|
|
|
| June 2002, Volume 9, Number 12, Pages 793-803 |
| Table of contents Previous Article Next [PDF] |
 |
| Research Article |
| Macrophage-derived chemokine gene transfer results in tumor regression in murine lung carcinoma model through efficient induction of antitumor immunity |
 |
| J Guo1,a, B Wang2,a, M Zhang1, T Chen1, Y Yu1, E Regulier3,a, H E Homann3, Z Qin1, D W Ju1 and X Cao1 |
 |
1Institute of Immunology, Second Military Medical University, Shanghai, PR China
2Jinan General Hospital of PLA, PR China
3TRANSGENE SA, Strasbourg, France
|
Correspondence to: X Cao, Institute of Immunology, Second Military Medical University, 800 Xiang Yin Road, Shanghai 200433, PR China |  |
aThe first two authors contributed equally to this work Current address: Division de Recherche Chirurgicale et Centre de Thérapie Génique, CHUV, Pavillons 3 et 4, CH-1011 Lausanne, Switzerland |
 |
| Abstract |
 | Chemokine gene transfer represents a promising approach in the treatment of malignancies. Macrophage-derived chemokine (MDC) (CCL22) belongs to the CC chemokine family and is a strong chemoattractant for dendritic cells (DC), NK cells and T cells. Using adenoviral vectors, human MDC gene was transferred in vivo to investigate its efficacy to induce an antitumor response and to determine the immunologic mechanisms involved. We observed that intratumoral injection of recombinant adenovirus encoding human MDC (AdMDC) resulted in marked tumor regression in a murine model with pre-established subcutaneous 3LL lung carcinoma and induced significant CTL activity. The antitumor response was demonstrated to be CD4+ T cell- and CD8+ T cell-dependent. Administration of AdMDC induced chemoattraction of DC to the tumor site, facilitated DC migration to draining lymph nodes or spleen, and finally activated DC to produce high levels of IL-12. Furthermore, a significant increase of IL-4 production within the tumors was observed early after the AdMDC administration and was followed by the increase of IL-12 and IL-2 production. The levels of IL-2, IL-12 and IFN- in serum, lymph nodes and spleen were also found to be higher in mice treated with AdMDC as compared with that in AdLacZ- or PBS-treated mice. The antitumor response induced by AdMDC was markedly impaired in IL-4 knockout mice, suggesting an important role of IL-4 in the induction of antitumor immunity by MDC. These results suggest that MDC gene transfer might elicit significant antitumor effects through efficient induction of antitumor immunity and might be of therapeutic potentials for cancer. Gene Therapy 2002 9, 793-803. DOI: 10.1038/sj/gt/3301688 |
 |
| Keywords |
 | macrophage-derived chemokine; gene therapy; dendritic cells; IL-4; CTL |
 |  |
Introduction
Macrophage-derived chemokine (MDC/CCL22) (also referred to as DC/B-CK or STCP-1) is an 8 kDa member of the C-C chemokine family which appears to be synthesized specifically by cells of the macrophage lineage. High expression is detected in normal thymus. MDC is a potent chemoattractant for dendritic cells (DC), natural killer (NK) cells and Th2 subset of T cells1,2 and is involved in chronic inflammation or homing of DC and lymphocytes.3,4 Recent studies have demonstrated a pivotal role of MDC in the protection of mice from cecal ligation and puncture-induced lethality.5 It was reported that T cells attracted by MDC gene-transfected cell lines could predominantly produce Th2-type cytokines, such as IL-4.2,6 Previous data have shown that the growth of IL-4 gene-transfected tumors in vivo was suppressed in a rather reproducible fashion.7,8 It has been reported that growth suppression of IL-4-secreting tumors and Th1-associated, CTL-mediated antitumor immunity was impaired in IL-4 deficient mice.9,10 IL-4 can enhance the production of IL-12 by DC and has been confirmed to play roles in the antitumor response.8,11
Immature DC undergo a maturation process after they encounter antigens, and subsequently migrate to lymphoid tissue to prime naive T cells.12,13 Induction of effective antitumor response requires DC to present tumor antigen,14 but tumor cells often have limited expression of MHC antigens and costimulatory molecules,15,16,17 and also tumor cells can produce immune inhibitory factors that inhibit DC maturation and migration.18,19 It has been shown that the quantity of DC within tumors of a variety of histological types are correlated with prognosis,20,21 and that DC which reside within the tumor are immature.22 Thus efficient DC maturation, migration and activation might be of great importance for the induction of antitumor immunity.
In the present investigation, we hypothesized that if tumors could be genetically modified in vivo to produce MDC, the secreted MDC might result in the accumulation of DC and Th2 subset of T cells within the tumor, and that subsequently the IL-4 produced by Th2 cells might enhance DC maturation and activation. As a consequence, the maturated DC would migrate more effectively to the secondary lymphoid organs to present tumor antigens, thus inducing immune response against the tumor. Human and murine MDC share the chemotactic properties across species barriers, and both mouse and human MDC have been described as a functional ligand for murine CCR4.2We therefore utilized a replication-defective recombinant adenovirus as vehicle for human MDC gene transfer in the 3LL murine lung cancer model. We show that this strategy did induce local accumulation of DC within the tumors. It facilitates DC migration to secondary lymphoid organs, and finally induces CTL activity which results in regression of pre-established tumors.
|
 Results
MDC expression and chemoattrative activity of AdMDC transfection
The recombinant adenovirus encoding human MDC was used to explore the antitumor response of MDC gene transfer and its related mechanisms. Human MDC gene was expressed from recombinant E1/ E3 replication-deficient adenovirus vectors under control of the CMV promotor.23 Transduction efficiency of this approach was determined by a paralleling AdLacZ analysis by counting LacZ-positive cells after 5-bromo-4-chloro-3-indolyl- -D-galactopyranoside staining. The LacZ-positive cells were in 42% of 3LL cells at a MOI of 30, 74% at a MOI of 50 and 91% at a MOI of 100. Human MDC mRNA was detected by RT-PCR only in 3LL murine Lewis lung carcinoma cells both in vitro and in vivo 48 h after transfection with AdMDC (Figure 1a). Western blot analysis using an anti-human MDC monoclonal antibody demonstrated that MDC protein was present both in the cell lysate and in the culture supernatant 48 h after infection of 3LL cells with AdMDC Figure 1b. Additionally, mouse MDC expression in 3LL cells was not detected using mouse MDC-specific primers and human MDC expression was not detected by RT-PCR in the brain, liver, heart, lung, kidney, spleen and draining lymph nodes, except the tumor sites in the mice 3 days after AdMDC administration (data not shown). Markedly increased chemotactic activity of mouse DC and splenic T cells was also observed with the supernatants of MDC gene-transfected 3LL cells as compared with controls (Figure 2). These data indicated that human MDC, secreted by 3LL lung carcinoma cells transfected with AdMDC, could efficiently chemoattract murine DC and T cells and AdMDC could be used for the study of antitumor response in the murine model.
Tumor regression after intratumoral MDC gene transfer
The antitumor effect of AdMDC administration was investigated in a murine model with pre-established 3LL lung carcinoma. The data in Figure 3a showed that treatment of the tumor-bearing mice with intratumoral administration of AdMDC resulted in regression of the pre-established tumors significantly as compared with administration of AdLacZ or PBS (P < 0.01). The survival periods of the tumor-bearing mice after various treatments were observed. The results in Figure 3b showed that tumor-bearing mice intratumorally administered with AdMDC survived significantly longer than those mice administered with AdLacZ or PBS (P < 0.01), and six of 10 tumor-bearing mice were free of tumor 90 days after tumor inoculation.
In order to explore if specific antitumor immunity was induced in vivo in tumor-bearing mice after AdMDC treatment, the six tumor-free mice after AdMDC therapy were re-challenged s.c. with 5 ´ 104 3LL cells on their opposite flank region. Five mice remained tumor-free 3 months after tumor challenge, only one mouse died in 82 days. These data suggested that potent-specific antitumor immunity was induced after intratumoral MDC gene transfer.
Induction of tumor-specific CTL by intratumoral MDC gene transfer
To confirm the primary finding that specific antitumor immunity was induced after MDC gene transfer, we also determined the CTL activity in tumor-bearing mice after adenovirus-mediated MDC gene transfer. Splenocytes of tumor-bearing mice were isolated 12 days after AdMDC injection and cultured with irradiated 3LL tumor cells and subsequently used as CTL effector cells in cytotoxic assays with effector:target (E:T) ratios of 10:1, 20:1 and 50:1. As shown in Figure 4a, significantly potent cytotoxicity of CTL to 3LL carcinoma cells was detected in AdMDC-treated mice as compared with those in the mice injected with AdLacZ or PBS. No cytotoxicity of CTL to syngeneic EL4 lymphoma cells was observed, suggesting that 3LL lung carcinoma-specific CTL was induced efficiently and might be involved in the antitumor response of the MDC gene transfer.
Effector cells involved in the antitumor response of MDC gene transfer
To further characterize the effector cells involved in the antitumor response of MDC gene transfer, in vivo depletion with anti-CD4, anti-CD8 or anti-NK monoclonal antibodies was performed to elucidate the roles of different T cell subsets and NK cells. As shown in Figure 4b, administration of anti-CD4 mAb or anti-CD8 mAb abolished the suppression of 3LL tumor cell growth elicited by AdMDC, while anti-NK mAb had only partial effect, indicating that tumor growth inhibition by AdMDC administration was both CD4+ T cell and CD8+ T cell-dependent.
Chemoattraction and activation of DC in tumor-bearing mice by intratumoral MDC gene transfer
We want to elucidate the mechanisms involved in antitumor immunity induced by MDC gene transfer. MDC was shown to be a potent chemoattractant for DC in various animal models.1,2 We therefore intended to verify whether adenovirus-mediated MDC gene transfer could attract and activate DC in tumor-bearing mice. We visualized mouse DC using a fluorescent marker (PKH-26) 3 days after AdMDC administration. TC-1 cells were used as a control. The labeling procedure using PKH26 had little influence on cell viability as determined by trypan blue exclusion (96% viability for DC and 79% viability for TC-1 cells, respectively), as well as on the phenotypes of DC, including MHCII, CD86 and CD80 expression (data not shown). Seven days after subcutaneous inoculation of 3LL tumor cells, the mice were intratumorally administered with AdMDC, AdLacZ or PBS and after another 3 days, the PKH-26-labeled DC or TC-1 cells were injected at a distance of 2 cm from the tumors. Twenty-four hours later, mice were killed and tumors were collected for the analysis of colored DC. More labeled DC were observed to be present within the tumor tissue of AdMDC-treated animals, but not in tumors injected with AdLacZ or PBS (Figure 5a, b, c). On the other hand, when labeled TC-1 cells were injected into the tumor-bearing mice as negative controls, no labeled cells were detected within the tumors, indicating that the DC migration to tumor site was indeed specific in response to AdMDC.
These results were further verified by the infiltration of endogenous DC into tumor sites. Immunohistochemical analysis of tumor sections demonstrated that more DEC205+ and CD11c+ DC were observed in the tumor of AdMDC-treated animals but not in the tumors injected with AdLacZ or PBS Figure 5d, e, f.
After we observed that DC could be chemoattracted to the tumor site by intratumorally expressed MDC, we want to know if the intratumorally injected DC could migrate into the draining lymph nodes. The results in Figure 5g-i demonstrated that in control mice only a small number of labeled DC were detected in the draining lymph nodes, while in AdMDC-treated mice, however, much more labeled DC were observed in the draining lymph nodes. The same results were also observed in the spleen Figure 5j, k, l. We also found that intratumoral injection of AdMDC induced the inflammation of draining lymph nodes of tumor-bearing mice. The weight of inguinal lymph nodes was significantly increased in the AdMDC-treated group (17.6 ± 5.67 mg) as compared with that of AdLacZ (6.87 ± 1.34 mg) or PBS (2.46 ± 0.56 mg) injected groups (P < 0.05).
To further determine whether DC were activated after AdMDC administration in tumor-bearing mice, we isolated DC from spleens of tumor-bearing mice 5 days after intratumoral injection with AdMDC. The results demonstrated that IL-12 production by splenic DC increased significantly in tumor-bearing mice treated with AdMDC as compared with that in tumor-bearing mice injected with AdLacZ or PBS (Figure 6a). These data suggested that administration of AdMDC could induce increased IL-12 production of DC, enhance DC migration to the draining lymph nodes and spleen, and finally lead to DC activation.
Production of cytokines in tumor-bearing mice after MDC gene transfer
Given that cytokines like IL-2, IL-12, IFN- , as well as IL-4, are essential mediators in the induction of antitumor immunity, we studied the expression profiles of these immunoregulatory cytokines within the tumor site and in peripheral lymph organs in tumor-bearing mice after AdMDC administration. As shown in Figure 6 (a, b, c), after stimulation with irradiated 3LL cells, splenocytes and lymph node-derived cells from AdMDC-treated mice secreted significantly higher levels of IL-12, IL-2 and IFN- as compared with those from AdLacZ- or PBS-injected mice. An increase of IL-12, IL-2 and IFN- production was also detected in the supernatants of homogenated tumor tissue after an overnight culture and in the serum of the AdMDC administered mice. Increased Th1 cytokine production, both locally and systemically, indicated that the cellular immunity of the tumor-bearing host was induced efficiently.
The data in Figure 6d also illustrated that IL-4 content was significantly higher within the tumor site of mice intratumorally injected with AdMDC when compared with those in mice injected with AdLacZ or PBS. In serum, lymph nodes and spleen, no significant IL-4 release was observed. The important role of IL-4 in the antitumor immunity has been studied intensively. To confirm our hypothesis that IL-4 produced after MDC gene transfer play important roles in the induction of cellular immunity, we determined the kinetics of IL-4, IL-12 and IL-2 production inside the tumor nodules. The results demonstrated that significant production of IL-4 appeared 3 days before the increased production of IL-12 and IL-2 (Figure 7a, b, c), but no increased production of IL-12 was observed in IL-4-/- mice Figure 7d, indicating that increased Th1 cytokine production might be a consequence of IL-4 release after intratumoral MDC gene transfer.
Important role of IL-4 in the antitumor effect of MDC gene transfer
MDC can attract IL-4 producing Th2 cells, and IL-4 plays an important role in the maturation and activation of DC. To further confirm the role of IL-4 in the potent antitumor response elicited by MDC gene transfer, C57BL/6 wild-type or IL-4 knockout mice bearing 3LL tumors were intratumorally injected with AdMDC or AdLacZ. The results in Figure 8 illustrated that treatment with AdMDC induced a significant inhibition of tumor growth in wild-type mice, but the antitumor effects was significantly impaired in IL-4 knockout mice, indicating the important role of IL-4 in the antitumor response of intratumoral MDC gene transfer.
|
 Discussion
Chemokines play important roles in the immune reaction by their involvement in the inflammatory response and their capacity to chemoattract leukocytes.24,25,26 Directed migration of DC can be induced by various chemokines during their development and maturation.27,28 Immature DC are attracted by MDC, MIP-1 , MIP-3 , MCP-1,2,3,4, RANTES and SDF-1, whereas mature DC are attracted by MIP-3 /ELC(CK -11) and SLC. Several studies have shown that chemokine gene transfer represents a potent antitumor approach. MIP-1 expression in adenocarcinoma cells led to reduced tumor formation and increased infiltration of macrophages and neutrophils.29 RANTES and lymphotactin also inhibited tumor formation and generated tumor immunity.30,31,32 MCP-1 was shown to reduce in vivo growth of tumor cells and to increase infiltration of macrophages/monocytes to the tumor site.33 Recently, intratumoral injection of recombinant SLC showed potent antitumor response and led to tumor eradication in treated mice.34 The expression of MIP-3 /ELC(CK -11) in a breast cancer cell line mediated rejection of the transduced tumor.35 Adenovirus-mediated gene transfer of MIP-3 to tumors induced local accumulation of DC and inhibited growth of pre-existing tumors.36
MDC is a potent chemoattractant for DC, NK cells, Th2 and Tc2 subsets of T cells.1,2,6 The functional receptor for MDC is the CC chemokine receptor 4 (CCR4), which is preferentially expressed on blood T cells, particularly CD4+ T cells of the Th2 phenotype.2 MDC is thought to play an important role in the selective migration of antigen-stimulated T cells, especially Th2 cells, toward antigen-presenting cells during T cell-mediated host responses.2,6 In normal human tissues, MDC and its receptor CCR4 are expressed almost exclusively in thymus, where it is a chemoattractant for CD3+ CD4+ and CD8 (low) thymocytes.37 In this study, we have confirmed our hypothesis that adenovirus-mediated intratumoral MDC gene transfer could suppress the growth of 3LL tumors, increase survival of the tumor-bearing mice, and induced tumor-specific cytotoxic T cell response. CD4+ T cells and CD8+ T cells are the most important effector cells involved in the antitumor response of MDC gene transfer.
DC are powerful antigen-presenting cells and have the ability to capture antigens, to migrate to secondary lymphoid organs, to process and present antigenic peptides and to stimulate naive T cells.38,39,40,41 After exposure to antigens or inflammation factors, DC undergo functional maturation and reenter the circulatory system to home to T cell areas of lymphoid organs via lymphatic vessels to reach lymph nodes and blood to reach the spleen.42 DC participate in the processing and presentation of tumor antigens and stimulate T cells to elicit potent antitumor response, but tumor cells can produce immune inhibitory factors that inhibit DC maturation and migration into tumor site.18,19 In this study, we also demonstrated that migration of DC was inhibited by supernatants of 3LL (see Figure 3). It has been shown that the density of DC within tumors of a variety of histological types was correlated with prognosis,20,21 and that DC within the tumor were immature.22 So, both the infiltration of DC into the tumor and the migration and homing of DC from the tumor to lymphoid organs are considered to be critically initial steps during induction of antitumor immune response. It has been shown that enhanced migration from the tumor site to draining lymphoid organs induced potent antitumor activity.43 In the present study, we demonstrated accumulation of DC, as well as T cells in tumors 3 days after administration of the AdMDC. Intratumoral injections of PKH26-labeled DC 3 days after AdMDC administration showed that DC migrated into the draining lymph nodes more effectively in AdMDC-treated mice than that in PBS- or AdLacZ-injected mice. The cytokine production in serum, tumor, lymph nodes and spleen 3 days after AdMDC administration was assayed by ELISA and significant IL-4 production within the tumors of AdMDC-treated mice and increased IL-12 production was detected in serum, lymph nodes, spleen or in tumor. Since the tumor cells used in this study do not secrete detectable levels of IL-12 (data not shown), we presumed that DC might be the predominant sources of IL-12. An increase of IFN- and IL-2 production was also detected in the supernatant of tumor homogenates after an overnight culture and in the serum, lymph nodes, and spleen of AdMDC-administered mice. These results suggested that MDC secretion in tumor site could attract DC to tumors and promote DC maturation and enhance DC migrate to draining lymphoid organs, and lastly lead to DC activation.
Recombinant IL-4 and GM-CSF allow the generation of large numbers of mature DC in vitro.44,45 Recent results have shown that IL-4-/- mice were severely impaired in the development of anti-tumor immunity, indicating a defective Th1 response in the absence of IL-4.10 The important role of IL-4 was demonstrated for the generation of Th1-associated, CTL-medicated tumor immunity. IL-4 can effectively induce DC to produce the major Th1-inducing cytokine-bioactive IL-12, and the expression of IL-4 by tumor cells transfected to secrete IL-4, or in a transgenic mouse model, led to induction of IFN- in vivo and tumor suppression.46 IL-4 injection around the tumor-draining lymph node, where T cell priming probably occurs, lead to an antitumor response, showing that not only the time point, but also the amount of IL-4 required for induction of tumor immunity are crucial.47 In this study, we found significant IL-4 production within the tumors of AdMDC-treated mice. Since the tumor cells used in this study do not spontaneously secrete detectable levels of IL-4, we therefore presumed that Th2 cells attracted to tumor site by MDC are the predominant source of IL-4. DC that were attracted to tumor site would undergo maturation in this particular microenvironment in the presence of both IL-4 and tumor antigens, produce IL-12 and prime Th1 response.48 This study indicated that attraction of Th2 cells by MDC can contribute to maturation and migration of DC and CTL generation, and IL-4 plays an essential role in the antitumor response. In conclusion, intratumoral MDC gene transfer elicited significant antitumor effects through efficient induction of antitumor immunity and might be of therapeutic potential for immunotherapy of cancer.
|
 Materials and methods
Animals and cell lines
Male C57BL/6 (H-2Kb) or IL-4 knockout (C57BL/6, IL-4-/-) mice, 6-8 weeks of age, were purchased from Joint Ventures Sipper BK Experimental Animal Co, Shanghai, China. Mice were housed under specific pathogen-free conditions for at least 1 week before any experiments. 293 (CRL 1573), a human embryonic kidney cell line transformed with Ad5 E1A and E1B genes and supporting propagation of E1-deleted recombinant adenovirus, was cultured in DMEM (Life Technologies, Grand Island, NY, USA) supplemented with 10% heat-inactivated FCS (HyClone, Logan, UT, USA), 2 mM glutamine, 100 g/ml streptomycin, 100 U/ml penicillin (GIBCO BRL, Gaithersburg, MD, USA). 3LL, a murine Lewis lung carcinoma cell line derived from C57BL/6 mice (H-2Kb), and EL4, a lymphoma cell line derived from C57BL/6, were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). TC-1 cell line, kindly provided by Dr C Song, is a bone marrow-derived stromal cell line of C57BL/6 mice (H-2Kb).49 These cells were maintained in complete RPMI-1640 medium supplemented with 10% FCS.
Adenovirus preparation
The human MDC gene was synthesized by oligonucleotide assembling using eight oligonucleotides: to generate a plasmid containing the 5' half of the human MDC gene, the two sense oligonucleotides OTG 11539 (GATCCCACCATGGCTCGCCTACAGACTGCACTCCTGGTT GTCCTCGTCCTCCTTGCTGTGGCGCTTCAAGCAACTGAGG) and OTG 11541(CAGGCCCCTACGGCGCCAACATGG AAGACAGCGTCTGCTGCCGTGATTACGTCCGTTACCGTCT GCCCCTGCGCGTGGTGAAACACTTC) were hybridized to the two antisense oligonucleotides OTG 11540 (TAGGGGCCTGCCTCAGTTGCTTGAAGCGCCACAGCAAGG AGGACGAGGACAACCAGGAGTGCAGTCTGTAGGCGAGCCA TGGTGG) and OTG 11542 (AATTGAAGTGTTTCACCACGCGCAGGGGCAGACGGTAAC GGACGTAATCACGGCAGCAGACGCTGTCTTCCATGTTGGCGCCG) and subsequently cloned into the BamHI-EcoRI site of pBK-RSV (Stratagene, La Jolla, CA, USA). The resulting plasmid was cut with XhoI-XmnI to introduce the rest of the coding region. To generate the 3' half of the human MDC coding sequence, the two sense oligonucleotides OTG 11543 (ACTTCTACTGGACCTCAGACTCCTGCCCGAGGCCTGGCG TGGTGTTGCTAACCTTCAGGGATAAGG) and OTG 11545 (AGATCTGTGCCGATCCCAGAGTGCCCTGGGTGAAGATGA TTCTCAATAAGCTGAGCCAATGAC) were hybridized to the two antisense oligonucleotides OTG 11544 (GCACAGATCTCCTTATCCCTGAAGGTTAGCAACACCACG CCAGGCCTCGGGCAGGAGTCTGAGGTCCAGTAGAAGT) and OTG 11546 (TCGAGTCATTGGCTCAGCTTATTGAGAATCATCTTCACCC AGGGCACTCTGGGATCG), ligated and inserted into the XhoI-XmnI site thus generating the complete cDNA sequence of huMDC. After sequence verification, the human MDC gene was then inserted into E1 region of the adenoviral shuttle plasmid plasmid under the control of the CMV promoter and containing the chimeric human -globin/IgG intron and the SV40 late polyadenylation signal. The recombinant E1/ E3 replication-deficient adenoviruses were generated by homologous recombination in E. coli and amplified in 293 cells.50,51 Viral propagation, purification and titration were carried out as previously described.52 Purified viruses were stored in 1 M sucrose, 10 mM Tris-HCl pH 8.5, 1 mM MgCl2, 150 mM NaCl, 0.005% Tween 80. Replication-defective recombinant adenovirus LacZ encoding the -galactosidase was kindly provided by Professor H Hamada (Sapporo Medical University, Sapporo, Japan).53 Functional titers of recombinant virus were 4 ´ 109 p.f.u./ml (AdLacZ ) and 4 ´ 109 p.f.u./ml (AdMDC). Recombinant virus was stored at -80°C until use.
Adenoviral transduction, RT-PCR and Western blot
3LL cells were transduced with AdLacZ or AdMDC at a multiplicity of infection (MOI) of 100, unless otherwise stated. RNA was extracted from 2 ´ 106 AdMDC-infected 3LL cells and control 3LL cells 48 h after transduction using the Trizol method (GIBCO BRL) according to the manufacturer's instructions. First-strand cDNA was synthesized using the superscript pre-amplification system (GIBCO BRL) with the supplied oligo (dT) 12-18 primers. The cDNAs were used as templates for PCR (95°C for 20 s, 55°C for 30 s, 72°C for 30 s, 25 cycle using specific primers for human MDC (forward: 5'-TGGCTCGCCTACAGACTG; reverse 5'-CACAGATCTCCTTATCCC). To ensure the quality of the procedure, control RT-PCR was performed on the samples with specific primers for -actin.
Expression of MDC protein was analyzed by Western blot 48 h after transduction from AdMDC-infected 3LL and control 3LL cells (5 ´ 106). The cells were lysed in T-PERtm Tissue Protein Extraction Reagent (Pierce, Rockford, ME, USA) at 4°C for 30 min and were shaken occasionally. The cell lysates were centrifuged at 12 000 g for 15 min and supernatants were collected. Then 15 l of the culture and lysate supernatants were separated by 12% SDS-polyacrylamide gel and electrotransferred on to nitrocellulose membrane (0.45 ) (BioRad Laboratories). Membranes were incubated with anti-human MDC monoclonal antibody (R&D Systems, Minneapolis, MN, USA) and subsequently with anti-mouse secondary antibody. Protein bands were visualized using the enhanced chemiluminescence method according to the instructions of the manufacturer (Amersham Life Sciences, Arlington Heights, IL, USA).
Chemoattractive activity of AdMDC in vitro
To evaluate the function of the MDC protein expressed by the AdMDC transfection, chemotaxis of mouse DC and splenic T cells was assayed with supernatants of AdMDC-infected 3LL cells as described.37 Approximately 1 ´ 106 C57BL/6 mouse DC or 1 ´ 106 nylon wool-purified T cells from C57BL/6 mouse splenocytes (cultured overnight with 1000 U/ml of IL-2) were resuspended in 0.1 ml of RPMI 1640 containing 0.5% BSA and loaded into the upper well of a transwell chamber (3 pore size; Costar, Corning, NY, USA). Supernatants of wild-type 3LL cells or of cells infected with AdMDC or AdLacZ were harvested after 72 h. Different dilutions of the supernatants were added to the lower well in a volume of 0.6 ml. The chamber was incubated for 4 h at 37°C. Directed migration was expressed as the number of cells that had migrated to the lower chamber, seen in five high power fields. Each experiment was performed in triplicate at least three times. The data are presented as mean ± s.d.
Generation of DC from bone marrow
DC were obtained from murine bone marrow precursors as described previously by us.54,55,56 In brief, erythrocyte-depleted murine bone marrow cells harvested from femurs of C57BL/6 mice were plated in complete RPMI 1640 media supplemented with 20 ng/ml recombinant murine GM-CSF (Sigma, St Louis, MO, USA) and 1 ng/ml recombinant murine IL-4 (PeproTech, Rocky Hill, NJ, USA). On day 3, floating cells were gently removed and fresh medium was added. On day 6 of the culture, nonadherent and loosely adherent cells with the typical morphological features of DC were collected and used for the in vitro and in vivo migration assay.
Tumor-bearing model and therapeutic regimen with adenovirus-mediated intratumoral MDC gene transfer
To establish murine model with pre-established tumor, C57BL/6 mice were inoculated with 1 ´ 106 3LL tumor cells subcutaneously into the shaved right flanks. After 7 days, the tumors were 50-80 mm2 and the tumor-bearing mice were injected intratumorally with AdMDC (1 ´ 109 p.f.u. in 100 l), AdLacZ (1 ´ 109 p.f.u. in 100 l), or PBS (100 l). To demonstrate expression of MDC within the tumors, RNA was extracted from tumors 3 days after intratumoral administration of AdMDC and RT-PCR was performed using specific primers for human MDC and for -actin. To demonstrate suppression of tumor growth in vivo by MDC gene transfer, the size of individual tumors was monitored every 2 days. The tumor area was expressed as the average tumor size (mm2) ± s.d. Mice were killed when the tumors reached 3 cm in diameter or appeared moribund, and this was recorded as the date of death for survival studies. All experiments were performed three times using individual treatment groups of 10 mice. Data are representative of three experiments performed.
Cytotoxic assay
Splenic lymphocytes were isolated from tumor-bearing mice 12 days after administration of adenovirus and were cocultured at 1 ´ 107 cells/ml with 1 ´ 106 cells/ml inactivated 3LL tumor cells for 7 days in the presence of mIL-2 20 IU/ml (Genzyme, Cambridge, MA, USA), and then collected as CTL effector cells. The CTL activities was determined by a standard 4-h 51Cr-release assay utilizing 3LL as targets.54 Two million 3LL in 0.5 ml RPMI-1640 with 20% FCS were labeled with 200 Ci Na51CrO4 (Amersham) for 2 h. The labeled cells were washed three times in serum-free medium. Ten thousand target cells were then mixed with effector cells for 4 h at 37°C at the ratio indicated. For the maximal 51Cr-release control, 0.1 ml of 0.1 N HCl was added to the target cells, and for the spontaneous 51Cr control, 0.1 ml of medium was added to the labeled cells. The syngeneic EL4 lymphoma cells were used as control target cells. The amount of 51Cr release was determined by counting on a 1275 Minigamma Counter (LKB-Wallac, Turku, Finland), and the percentage of specific lysis was calculated as follows: CTL activity (%) = (experimental c.p.m. - spontaneous c.p.m.)/(maximal c.p.m. - spontaneous c.p.m.) ´ 100.
In vivo depletion of T cell subsets and NK cells
Mice were injected i.p. with rat IgG2b mAb (1 mg/mouse/injection) against murine CD4 (GK1.5, TIB-207, ATCC), CD8 (2.43, TIB210, ATCC) or IgG2a against NK (PK136, HB-191) on day -2, 0, +2, +4 of adenovirus administration. Normal rat IgG (Sigma) was given as control. This procedure was shown to be effective for specific depletion of T cells in blood and spleen, and long-term T cell subset depletion as confirmed by flow cytometry analysis.
Assay for in vivo chemoattraction and facilitated migration of DC
DC were labeled with the red fluorescence marker PKH-26 (Sigma) according to the manufacturer's protocol and immediately used for injection.57 In brief, DC or TC-1 control cells were incubated with 2 ´ 10-6 M PKH-26 at room temperature for 5 min, rinsed extensively with PBS, examined for viability and cell number using trypan blue exclusion, and injected into the animals. Twenty four hours after subcutaneously injection of the labeled cells (1 ´ 106 in 100 l) at a distance of 2 cm anterior to the tumor in the flank region, mice were killed and the tumors were harvested, embedded in OCT compound (IEC, Needham HTS, MA, USA) and frozen immediately at -80°C. Cryostat sections (6 m) were placed on cove slides, fixed in 1% paraformaldehyde for 5 min, incubated with 0.4 g/ml Hochest (Calbiochem, San Diego, CA, USA) for 5 min, and subsequently examined by fluorescence microscopy.
To evaluate the capability of intratumorally administered AdMDC to facilitate DC migration from the tumor site to the draining lymph nodes, PKH-26 labeled DC (1 ´ 106 in 100 l) were injected into the tumors 3 days after intratumoral injection of AdMDC or AdLacZ, and the ipsilateral inguinal lymph nodes were isolated 2 h later, fluorescence microscopy assay was carried out as described above.
To further verify the infiltration of endogenous DC into tumor sites, we performed immunohistochemistry on the tumors collected 3 days after administration of AdMDC. The tumor-bearing mice were killed and the tumor nodules were harvested and embedded in OCT compound. The frozen sections (6 m) were fixed in acetone and washed, incubated with 5% normal rat serum for 30 min, then sequentially incubated with the optimal dilution of the primary Abs, rat anti-mouse DEC205 mAb (PharMingen, San Diego, CA, USA) and rat anti-mouse CD11c mAb (PharMingen) to identify DC. Rat IgG2a (PharMingen) and rat IgG1 were used as isotype control. Sections were preincubated with rabbit serum and sequentially incubated with optimal dilution of biotinylated rabbit anti-rat IgGs and streptavidin-HRP (PharMingen). Each incubation lasted 30 min and was followed by a 10-min wash in Tris-buffered saline. Sections were then stained with CN/DAB substrate kit (Pierce) according to the manufacturer's instructions and finally lightly counterstained with hematoxylin. The number of immunostained cells was examined by light microscopy at ´200 magnification.
Assay for cytokine production by tumor nodules, lymph nodes and spleen
The cytokine productions in tumors, lymph nodes and spleens were determined 3 days after administration of the AdMDC as described procedures.34 In brief, non-necrotic tumors were harvested, cut into small pieces, and passed through a sieve. Tumor cells (5 ´ 106 cells/ml) were evaluated for the production of IL-4, IL-12, IL-2 and IFN by ELISA in the supernatants after an overnight culture. Tumor-draining lymph nodes and spleens were recovered from mice injected with AdMDC. After passing the homogenate through a sieve, erythrocytes were lysed with 0.8 M Tris-NH4Cl buffer. Lymph nodes or spleen-derived lymphocytes were restimulated with irradiated 3LL (105 cell/ml) at a ratio of 50:1 (target/stimulator) in a total volume of 5 ml. After an overnight culture, supernatants were harvested and IL-4, IL-12, IL-2 and IFN were determined by ELISA. Mouse IL-4, IL-12 (p70), IL-2 and IFN ELISA kits were obtained from R&D Systems.
The procedure used to isolate DC from spleens was described previously58 with minor modifications. Briefly, splenic cells were cultured in 100 ´ 20 mn2 culture dishes (Becton Dickinson Labware, Franklin Lakes, NJ, USA) for 2 h after lysis of red cells. The non-adherent cells were washed away with warmed medium and the adherent cells (5 ´ 106 cells/ml) were cultured overnight in fresh complete RPMI 1640 without cytokines. The production of IL-12 in the supernatants after overnight culture was determined by ELISA.
Statistical analysis
All experiments were performed three times using individual treatment groups of 10 mice. The data are presented as mean ± s.d. Statistical analysis was performed using Student's t test. Statistical significance was determined at P < 0.05. Survival estimates and median survivals were determined using the method of Kaplan and Meier.
|
 | Acknowledgements
This work was supported by grants from the TRAPOYT, National Natural Science Foundation of China (30/2/002, 30028022) and National Key Basic Research Program of China(2001CB510002). We thank Dr Zhenglong Yuan, Dr Zhenhong Guo, Dr Rui Zhang and Dr Hongmin Li for their expert technical assistance.
|  |
| References |
 |
1 Godiska Ret al. . Human macrophage-derived chemokine (MDC), a novel chemoattractant for monocytes, monocyte-derived dendritic cells, and natural killer cells. J Exp Med 1997; 185: 1595-1604. MEDLINE
2 Imai Tet al. . Macrophage-derived chemokine is a functional ligand for the CC chemokine receptor 4. J Biol Chem 1998; 273: 1764-1768. MEDLINE
3 Vestergaard Cet al. . Overproduction of Th2-specific chemokines in NC/Nga mice exhibiting atopic dermatitis-like lesions. J Clin Invest 1999; 104: 1097-1105. MEDLINE
4 Gonzalo JAet al. . Mouse monocyte-derived chemokine is involved in airway hyperreactivity and lung inflammation. J Immunol 1999; 163: 403-411. MEDLINE
5 Matsukawa Aet al. . Pivotal role of the CC chemokine, macrophage-derived chemokine, in the innate immune response. J Immunol 2000; 164: 5362-5368. MEDLINE
6 Imai Tet al. . Selective recruitment of CCR4-bearing Th2 cells toward antigen-presenting cells by the CC chemokines thymus and activation-regulated chemokine and macrophage-derived chemokine. Int Immunol 1999; 11: 81-88. Article MEDLINE
7 Golumbek PTet al. . Treatment of established renal cancer by tumor cells engineered to secrete interleukin-4. Science 1991; 254: 713-716. MEDLINE
8 Tepper RI, Pattengale PK, Leder P. Murine interleukin-4 displays potent anti-tumor activity in vivo. Cell 1989; 57: 503-512. MEDLINE
9 Noffz G, Qin Z, Kopf M, Blankenstein T. Neutrophils but not eosinophils are involoved in growth suppression of IL-4-secreting tumors. J Immunol 1998; 160: 345-360. MEDLINE
10 Schuler Tet al. . T helper cell type 1-associated and cytotoxic T lymphocyte-mediated tumor immunity is impaired in interleukin 4-deficient mice. J Exp Med 1999; 189: 803-810. MEDLINE
11 Hochrein Het al. . Interleukin-4 is a major regulatory cytokine governing bioactive IL-12 production by mouse and human dendritic cells. J Exp Med 2000; 192: 823-833. MEDLINE
12 Rissoan MCet al. . Reciprocal control of T helper cell and dendritic cell differentiation. Science 1999; 283: 1183-1186. Article MEDLINE
13 Mitchell DA, Nair SK, Gilboa E. Dendritic cell/macrophage precursors capture exogenous antigen for MHC class I presentation by dendritic cells. Eur J Immunol 1998; 28: 1923-1933. Article MEDLINE
14 Timmerman JM, Levy R. Dendritic cell vaccines for cancer immunotherapy. Annu Rev Med 1999; 50: 507-529. MEDLINE
15 Restifo NPet al. . Identification of human cancers deficient in antigen processing. J Exp Med 1993; 177: 265-272. MEDLINE
16 Tamada Ket al. . LIGHT, a TNF-like molecule, costimulates T cell proliferation and is required for dendritic cell-mediated allogeneic T cell response. J Immunol 2000; 164: 4105-4110. MEDLINE
17 Chapoval AIet al. . B7-H3: A costimulatory molecule for T cell activation and IFN-gamma production. Nat Immunol 2001; 2: 269-274. Article MEDLINE
18 Qin Z, Noffz G, Mohaupt M, Blankenstein T. Interleukin-10 prevents dendritic cell accumulation and vaccination with granulocyte-macrophage colony-stimulating factor gene-modified tumor cells. J Immunol 1997; 159: 770-776. MEDLINE
19 Sato Ket al. . TGF- 1 reciprocally controls chemotaxis of human peripheral blood monocyte-derived dendritic cells via chemokine receptors. J Immunol 2000; 164: 2285-2295. MEDLINE
20 Tsujitani Set al. . Langerhans cells and prognosis in patients with gastric carcinoma. Cancer 1987; 59: 501-505. MEDLINE
21 Zeid NA, Muller HK. S100 positive dendritic cells in human lung tumors associated with cell differentiation and enhanced survival. Pathology 1993; 25: 338-343. MEDLINE
22 Bell Det al. . In breast carcinoma tissue, immature dendritic cells reside within the tumor, whereas mature dendritic cells are located in peritumoral areas. J Exp Med 1999; 190: 1417-1426. MEDLINE
23 Regulier Eet al. . Adenovirus-mediated delivery of antiangiogenic genes as an antitumor approach. Cancer Gene Ther 2001; 8: 45-54. MEDLINE
24 Rollins BJ. Chemokines. Blood 1997; 90: 909-928. MEDLINE
25 Baggiolini M, Dewald B, Moser B. Human chemokines: an update. Annu Rev Immunol 1997; 15: 675-705. MEDLINE
26 Mantovani A, Allavena P, Vecchi A, Sozzani S. Chemokines and chemokine receptors during activation and deactivation of monocytes and dendritic cells and amplificationof Th1 versus Th2 response. Int J Clin Lab Res 1998; 28: 77-82. MEDLINE
27 Vecchi Aet al. . Differential responsiveness to constitutive vs inducible chemokines of immature and mature mouse dendritic cells. J Leukoc Biol 1999; 66: 489-494. MEDLINE
28 Lane PJ, Brocker T. Developmental regulation of dendritic cell function. Cur Opin Immunol 1999; 11: 308-313.
29 Nakashima Eet al. . A candidate for cancer gene therapy: MIP-1 alpha gene transfer to an adenocarcinoma cell line reduced tumorigenicity and induced protective immunity in immunocompetent mice. Pharm Res 1996; 13: 1896-1901. MEDLINE
30 Mule JJet al. . RANTES secretion by gene-modified tumor cells results in loss of tumorigenicity in vivo: role of immune cell subpopulations. Hum Gene Ther 1996; 20: 1545-1553.
31 Hedrick JA, Zlotnik A. Lymphotactin. Clin Immunol Immunopathol 1998; 87: 218-222. Article MEDLINE
32 Emtage PCet al. . Adenoviral vectors expressing lymphotactin and interleukin 2 or lymphotactin and interleukin 12 synergize to facilitate tumor regression in murine breast cancer models. Hum Gene Ther 1999; 20: 697-709.
33 Dilloo Det al. . Combined chemokine and cytokine gene transfer enhances antitumor immunity. Nat Med 1996; 2: 1090-1095. MEDLINE
34 Sharma Set al. . Secondary lymphoid tissue chemokine mediates T cell-dependent antitumor response in vivo. J Immunol 2000; 164: 4558-4563. MEDLINE
35 Braun SEet al. . The CC chemokine CK beta-11/MIP-3 beta/ELC/Exodus 3 mediates tumor rejection of murine breast cancer cells through NK cells. J Immunol 2000; 164: 4025-4031. MEDLINE
36 Fushimi T, Kojima A, Moore MA, Crystal RG. Macrophage inflammatory protein 3alpha transgene attracts dendritic cells to established murine tumors and suppresses tumor growth. J Clin Invest 2000; 105: 1383-1393. MEDLINE
37 Chantry Det al. . Macrophage-derived chemokine is localized to thymic medullary epithelial cells and is a chemoattractant for CD3(+), CD4(+), CD8(low) thymocytes. Blood 1999; 94: 1890-1898. MEDLINE
38 Steinman RM. The dendritic cell system and its role in immunogenicity. Annu Rev Immunol 1991; 9: 271-296. MEDLINE
39 Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature 1998; 392: 245-252. Article MEDLINE
40 Chapoval AI, Tamada K, Chen L. In vitro growth inhibition of a broad spectrum of tumor cell lines by activated human dendritic cells. Blood 2000; 95: 2346-2351. MEDLINE
41 Gilboa E, Nair SK, Lyerly HK. Immunotherapy of cancer with dendritic-cell-based vaccines. Cancer Immunol Immunother 1998; 46: 82-87. Article MEDLINE
42 Sozzani S, Aliavena P, Vecchi A, Mantovani A. The role of chemokines in the regulation of dendritic cell trafficking. J Leuk Biol 1999; 66: 1-9.
43 Hirao Met al. . CC chemokine receptor-7 on dendritic cells is induced after interaction with apoptotic tumor cells: critical role in migration from the tumor site to draining lymph nodes. Cancer Res 2000; 60: 2209-2217. MEDLINE
44 Morse MAet al. . Generation of dendritic cells in vitro from peripheral blood mononuclear cells with granulocyte-macrophage colony-stimulating factor interleukin-4 and tumor necrosis factor-alpha for use in cancer immunotherapy. Ann Surg 1997; 226: 6-16. Article MEDLINE
45 O'Doherty U, Ignatius R, Bhardwaj N, Pope M. Generation of monocyte-derived dendritic cells from precursors in rhesus macaque blood. J Immunol Meth 1997; 207: 185-194.
46 Platzer Cet al. . Interleukin-4-mediated tumor suppression in nude mice involves interferon-gamma. Eur J Immunol 1992; 22: 1729-1733. MEDLINE
47 Bosco Met al. . Low doses of IL-4 injected perilymphatically in tumor-bearing mice inhibit the growth of poorly and apparently nonimmunogenic tumors and induce a tumor-specific immune memory. J Immunol 1990; 145: 3136-3143. MEDLINE
48 de Saint-Vis Bet al. . The cytokine profile expressed by human dendritic cells is dependent on cell subtype and mode of activation. J Immunol 1998; 160: 1666-1676. MEDLINE
49 Kerkvliet NIet al. . Inhibition of TC-1 cytokine production, effector cytotoxic T lymphocyte development and alloantibody production by 2,3,7,8-tetrachlorodibenzo-p-dioxin. J Immunol 1996; 157: 2310-2319. MEDLINE
50 Erbs Pet al. . In vivo cancer gene therapy by adenovirus-mediated transfer of a bifunctional yeast cytosine deaminase/uracil phosphoribosyltransferase fusion gene. Cancer Res 2000; 60: 3813-3822. MEDLINE
51 Chartier Cet al. . Efficient generation of recombinant adenovirus vectors by homologous recombination in Escherichia coli. J Virol 1996; 70: 4805-4810. MEDLINE
52 Lusky Met al. . In vitro and in vivo biology of recombinant adenovirus vectors with E1, E1/E2A, or E1/E4 deleted. J Virol 1998; 72: 2022-2032. MEDLINE
53 Ju DWet al. . Adenovirus-mediated lymphotactin gene transfer improves therapeutic efficacy of cytosine deaminase suicide gene therapy in established murine colon carcinoma. Gene Therapy 2000; 7: 329-338. MEDLINE
54 Cao Xet al. . Therapy of established tumour with a hybrid cellular vaccine generated by using granulocyte-macrophage colony-stimulating factor genetically modified dendritic cells. Immunology 1999; 97: 616-625. Article MEDLINE
55 Zhang Wet al. . Enhanced therapeutic efficacy of tumor RNA-pulsed dendritic cells after genetic modification with lymphotactin. Hum Gene Ther 1999; 10: 1151-1161. Article MEDLINE
56 Cao Xet al. . Lymphotactin gene-modified bone marrow dendritic cells act as more potent adjuvants for peptide delivery to induce specific antitumor immunity. J Immunol 1998; 161: 6238-6244. MEDLINE
57 Horan PK, Melnicoff MJ, Jensen BD, Slezak SE. Fluorescent cell labeling for in vivo and in vitro cell tracking. Meth Cell Biol 1990; 33: 469-490.
58 Liu Let al. . Induction of Th2 cell differentiation in the primary immune response: dendritic cells isolated for adherent cell culture treated with IL-10 prime naive CD4 T cells to secrete IL-4. Int Immunol 1997; 10: 1017-1026.
|
 |
| Figures |
 |
Figure 1 MDC expression by 3LL cells transfected with AdMDC. (a) RT-PCR analysis for human MDC expression in vivo. RNA was extracted from tumors 3 days after intratumoral administration of AdMDC, LacZ or PBS. RT-PCR was performed using specific primers for human MDC and specific primers for -actin. Electrophoresis with 2% agarose gel was performed for the PCR products. Lane 1, marker; lane 2, PBS; lane 3, AdLacZ; lane 4, AdMDC. (b) Western blot analysis of human MDC protein in the cell lysates and in the culture supernatants of 3LL cells transfected with AdMDC. Cell lysates (lanes 1, 3, 5) and culture supernatants (lanes 2, 4, 6) were prepared 48 h after transfection with AdMDC or AdLacZ, then electrotransferred on to nitrocellulose membrane and incubated with anti-human MDC monoclonal antibody. Lanes 1 and 2, wild-type 3LL cells; lanes 3 and 4, 3LL transfected with AdLacZ; lanes 5 and 6, 3LL transfected with AdMDC. |
Figure 2 Induction of migration of mouse DC and T cells by the supernatants of 3LL cells infected with AdMDC. Mouse DC (a) or nylon wool-purified T cells (b) were loaded into the upper well of a transwell chamber, different dilutions of the supernatants of 3LL cells 3 days after transfection with AdMDC, or AdLacZ, or supernatants of wild-type 3LL cells were added to the lower well. The chamber was incubated for 4 h at 37°C. The cell migration was expressed as the number of cells that had migrated to the lower well, seen in five high power fields. The data are presented as mean ± s.d. Results reported are the representative of three independent experiments. |
Figure 3 Antitumor effects of intratumoral MDC gene transfer in a murine model with pre-established subcutaneous tumors. (a) Suppression of tumor growth by intratumoral injection of AdMDC. 3LL tumor cells (1 ´ 106 cells in 100 l) were injected subcutaneously into C57BL/6 mice. The tumor-bearing mice were injected with 1 ´ 109 p.f.u. of AdMDC, AdLacZ, or PBS 7 days after tumor inoculation. The size of each tumor was monitored every 2 days and expressed as the average tumor area (mm2) ± s.d. (b) Survival rate of tumor-bearing mice after AdMDC intratumoral injection. Mice were killed when the tumors reached 3 cm in diameter or appeared moribund, and this was recorded as the date of death for survival studies. Survival was recorded as the percentage of surviving animals (n = 10 mice per group). |
Figure 4 Effector cells involved in the antitumor response of MDC gene transfer. (a) Induction of tumor-specific CTL in tumor-bearing mice after treatment with AdMDC. Splenic lymphocytes were isolated from tumor-bearing mice 12 days after adenovirus administration and were cocultured at a concentration of 1 ´ 107 cells/ml with 1 ´ 106 cells/ml inactivated 3LL tumor cells for 7 days to induce CTL effector cells. The cytotoxicity was determined by a standard 4-h 51Cr-release assay by utilizing 3LL cells as target cells. The syngeneic EL4 lymphoma cells were used as control target cells. Each point represents the mean of triplicates. The experiment was repeated once with similar results. (b) In vivo depletion analysis with anti-CD4, anti-CD8 or anti-NK monoclonal antibodies was performed as described in Materials and methods. |
Figure 5 Chemoattraction and facilitated migration of DC after intratumoral AdMDC administration. DC (1 ´ 106 in 100 l) were labeled with the red fluorescence marker PKH-26 and injected subcutaneously into the mice at a distance of 2 cm anterior to the tumor in the flank region 3 days after intratumoral administration of the AdMDC, AdLacZ or PBS. After 24 h, mice were killed and tumor (a, b, c) were examined by fluorescence microscopy. The infiltration of endogenous DC into tumor sites (d, e, f) were performed by immunohistochemistry on isolated tumors 3 days after administration of AdMDC without injection of DC expanded in vitro as described in Materials and methods. PKH-26-labeled DC (1 ´ 106 in 100 l) were injected intratumorally 3 days after AdMDC, AdLacZ or PBS injection and the ipsilateral inguinal lymph nodes (g, h, i) and spleens (j, k, l) were isolated 2 h later for fluorescence microscopy assay. |
Figure 6 Production of cytokines after MDC gene transfer in tumor-bearing mice. Tumor nodules were evaluated 3 days after administration of the AdMDC, AdLacZ or PBS for the production of IL-4, IL-12, IL-2 and IFN- in the supernatants after an overnight culture (5 ´ 106 cells/ml). Lymph nodes or spleen-derived lymphocytes from individual mouse were restimulated with irradiated 3LL tumor cells (105 cell/ml) at a ratio of 50:1 (target/stimulator) in a total volume of 5 ml. After an overnight culture, supernatants were harvested and IL-12 (a), IL-2 (b), IFN- (c) and IL-4 (d) productions were determined using ELISA kits. The procedure used to isolate DC from spleens and the determination of IL-12 production in the supernatants of these DC was performed as described in Materials and methods. The data are presented as means ± s.d. (n = 4 per data point). |
Figure 7 Kinetics of cytokine levels in serum of tumor-bearing mice after intratumoral MDC gene transfer. Serum was evaluated at different time-points after administration of the AdMDC, AdLacZ or PBS for the presence of IL-4 (a), IL-2 (b) and IL-12 (c). Kinetics of IL-12 (d) level was observed in serum of IL-4-/- tumor-bearing mice after intratumoral MDC gene transfer. The contents of the cytokines were assayed with ELISA. The data are presented as means ± s.d. (n = 3 per data point). |
Figure 8 Impaired antitumor effect of intratumoral MDC gene transfer in IL-4-/- tumor-bearing mice. C57BL/6 wild-type or IL-4-/- mice bearing 3LL carcinoma were intratumorally injected with AdMDC or AdLacZ as described in Materials and methods. The size of each tumor was monitored every 2 days and expressed as the average tumor size (mm2) ± s.d. (n = 10 mice per group). |
 |
 |
 |
| Received 6 August 2001; accepted 28 January 2002 |
 |
| June 2002, Volume 9, Number 12, Pages 793-803 |
 |
| Table of contents Previous Article Next [PDF] |
|
|