L1 gene in pUc18. The chimeric BPVL1-HIV1 IIIbV3 gene was excised with BamHI and inserted into a baculovirus transfer vector (pvL1393) at the BamHI site to produce a baculovirus intermediate vector designated pL1V3.

Full figure and legend (37K)

Production of recombinant baculoviruses

An L1-V3 recombinant baculovirus was produced using a BaculoGold transfection kit (Pharmingen, San Diego, CA, USA) as described elsewhere.¹¹ VLP were purified from the nuclei of Sf9 cells infected with L1 recombinant baculovirus by CsCl gradient centrifugation as previously described.¹⁴ VLP with a density of 1.28 g/mL were collected and dialysed extensively against PBS.

Western immunoblot analysis

Virus-like particle samples were diluted in SDS-PAGE sample buffer, boiled at 100°C for 10 min, and electrophoresed through a 10% SDS-PAGE gel, and then transferred to nitrocellulose membrane. The membrane was blocked with 5% skim milk in PBS, and probed with the anti-L1 mAb MC15¹⁵ at a dilution of 1:2000. Bound antibody was detected by incubation of the membrane with HRP sheep antimouse antibody (Silenus, Vic., Australia) at a dilution of 1:1000, and visualized using diaminobenzidine (DAB) (Sigma; St Louis, MO, USA).

Transmission electron microscopy

CsCl gradient-purified and dialysed VLP samples were mounted onto carbon-coated grids stained with 2% ammonium molybdate (pH 6.2) and examined with a Hitachi H-800 electron microscope.

Immunization of mice

Groups of four 4–8-week-old female BALB/c mice were immunized on day 0 and day 14 with VLP i.m., i.va., or i.r. Sera, vaginal washes and intestine washes were collected after a further 7 days, and stored at -70°C until use. Vaginal secretions were collected by washing the vaginal tracts with 100 L of sterile PBS. Intestinal washes were collected by washing the intestine with 1 mL sterile PBS. Samples were centrifuged at 6000 r.p.m. for 5 min and stored at -70°C before testing.

Cytotoxic T lymphocyte assays

Immunized mice were killed on day 21. Spleens were removed, and a single cell suspension was made using nylon mesh. Lymphocytes were cultured in complete RPMI-1640 medium supplemented with 10 U/mL rIL-2 (Sigma) for 6 days. Peyer's patches were removed from the intestine walls and dissociated into single cells as described,³ and single lymphocytes were isolated by centrifugation through a discontinuous 45% and 75% Percoll (Sigma) gradient. Lymphocytes were cultured with 10 U/mLrIL-2 and 0.1 mol/L P18I10 peptide for 6 days. For HIV P18 specific CTL assays, P815 cells were washed once with serum-free complete RPMI and labelled with 100 Ci of ⁵¹Cr/10⁷ cells. Excess ⁵¹Cr was removed using the FBS underlay technique. ⁵¹Cr labelled P815 cells were exposed to peptide (RGPGRAFVTI) for 3 h and washed prior to use in the lytic assay. Effector cells and labelled target cells were plated into 96-well round bottom plates at various effector/target ratios, and incubated at 37°C, 5% CO₂ for 5 h. One hundread microlitres of supernatant was collected from each well for counting with a gamma counter. The percentage of specific lysis was calculated as specific lysis = (sample release - spontaneous release)/(maximum release - spontaneous release) 100. Maximum release was generated by adding 100 L of 10% SDS to 100 L of target cells, and spontaneous release was assayed from 100 L of target cells incubated with 100 L of medium. Assays were performed in triplicate and spontaneous ⁵¹Cr release from the various targets did not exceed 15%. Each set of results represents the mean from two independent experiments.

ELISA assay for VLP-specific IgA and IgG antibodies

Measurement of specific IgA and IgG antibodies in serum and mucosal washes was performed in flat-bottomed polystyrene micro­titre plates. Plates were initially coated with 50 L of BPVL1 at 10 g/mL or 50 g/mL of peptide HIV IIIb P18 RIQRGPGRAFVTIGK overnight at 4°C. The plates were washed using 0.5% PBS Tween20 and serial dilutions of mucosal washes or sera were added. After incubation at 37°C for 1 h, the plates were washed three times, and HRP-conjugated goat antimouse IgA or IgG (Sigma) was added at 1:1000 dilutions. Substrate was added and plates read at 495 nm using a Bio-Rad4500 reader. Sera were pooled by group. All assays were run at least in duplicate and the results were averaged. Results represent the mean of at least two independent experiments.

Results

Construction of hybrid BPVL1-HIVV3 VLP

Broadly neutralizing mAb directed against V3 loop have been recovered from humans infected with HIV-1 who progress slowly to AIDS,¹⁶ and HIV-infected chimpanzees develop neutralizing antibodies targeted to the V3 loop of HIV envelope protein. We, therefore, constructed a chimeric PV VLP incorporating a 43 aa fragment of the V3 loop. The C-terminal coding sequence of BPV-1 L1, corresponding to L1 aa residues 471–495 was replaced by a PCR-derived oligo­nucleotide encoding a 43 aa fragment of the V3 loop of the gp120 protein of HIV1 IIIb. This was cloned into baculovirus intermediate vector pvL1393, and a recombinant baculovirus, designated rBV BPVL1V3 Figure 1), was used to generate chimeric VLP in Sf9 cells. Virus-like particles purified by density flotation were confirmed by electron microscopy to have an appropriate conformation Figure 2b) and were demonstrated immunoreactive for L1 using mAb MC15.¹⁵ The apparent molecular weight on SDS PAGE of the chimeric BPVL1V3 protein was slightly larger Figure 2a) than that of chimeric BPVL1 HIVP18 (L1P18) protein and of BPV1 L1, as predicted from the additional amino acid sequence. DNA sequencing results showed three amino acid differences in the L1V3 plasmid from the published H-2^d restricted P18I10 CTL epitope Figure 1). Thus, the V3 construct was held unlikely to induce a P18-specific CTL response, but was expected to induce V3 specific humoral immune responses.

Figure 2.

(a) Ultrastructure of purified chimeric BPV1 L1VLP. P18 (i) VLP and (ii) V3 VLP were purified as described in the Materials and Methods from Sf9 cells infected with the appropriate recombinant baculovirus. The marker bar is 50 nmol/L. (b) Immunoblot detection of BPVL1 protein. CsCl gradient-purified BPV1 L1, P18 VLP and V3 VLP were separated by SDS-PAGE, blotted onto nitrocellulose membrane, probed with mAb MC15 and detected by diaminobenzidine. The position of L1 (55 kDa) is indicated by the arrow. Lane 1, wild type baculovirus; Lane 2, L1P18; Lane 3, L1V3; Lane 4, BPVL1; Lane 5, protein marker.

Full figure and legend (53K)

Systemic and mucosal antibody responses following immunization with chimeric VLP

Mice immunized i.m. with BPV1 L1 P18 or BPV1 L1V3 hybrid VLP developed anti-BPV1 L1 reactivity in serum by 7 days after the second immunization Figure 3a,b), and the level of VLP-specific antibody was similar with both constructs. Mice immunized i.m. with V3 VLP also developed serum antibody reactive with the P18 peptide Figure 3c). In contrast, mice immunized i.va. or i.r. with either chimeric VLP did not develop significant serum IgG antibody against BPVL1 or against the incorporated HIV-V3 sequence, although mucosal antibody was elicited Figure 4c), confirming that the compartmentalization of immune responses between systemic and mucosal immune systems demonstrated for conventional antigens and adjuvants is also seen for VLP.

Figure 3.

Systemic antibody response to chimeric BPV-1 VLP following systemic or mucosal immunization. BALB/c mice (four per group) were immunized twice at day 0 and day 14 with P18 VLP (Panel or V3 VLP (Panel b, c) in each case without adjuvant. VLP (50 g/mouse) were given intramuscularly (), intravaginally () or intrarectally () as indicated (, control). Serum IgG antibody to VLP (Panel a, b) or to P18 peptide (Panel in serum was measured as ELISA reactivity on day 21. Results are shown as the mean OD SEM and are from a single experiment representative of two similar experiments.

Full figure and legend (12K)

Figure 4.

Mucosal IgA response to chimeric BPV1 VLP following systemic or mucosal immunization. Mucosal secretions from gut (Panels a, c) and vagina (Panels b, d) were collected at day 21 as described in the Materials and Methods and assayed for VLP-specific antibody by ELISA. Results are shown for animals immunized systemically (), intravaginally () or intrarectally () with P18 VLP (Panel a, b) and V3 VLP (Panel c, d) and are expressed as the mean OD SEM from a single experiment of two similar experiments. (), control.

Full figure and legend (19K)

Next we compared routes of mucosal administration of VLP. Antibody responses following mucosal administration of VLP were generally weaker than following systemic administration. Gut antibody responses were stronger following i.r. immunization than following i.va. immunization. Antibody was not seen in vaginal secretions when VLP were delivered i.r. or i.va. Some vaginal antibody, and also some intestinal antibody, was observed following i.m. immunization. These results suggest that the vaginal secretory IgA response to antigen reflects the level of systemic rather than mucosal immunity induced.

Immunogenicity of VLP depends on the morphology of VLP

Papillomavirus virus-like particles were highly immunogenic, as 1 g VLP could elicit high titre serum antibody in mice when administered systemically Figure 5b). Also, chimeric PV VLP can deliver a defined CTL epitope to the MHC-I pathway.¹¹ To test whether the immunogenicity of chimeric VLP depends on intact VLP conformation, equimolar amounts of VLP were boiled for 10 min, which has previously been shown to partially destroy VLP structure, or not so treated, and then used to immunize mice i.m. Four mice in each group were immunized with 1 g or 5 g L1V3 VLP or with 5 g denatured L1V3 VLP at day 0 and day 14. After another 7 days, serum samples were collected individually and tested for the presence of anti-BPVL1 IgG. L1V3 VLP (1 g) could elicit strong serum antibody responses, while denatured L1V3 VLP (5 g) could hardly induce any antibody responses. In a separate experiment, mice were immunized with 50 g native or denatured L1V3 VLP, using the same protocol, and ELISA plates were coated with either native or denatured BPVL1 VLP. Mice immunized with denatured VLP had significantly lower serum levels of BPV1 VLP-specific and of P18-specific Figure 5a) antibody, compared with mice immunized with untreated VLP. The results indicate that the immunogenicity of PV VLP is dependent on the morphology of VLP. One hypothesis would be that intact PV VLP retain the specific receptor that allows dendritic cells (DC) to uptake and process VLP for presentation to T and B cells.

Figure 5.

Comparison of antibody responses to native or denatured BPV1 V3 VLP. Serum antibody responses against (a) native and (b) denatured BPVL1 and (c) P18 peptide were measured by ELISA in mice immunized twice with V3 VLP () or denatured V3 VLP (). (), unimmunized. Results are shown as the mean OD SEM. Four BALB/c mice in each group were immunized with different amounts of native or denatured BPVL1V3 VLP intramuscularly at day 0 and day 14 [(d), 1 g BPVL1V3 VLP; (e) 5 g BPVL1V3 VLP; (f) 5 g denatured BPVL1V3 VLP], and another 7 days later serum samples were collected individually and tested for the presence of anti-BPVL1 by ELISA as described in the Materials and Methods. The results shown represent one experiment. Results are shown as mean OD SEM.

Full figure and legend (21K)

P18 VLP can induce mucosal and systemic CTL response against the HIV P18 CTL epitope

Chimeric VLP delivered systematically or intranasally induce a systemic CTL response to defined CTL epitopes incorporated into the VLP.^{11, 13} To establish whether mucosal lymph node lymphocytes also demonstrated specific CTL activity following VLP immunization, mice immunized twice i.m. or i.r. with chimeric VLP were tested for p18-specific CTL using peptide-pulsed targets. Splenocytes or Peyer's patch lymphocytes were expanded in vitro for 6 days in the presence of rIL-2 prior to assay. CTLp responses were detected in splenocyte cultures from mice immunized i.m., i.va. or i.r. Figure 6). Splenic CTLp in the i.r. immunized group were as easily demonstrated as in the i.m. immunized group, and CTL responses were stronger than in the i.va. immunized group Figure 6a). A CTL response in Peyer's patch lymphocytes was seen only in mice immunized i.m. or i.r. Figure 6b). Thus, i.r. or i.m. immunization induces CTL precursors in both spleen and Peyer's patch cells, whereas i.va. immunization induces weak splenic and no CTL response in Peyer's patches. As expected, mice immunized with V3VLP failed to elicit a CTL response in any compartment, irrespective of which immunization route was used Figure 6c). Although immunization with the V3VLP induced good antibody responses to both VLP and V3, the amino acid substitutions in the L1V3 VLP construct alter the CTL epitope sufficiently to prevent a CTL response.

Figure 6.

Induction of p18-specific CTL activity by immunization with BPV1 L1 VLP. Specific killing of P18 peptide pulsed P815 cells was assessed by ⁵¹Cr release assay. Splenocytes (a, c) or lymphocytes isolated from Peyer's Patches ( were cultured with IL-2 for 6 days prior to assay. CTL were generated from mice immunized intramuscularly (), intrarectally () or intravaginally () with P18 VLP (a, b), or with V3 VLP (c).(), control.

Full figure and legend (21K)

Discussion

Immunization with chimeric PV-VLP has been shown by us and others to elicit VLP-specific antibodies at mucosal surfaces^{7, 13,17} and systemic CTL responses.^{11, 13,18} In this study, immunization by the intramuscular and intrarectal route with chimeric BPV1 VLP was shown additionally to elicit CTL responses in Peyer's patches. Compartmentalization of the immune response to VLP between the rectal and vaginal mucosa was demonstrated, in that gut immunity was best induced by i.r. VLP administration, whereas vaginal immunity was better induced by systemic delivery of VLP. It is also shown here that the immunogenicity of chimeric PV VLP is dependent on the morphology of VLP.

Most proteins delivered through mucosal routes, and especially through the gut, are non-immunogenic and induce a state of specific, long-lasting hyporesponsiveness termed immune tolerance.^{19, 20, 21} Poor immunogenicity of mucosally administered proteins has been a major obstacle to the develop­ment of efficient oral vaccines to induce mucosal, humoral and cellular immune responses. One way to overcome this is to use appropriate adjuvants, such as cholera toxin or heat-stable enterotoxin.²² Delivery of antigen to mucosal surfaces as VLP provides another way of inducing mucosal immunity. After oral or intranasal immunization with Norwalk VLP,²³ or Rotavirus VLP without adjuvant, intestinal IgA was detected in immunized mice, which were protected from virus challenge.²⁴ Intranasal delivery of Parvovirus VLP also elicited mucosal antibody in bronchoalveolar and intestinal fluids, and a strong systemic CTL response.²⁵ The current study confirms that PV VLP are also able to elicit systemic CTL responses and local mucosal CTL responses when delivered to mucosal surfaces, although the responses are not very strong. Intranasal immunization with chimeric PV VLP has similarly been shown to elicit systemic CTL responses and vaginal IgA in immunized mice.¹³ These data suggested that the immunogenicity of virus particles at mucosal surfaces is probably a property of particulate antigens assembled as multimers of subunits. When VLP were boiled to destroy their structure and used to immunize mice intramuscularly, 50 g did not produce detectable antibody, while 1 g of conformationally correct VLP could stimulate strong antibody production in serum. VLP might be actively taken up by mucosal APC through the integrin receptor.²⁶ Recently, it has been shown that murine bone-marrow-derived dendritic cells (BMDC) effectively bound and rapidly internalized bovine papillomavirus VLP: Exposure to fully assembled VLP of bovine papillomavirus, human papillomavirus (HPV) 16 or HPV18 induced acute phenotypic maturation of BMDC. Moreover, DC loaded with chimeric HPV-16 L1L2-E7 VLP induced a human T-cell response in vitro specific for E7-derived peptides.^{27, 28} Boiled VLP lose conformational structure and are not taken up through the integrin receptor. BMDC do not undergo phenotypic maturation when exposed to predominately disordered HPV16 capsomers.²⁸

It has been shown that neutralizing antibody elicited by im­mu­ni­zation of PV VLP protect the animal from papillomavirus challenge and a single immunization with 1 ng VLP without adjuvant can protect a rabbit from cottontail rabbit PV (CRPV) infection.^{5, 29,30} When administered intranasally, PV VLP induce antibody in mucosal secretions,^{13, 31,32} which are believed to be important for protection from viruses that enter through the mucosal membrane. In this study, intestinal IgA responses were highest when VLP were delivered i.r. and, unexpectedly, specific vaginal IgA was highest in i.m. immunized mice. This may have practical usage as i.m. immunization can be easily performed. These results indicate that the route of administration determined the nature of the immune responses in mice immunized with chimeric VLP. The degree of interconnectedness of the mucosal and systemic immune systems, and of the different mucosal surfaces, is still rather controversial. In a study of immunization using Salmonella typhi Ty21a at different mucosal sites, oral immunization elicited an immune response in saliva and vaginal secretions, while rectal immunization was more potent in inducing a response in rectal and nasal secretions.³³ Mice immunized with cholera toxin (CT) intrarectally developed high levels of IgA at the rectal mucosal surface, while vaginal immunization produced neither local nor distant IgA responses.³⁴ In the current study, anti-BPV IgA levels in intestine were better induced by i.r. immunization than by i.va. immunization, which produced only weak mucosal antibody responses at any site. Different immune responses observed in the study may reflect the available of lymphoid tissues in different immunized sites.^{34, 35} In view of the crossover demonstrated between systemic immunity and vaginal immunity, it would be worth testing whether systemic combined with mucosal VLP administration could improve both systemic and mucosal immune responses. Recently, it has been shown that coadministration of Escherichia coli heat-labile enterotoxin mutant R192G enhances the immune response to orally delivered PV VLP in the vaginal tract and mesenteric lymph nodes.³⁶ Enhanced vaginal mucosal IgA responses were similarly observed in mice immunized intranasally with PV VLP, if these were given with LTR72 or MF59 adjuvants.³⁷

Recombinant VLP from many viruses such as HIV gag particles,^{38, 39} simian immunodeficiency virus (SIV) gag particles,^{40, 41} Parvovirus VLP,^{42, 43} hepatitis B virus (HBV) VLP^{44, 45} and Ty VLP⁴⁶ have been shown to elicit specific CTL responses. After intranasal delivery of parvovirus-like particles, systemic CTL responses and mucosal antibodies were detected in immunized mice.⁴³ VLP are promising carrier systems that are being investigated in relation to the delivery of proteins to both MHC class I and MHC class II pathways for vaccine development and immunotherapy. It is also possible to generate chimeric PV VLP incorporating other virus proteins, such as HIV, to prevent two viruses that enter the host through mucosal membrane. HPV VLP administered to mice by gavage⁴⁷ elicited serum ani-VLP IgG and IgA antibodies and postimmune sera were found to neutralize HPV-11 virions in vitro, indicating that the PV VLP were antigenically stable in the environment of the gastrointestinal tract.⁴⁷ Also, VLP are safe, well tolerated in man⁴⁸ and easy to produce in industrial quantities. Recently, HBV particles produced in plants have proven immunogenic both in animals and in man.⁴⁹ In future, it may be possible to use plants to produce chimeric VLP, and hence develop vaccines against mucosally transmitted infections.

References

1. World Health Organisation. Report on the global HIV/AIDS epidemic. 1998. (http://www.who.int/emc-hiv/).
2. Bosch FX, Manos MM, Munoz N et al. Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. International biological study on cervical cancer (IBSCC) Study Group. JNatl Cancer Inst. 1995; 87: 796–802. | ChemPort |
3. Belyakov IM, Ahlers JD, Brandwein BY et al. The importance of local mucosal HIV-specific CD8 (+) cytotoxic T lymphocytes for resistance to mucosal viral transmission in mice and enhancement of resistance by local administration of IL-12. J. Clin. Invest. 1998; 102: 2072–81. | PubMed | ISI | ChemPort |
4. Zhou J, Sun XY, Stenzel DJ, Frazer IH. Expression of vaccinia recombinant HPV 16, L1 and L2 ORF proteins in epithelial cells is sufficient for assembly of HPV virion-like particles. Virology 1991; 185: 251–7. | Article | PubMed | ISI | ChemPort |
5. Kirnbauer R, Booy F, Cheng N, Lowy DR, Schiller JT. Papillomavirus L1 major capsid protein self-assembles into virus-like particles that are highly immunogenic. Proc. Natl Acad. Sci. USA 1992; 89: 12180–4. | Article | PubMed | ChemPort |
6. Hagensee ME, Yaegashi N, Galloway DA. Self-assembly of human papillomavirus type 1 capsids by expression of the L1 protein alone or by coexpression of the L1 and L2 capsid proteins. J. Virol. 1993; 67: 315–22. | PubMed | ISI | ChemPort |
7. Nardelli-Haefliger D, Roden RB, Benyacoub J et al. Human papillomavirus type 16 virus-like particles expressed in attenuated Salmonella typhimurium elicit mucosal and systemic neutralizing antibodies in mice. Infect. Immun. 1997; 65: 3328–36. | PubMed | ChemPort |
8. Paintsil J, Muller M, Picken M, Gissmann L, Zhou J. Carboxyl terminus of bovine papillomavirus type-1, L1 protein is not required for capsid formation. Virology 1996; 223: 238–44. | Article | PubMed | ChemPort |
9. Muller M, Zhou J, Reed TD et al. Chimeric papillomavirus-like particles. Virology 1997; 234: 93–111. | Article | PubMed | ISI | ChemPort |
10. Feltkamp MC, Smits HL, Vierboom MP et al. Vaccination with cytotoxic T lymphocyte epitope-containing peptide protects against a tumor induced by human papillomavirus type 16- transformed cells. Eur. J. Immunol. 1993; 23: 2242–9. | PubMed | ISI | ChemPort |
11. Peng S, Frazer IH, Fernando GJ, Zhou J. Papillomavirus virus-like particles can deliver defined CTL epitopes to the MHC class I pathway. Virology 1998; 240: 147–57. | Article | PubMed | ChemPort |
12. Greenstone HL, Nieland JD, de Visser KE et al. Chimeric papillomavirus virus-like particles elicit antitumor immunity against the E7 oncoprotein in an HPV16 tumor model. Proc. Natl Acad. Sci. USA 1998; 95: 1800–5. | Article | PubMed | ChemPort |
13. Liu XS, Abdul-Jabbar I, Qi YM, Frazer IH, Zhou J. Mucosal immunisation with papillomavirus virus-like particles elicits systemic and mucosal immunity in mice. Virology 1998; 252: 39–45. | Article | PubMed | ChemPort |
14. Qi YM, Peng SW, Hengst K et al. Epithelial cells display separate receptors for papillomavirus VLPs and for soluble L1 capsid protein. Virology 1996; 216: 35–45. | Article | PubMed | ChemPort |
15. Kulski JK, Sadleir JW, Kelsall SR et al. Type specific and genotype cross reactive B epitopes of the L1 protein of HPV16 defined by a panel of monoclonal antibodies. Virology 1998; 243: 275–82. | Article | PubMed | ChemPort |
16. Conley AJ, Gorny MK, Kessler JA et al. Neutralization of primary human immunodeficiency virus type 1 isolates by the broadly reactive anti-V3 monoclonal antibody, 447–52D. J. Virol. 1994; 68: 6994–7000. | PubMed | ISI | ChemPort |
17. Lowe RS, Brown DR, Bryan JT et al. Human papillomavirus type 11 (HPV-11) neutralizing antibodies in the serum and genital mucosal secretions of African green monkeys immunized with HPV-11 virus-like particles expressed in yeast. J. Infect. Dis. 1997; 176: 1141–5. | PubMed | ChemPort |
18. Rudolf MP, Nieland JD, DaSilva DM et al. Induction of HPV16 capsid protein-specific human T cell responses by virus-like particles. Biol. Chem. 1999; 380: 335–40. | Article | PubMed | ChemPort |
19. Mowat AM, Viney JL. The anatomical basis of intestinal immunity. Immunol. Rev. 1997; 156: 145–66. | Article | PubMed | ISI | ChemPort |
20. Weiner HL, Friedman A, Miller A et al. Oral tolerance: immunologic mechanisms and treatment of animal and human organ-specific autoimmune diseases by oral administration of auto­antigens. Annu. Rev. Immunol. 1994; 12: 809–37. | Article | PubMed | ISI | ChemPort |
21. Chin J, Turner B, Barchia I, Mullbacher A. Immune response to orally consumed antigens and probiotic bacteria. Immunol. Cell Biol. 2000; 78: 55–66. | Article | PubMed | ChemPort |
22. Medina E, Guzman CA. Modulation of immune responses following antigen administration by mucosal route. FEMS Immunol. Med. Microbiol. 2000; 27: 305–11. | Article | PubMed | ChemPort |
23. Ball JM, Hardy ME, Atmar RL, Conner ME, Estes MK. Oral immunization with recombinant Norwalk virus-like particles induces a systemic and mucosal immune response in mice J. Virol. 1998; 72: 1345–53. | PubMed | ChemPort |
24. O'Neal CM, Crawford SE, Estes MK, Conner ME. Rotavirus virus-like particles administered mucosally induce protective immunity. J. Virol. 1997; 71: 8707–17.
25. Sedlik C, Dridi A, Deriaud E et al. Intranasal delivery of recombinant parvovirus-like particles elicits cytotoxic T-cell and neutralizing antibody responses. J. Virol. 1999; 73: 2739–44. | PubMed | ChemPort |
26. Evander M, Frazer IH, Payne E, Qi YM, Hengst K, McMillan NA. Identification of the alpha6 integrin as a candidate receptor for papillomaviruses J. Virol. 1997; 71: 2449–56. | PubMed | ISI | ChemPort |
27. Rudolf MP, Fausch SC, Da Silva DM, Kast WM. Human dendritic cells are activated by chimeric human papilloma­virus type-16 virus-like particles and induce epitope-specific human t cell responses in vitro. J. Immunol. 2001; 166: 5917–24. | PubMed | ChemPort |
28. Lenz P, Day PM, Pang YY et al. Papillomavirus-like particles induce acute activation of dendritic cells. J. Immunol. 2001; 166: 5346–55. | PubMed | ChemPort |
29. Roden RB, Weissinger EM, Henderson DW et al. Neutralization of bovine papillomavirus by antibodies to L1 and L2 capsid proteins J. Virol. 1994; 68: 7570–4. | PubMed | ISI | ChemPort |
30. Christensen ND, Reed CA, Cladel NM, Han R, Kreider JW. Immunization with virus like particles induces long-term protection of rabbits against challenge with cottontail rabbit papillomavirus. J. Virol. 1996; 70: 960–5. | PubMed | ChemPort |
31. Balmelli C, Roden R, Potts A, Schiller J, De Grandi P, Nardelli-Haefliger D. Nasal immunization of mice with human papillomavirus type 16 virus-like particles elicits neutralizing antibodies in mucosal secretions. J. Virol. 1998; 72: 8220–9. | PubMed | ISI | ChemPort |
32. Dupuy C, Buzoni-Gatel D, Touze A, Bout D, Coursaget P. Nasal immunization of mice with human papillomavirus type 16 (HPV-16) virus-like particles or with the HPV-16 L1 gene elicits specific cytotoxic T lymphocytes in vaginal draining lymph nodes. J. Virol. 1999; 73: 9063–71. | PubMed | ChemPort |
33. Kantele A, Hakkinen M, Moldoveanu Z et al. Differences in immune responses induced by oral and rectal immunizations with Salmonella typhi Ty21a: evidence for compartmentalization within the common mucosal immune system in humans. Infect. Immun. 1998; 66: 5630–5. | PubMed | ISI | ChemPort |
34. Haneberg B, Dalseg R, Oftung F et al. Towards a nasal vaccine against meningococcal disease, and prospects for its use as a mucosal adjuvant. Dev. Biol. Stand. 1998; 92: 127–33. | PubMed | ChemPort |
35. Kozlowski PA, Cu-Uvin S, Neutra MR, Flanigan TP. Comparison of the oral, rectal, and vaginal immunization routes for induction of antibodies in rectal and genital tract secretions of women. Infect. Immun. 1997; 65: 1387–94. | PubMed | ISI | ChemPort |
36. Gerber S, Lane C, Brown DM et al. Human papillomavirus virus-like particles are efficient oral immunogens when coadministered with Escherichia coli heat-labile enterotoxin mutant R192G or CpG DNA. J. Virol. 2001; 75: 4752–60. | Article | PubMed | ChemPort |
37. Greer CE, Petracca R, Buonamassa DT et al. The comparison of the effect of LTR72 and MF59 adjuvants on mouse humoral response to intranasal immunisation with human papillomavirus type 6b (HPV-6b) virus-like particles. Vaccine 2000; 19: 1008–12. | Article | PubMed | ChemPort |
38. Kang CY, Luo L, Wainberg MA, Li Y. Development of HIV/AIDS vaccine using chimeric gag-env virus-like particles. Biol. Chem. 1999; 380: 353–64. | Article | PubMed | ChemPort |
39. Paliard X, Liu Y, Wagner R, Wolf H, Baenziger J, Walker CM. Priming of strong, broad, and long-lived HIV type 1 p55gag-specific CD8+ cytotoxic T cells after administration of a virus-like particle vaccine in rhesus macaques. AIDS Res. Hum. Retroviruses 2000; 16: 273–82. | Article | PubMed | ChemPort |
40. Notka F, Stahl-Hennig C, Dittmer U, Wolf H, Wagner R. Construction and characterization of recombinant VLPs and Semliki-Forest virus live vectors for comparative evaluation in the SHIV monkey model. Biol. Chem. 1999; 380: 341–52. | Article | PubMed | ChemPort |
41. Wagner R, Teeuwsen VJ, Deml L et al. Cytotoxic T cells and neutralizing antibodies induced in rhesus monkeys by virus-like particle HIV vaccines in the absence of protection from SHIV infection. Virology 1998; 245: 65–74. | Article | PubMed | ChemPort |
42. Rueda P, Martinez-Torrecuadrada JL, Sarraseca J. Engineering parvovirus-like particles for the induction of B-cell, CD4 (+) and CTL responses. Vaccine 1999; 18: 325–32. | Article | PubMed | ChemPort |
43. Casal JI. Use of parvovirus-like particles for vaccination and induction of multiple immune responses. Biotechnol. Appl. Biochem. 1999; 29: 141–50. | PubMed | ChemPort |
44. Ulrich R, Nassal M, Meisel H, Kruger DH. Core particles of hepatitis B virus as carrier for foreign epitopes. Adv. Virus Res. 1998; 50: 141–82. | PubMed | ISI | ChemPort |
45. Ulrich R, Lundkvist A, Meisel H et al. Chimaeric HBV core particles carrying a defined segment of Puumala hantavirus nucleocapsid protein evoke protective immunity in an animal model. Vaccine 1998; 16: 272–80. | Article | PubMed | ChemPort |
46. Layton GT, Harris SJ, Myhan J et al. Induction of single and dual cytotoxic T-lymphocyte responses to viral proteins in mice using recombinant hybrid Ty-virus-like particles. Immunology 1996; 87: 171–8. | Article | PubMed | ISI | ChemPort |
47. Rose RC, Lane C, Wilson S, Suzich JA, Rybicki E, Williamson AL. Oral vaccination of mice with human papillomavirus virus-like particles induces systemic virus-neutralizing antibodies. Vaccine 1999; 17: 2129–35. | Article | PubMed | ISI | ChemPort |
48. Zhang LF, Zhou J, Chen S et al. HPV6b virus like particles are potent immunogens without adjuvant in man. Vaccine 2000; 18: 1051–8. | Article | PubMed | ISI | ChemPort |
49. Kapusta J, Modelska A, Figlerowicz M et al. A plant-derived edible vaccine against hepatitis B virus. Faseb J. 1999; 13: 1796–9. | PubMed | ISI | ChemPort |

Acknowledgements

XS Liu is in receipt of a PhD scholarship from the Queensland Cancer Fund. This work was funded in part by grants from the National Health and Medical Research Council of Australia, the Queensland Cancer Fund and the Princess Alexandra Hospital Foundation.