¹Muscle Cell Biology Group, MRC, Clinical Sciences Centre, Imperial College School of Medicine, Hammersmith Campus, London, UK

²Gene Targetting Group, Department of Neuromuscular Diseases, Division of Neurosciences and Psychological Medicine, Imperial College School of Medicine, Charing Cross Campus, London, UK

Correspondence to: G Bou-Gharios, Muscle Cell Biology Group, MRC Clinical Sciences Centre, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London W12 0NN, UK

Muscle can be used for systemic delivery of non-muscle proteins. In order to investigate the relative effectiveness of direct DNA plasmid injection versus implantation of genetically modified myogenic cell lines, we have used the human alpha 1 anti-trypsin (1AT) cDNA driven by either cytomegalovirus (CMV) or the muscle creatine kinase 3.3 kb (MCK) promoter in immunodeficient mice. We dem- onstrate that the implantation of transfected myoblasts stably expressing the human 1AT cDNA generates a more persistent production of 1AT than does direct intramuscular injection of the same construct as plasmid DNA. Moreover, immunohistological labelling of muscle sections implanted with myoblasts show that the newly formed muscle fibres are those containing the human protein.

plasmid DNA; transfection; alpha 1 anti-trypsin; myoblast implantation

Introduction

Over recent years, skeletal muscle has been extensively investigated as a target for gene therapy regimes, not only to correct inherited myopathies¹ but also for the production and secretion of gene products^2,3 for systemic delivery. Skeletal muscle is readily susceptible to, and easily accessible for gene manipulation by either in vivo gene transfer, eg direct injection of naked DNA, or implantation of genetically modified myoblasts. However, as with viral transduction, naked plasmid injection can elicit an immune reaction against the encoded peptide in immunocompetent mice. This may result in the inactivation/clearance of the secreted protein⁴ and immune rejection of transfected fibres involved in synthesis of this protein.⁵ As an alternative, implantation of myogenic lines stably transduced ex vivo has an added advantage in that the grafted myoblasts should be able to maintain a continuous supply of the transfected gene product even when recombinant myofibres are damaged.⁶

In order to investigate the relative effectiveness of direct DNA plasmid injection versus implantation of genetically modified myogenic cell lines, we have used the human alpha 1 anti-trypsin (1AT) cDNA driven by either cytomegalovirus (CMV) or the muscle creatine kinase 3.3 kb (MCK) promoter in immunodeficient mice. Alpha 1 anti-trypsin is a serine protease inhibitor which functions to protect the lung from neutrophil elastase activity. We chose this protein because it is secreted into the blood stream and we can specifically immunodetect the human enzyme and compare the level in the serum with the expression in the muscle fibres.

Results

Stable transfection of myoblast cell lines with 1AT

Several clones transfected with either pDNA1AT or pDCK1AT were tested for their ability to secrete 1AT and at the same time fuse into myotubes by comparison with untransfected myoblasts. We noted that clones which showed high secretion of 1AT were the least myogenic, forming few myotubes in vitro under non-permissive conditions; these were therefore discarded. Table 1 shows data from two clones which were selected as having shown the highest secretion of 1AT while retaining myogenicity. The T2-2 cell line was sham transfected with a vector alone and did not secrete 1AT. Ninety percent of all myoblasts had fused into myotubes 192 h after plating. The CMV driven clone, C3.1.1 showed a similar level of 1AT secretion under both permissive and non-permissive conditions, presumably because the cytomegalovirus promoter is not muscle specific and is constantly being expressed. However, M7.1.2 myoblasts containing the muscle MCK promoter did not express 1AT until myotubes started to form in non-permissive conditions. This is expected since the endogenous MCK is not expressed in myoblasts; these synthesize the BB form of the protein and then gradually switch to the MM form as myotubes develop.⁷

Effect of naked DNA injection in muscle of mdx nude mice

For the first in vivo experiment, we used the same constructs tested in cell culture experiments as described above. Six mdx-nude mice were injected with each construct. The results from serum analysis shows a substantial level of human 1AT in the blood in the first and second week following the injection for CMV and MCK promoters, respectively (Figure 1) . This level was on average two-fold higher with the CMV compared with the MCK promotor. Surprisingly, there was a sharp decrease after the first week falling to a level just above the baseline by week 4 (Figure 1). As controls we tested serum from untreated mdx-nude mice and mdx-nude mice injected with a related plasmid that has the CMV promoter driving expression of human minidystrophin (Wells et al, in preparation). In neither case could we detect any expression of human 1AT.

Effect of naked DNA injection in muscle of MF1-nude mice

We suspected that the continuous degeneration-regeneration of muscle that typifies the mdx pathology was the cause of the reduction in 1AT levels with time since we did not expect an immune response in a nude mouse background. In the second in vivo experiment, we used MF1-nude mice and injected six mice in each group with 1AT constructs driven by either CMV (pBScmv1AT) or MCK promoters (pBSmck1AT) in a modified bluescript backbone. These second generation constructs did not contain the neo selection marker. Injected mice were killed at 1, 2, 4 and 10 weeks to provide a muscle sample to investigate the levels of 1AT in situ. The pattern of the serum sample results (not shown) was exactly the same as obtained with the mdx nude mice, shown in Figure 1. The peak levels of 1AT were lower than those obtained in mdx-nudes, but the overall reduction in the serum level followed the same pattern. This unexpected result suggested that the plasmid DNA may be gradually lost from the injected muscle.

PCR for the presence of plasmid in the muscle

To investigate the cause of the reduction in levels of 1AT in blood serum, we used PCR to determine whether the plasmid was still present in the injected muscles. Given the small number of 'transgenic' fibres even in the sections showing the highest number of 1AT positive fibres, we used nested PCR for optimum sensitivity. The results showed the presence of the expected product size in varying amount for both CMV (Figure 2) and MCK (data not shown) driven constructs in most tested muscles.

Antibodies against human 1AT in MF1 nude mice

To test whether a non-specific immune response might cause the down-regulation of human 1AT in the MF1 nude mice, we injected 50 g of pCMV5 plasmid alone or pCMV1AT into seven mice in each group. Blood was collected at 0, 1, 2, 4 and 8 weeks after injection. The serum was analysed by ELISA for 1AT and antibodies against the protein. The results show that, while sera from mice injected with the vector alone had very little detectable human 1AT (Figure 3b), the mice injected with pCMV1AT had a high level of the protein in the first week after injection which gradually decreased by week 8 (Figure 3a). The maximum level attained with this construct was the highest found in our studies, with an average of 15 ng/ml of serum. However, there was a consistent failure to sustain such levels beyond the first week after injection. Whilst specific antibodies against human 1AT were detected, there was very little 1AT-specific IgG (Figure 4) suggesting that the response to injection of the plasmid was primarily IgM. No 1AT-specific antibodies were detected in untreated or the pretreated mice. No correlation was found between the level of 1AT and either the level of total 1AT-specific Ig or IgG. The serum of the MF1-nudes was also tested for the level of creatine kinase (CK) to assess the leakiness of the muscle at various time-points. The results showed no significant leakage at 1 week or thereafter (data not shown).

Immunolocalisation of 1AT in plasmid injected muscle

Cryostat sections of muscles from mdx-nude mice directly injected with plasmid DNA were immunostained with a rabbit anti-human 1AT antibody to identify the structures expressing 1AT. Muscle fibres were stained with varying intensity during the first week after injection and the protein remained detectable throughout the duration of the experiment (Figure 5). The maximum number of positive fibres recorded at any particular whole section of each tibialis anterior (TA) muscle was compared with the serum level of 1AT produced by that particular mouse. No correlation was found between the level of 1AT detected in the serum and the number of positive fibres at any given time (Figure 4). This correlation did not improve by considering the total number of positive fibres throughout the muscle.

Myoblast implantation in mdx-nude mice

Myoblast clones secreting human 1AT were expanded in tissue culture. 5 ´ 10⁵ cells were transplanted into each of the pre-irradiated TA muscles. Six mice in each group were transplanted with the CMV driven 1AT clone, C3.1.1, the MCK driven 1AT clone, M7.1.2. or T-2-2 cells as control. The mice were bled at weekly intervals up to 10 weeks following implantation. Myoblasts containing 1AT formed varying amounts of new muscle when injected into mdx-nude mouse muscle. The serum levels of 1AT generated by the transplants are shown in comparison with the direct injection data (Figure 6). No 1AT secretion was detected in mice transplanted with T 2-2 control cells, while results from transfected cells show a gradual increase in 1AT serum levels plateauing at 2 weeks and remaining at this level for the 10 weeks of the experiment. Compared to mdx-nude injected with the same constructs as plasmid DNA, it is apparent that the transfected cells implanted in the TA produce a lower level of 1AT in the serum than the maximum obtained with plasmid injected in the same muscle. However, this production was sustained in mice implanted with myoblasts. Furthermore, staining of the muscle for dystrophin and 1AT showed that it is the dystrophin-positive muscle fibres that stained for human 1AT (Figure 7).

Discussion

In this study, we directly compared two methods for gene delivery to skeletal muscle using the same constructs. We used plasmids containing the human 1AT cDNA driven by a strong viral promoter, the immediate-early promoter of CMV and similar constructs driven by the muscle specific MCK promoter. The strength and persistence of expression of these constructs was tested using two delivery methods, namely, direct plasmid DNA injection compared with transplantation of ex vivo transfected myoblasts. In order to minimise interference by the immune system, we used athymic nude mice.

With the direct injection of plasmid DNA, we observed a peak level at 1 and 2 weeks for CMV and MCK promoters, respectively. This was followed by a significant reduction in the serum levels of human 1AT. In contrast, steady state levels of 1AT in the serum followed myoblast transplantation. The level of 1AT produced by either method of gene transfer was higher with the CMV promoter and was comparable to human 1AT expression in skeletal muscle reported in a previous study.⁸ However, this level is far below the normal endogenous level in humans and at such low efficiency we estimate that one would need to inject all skeletal muscles to achieve a therapeutic concentration for the treatment of 1AT deficiency. Thus a future goal may be to find much stronger promotors or alternative constructs such as genomic DNA reported recently.⁹ What is worth noting is that some 25 000 myoblasts, the estimated 5% that survive the first 24 h after transplantation¹⁰ represents a promising, long-term, systemic delivery of therapeutic proteins. Indeed, we show an immunohistological relationship between the implanted myoblast carrying the transgene with the detection of the human 1AT in the mouse serum. Although not every dystrophin-positive fibre expressed the human protein, most likely due to the low sensitivity of the immunolabelling technique, 1AT labelling was found only in the fibres which expressed dystrophin. Sustained expression of another protein, factor IX, following myoblast transplantation has been reported by several groups.^11,12,13

There are several possible explanations for the reduction in serum levels of human 1AT with time following plasmid DNA gene transfer. Initially, we considered that the pathology of the mdx mouse might play a role, as the cycles of fibre degeneration and regeneration characteristic of dystrophin-deficient muscle,¹⁴ may lead to the loss of episomal plasmid DNA. However, when the same constructs were injected into MF1-nude mice, similar results were obtained, albeit at a slower rate. The rate of decline may thus be partly attributed to the mdx pathology but the progressive diminution in the amount of secreted protein suggests that any role played by the mdx pathology was incidental. PCR from the muscle homogenates demonstrated that plasmid DNA was present in the muscle up to 10 weeks after injection. However, this assay did not measure the amount of plasmid DNA because only few sections of the muscle were used.

An alternative explanation for the plasmid results might relate to the peak levels at 1 week rather than the lower levels at later time-points. Plasmid DNA causes extensive inflammation when injected into skeletal muscle,¹⁵ and this inflamed environment might lead to muscle damage and/or leakiness of muscle membranes. However, the level of serum creatine kinase, a useful marker of muscle damage,¹⁴ was not significantly higher than normal and showed no variation over time thus suggesting that increased leakage of 1AT at 1 week was unlikely.

A third possibility for the fall in 1AT levels is that immunoglobulins may sequester and mask serum levels of 1AT. The athymic nude mice lack the thymic epithelial cells for the education of the T cell lineage,¹⁶ but have B cells that may be able to mount a limited humoral immune response to foreign proteins in the absence of T-helper cells. We must therefore entertain the idea that immunoglobulin, mainly IgM, may bind circulating 1AT and therefore reduce the total level detected by our ELISA. Higher levels of IgM may be generated following plasmid gene transfer compared with myoblast transplantation as plasmid DNA has been shown to directly stimulate B cell.^17,18 Although we found evidence of Ig binding to 1AT in ELISA assays, we observed no significant correlation, positive or negative, between the amount of 1AT and the amount of Ig which became bound to it (Figure 4).

Finally, we considered a fourth possibility, that promoter down-regulation might account for the decline in serum levels of 1AT with time following direct injection of plasmid DNA. A decline in expression of several genes has been reported for CMV driven constructs,^19,20 but not for MCK. It is possible that such decline is inherent to the direct injection method since promoter down-regulation should also be expected to reduce 1AT secretion following the implantation of transfected myoblasts, as they were generated with the same expression constructs. Additionally, while cytokines have been shown to reduce CMV activity in vitro,^21,22 the inflammation associated with plasmid administration and myoblast transplantation, falls rapidly and is essentially gone by 2 weeks after administration.

In this study, we have shown that direct injection of expression plasmids for 1AT into muscle, or transplantation into muscle of myogenic cells stably transfected ex vivo with these expression plasmids, will lead both to expression of 1AT within muscle fibres and the appearance of this peptide in the serum. It remains a moot point however, whether the 1AT demonstrable in the muscle fibres is directly related to the 1AT we find in the serum and a detailed study of the localization of this peptide in relation to the organelles of the known secretory pathways is a topic of current investigation.

Materials and methods

Constructs

The human full 1AT cDNA 1.4 kb was obtained from plasmid p8a1ppg (kind gift of Dr J Clark, Institute of Animal Physiology and Genetic Research, Edinburgh, UK) by PstI digestion and ligated into several vectors driven by various promoters as indicated in Table 2. The pCMV5 vector obtained from Dr M Stinski (University of Iowa, USA). A modified Bluescript KS with a 800 bp SV40 polyA at the 3' end was obtained from Professor G Dickson (Royal Holloway College, London, UK). For stable transfections, pcDNA3 (Invitrogen, Leek, Netherlands) was used to insert the 1AT cDNA into the multiple cloning site. For MCK constructs, the CMV promoter was substituted by 3.3 kb MCK promoter through blunt-end ligation. The MCK 3.3 kb promoter was a kind gift of Jean Buskin (University of Washington, USA). Plasmids were prepared using Qiagen columns (Crawley, UK) as previously described.¹⁵

Stable transfection of H2Kb myoblast cell line

A myoblast cell line T2-2 was derived from an H2K^bts-58 transgenic mouse as described Morgan et al.²³ These cells were transfected with pDNA1AT and pDCK1AT. The transfection was carried out by electroporation as follows: 2.5 million myoblasts were placed in 0.4 cm cuvette at 300 V at 960 F in 0.5 ml of F-10 medium and 45 g of linearised constructs. The surviving cells were seeded at 5 ´ 10³ per 10 cm² petri dish and cultured at the permissive temperature of 33°C in DMEM medium supplemented with 20% FCS, 1% chicken embryo extract and l-glutamine in the presence of murine IFN. The medium was changed 48 h later to fresh growth medium and 600 mg/ml of G418. Cells transfected with a similar plasmid lacking the neomycin gene were used as control. Cells which were resistant to G418 were cloned using cloning rings and tested for 1AT secretion using an ELISA assay on the culture medium. To assess whether the genetically modified myogenic clones still retain their ability to fuse in vitro, cells were cultured in duplicate at 10⁴ cells per well in eight-well Lab-tek flaskette at 33°C in the presence of IFN for 48 h. The medium was collected and fresh medium supplemented with 10% horse serum was added to the cultures and placed at 37°C without IFN. These non-permissive conditions promoted myotube formation.²³ The medium was removed for assay every 48 h for a total of 192 h, after which the cells were fixed and stained with toluidine blue and the number of nuclei forming myotubes was counted and divided by the total number of nuclei to give a fusion index.

Injection of plasmid DNA in vivo

Mdx-nude²⁴ or MF1-nude mice were used for naked DNA injection at 6-8 weeks of age. The mice were anaesthetised using Hypnorm-Hypnovel general anaesthesia, as previously described.²⁵ 25-50 g of plasmid in 25 l of a saline solution was injected percutaneously into the anterior tibialis muscle using a 27-gauge needle. Blood samples were collected from the tail vein before DNA injection and at weekly interval up to 12 weeks after injection.

Transplantation of mdx/nude mice with stably transfected myoblasts

Mdx-nude mice were anaesthetised at 4-6 weeks of age and legs irradiated at 18 Gy followed by myoblast transplantation 3-5 days later as described previously.²³ Briefly, 5 million cells of the 1AT transfected myoblast line were injected in the TA muscle, under anaesthesia, using a 5 l Hamilton syringe. The mice were allowed to recover and blood samples were taken for analysis at intervals up to 12 weeks. At the end of the experiments, the mice were killed and injected muscles were removed for analysis.

ELISA for alpha1 anti-trypsin in serum

The concentration of human 1AT in the mouse serum was measured by a double antibody sandwich enzyme linked immunosorbent assay (ELISA) with a detection range of 0.01-30 ng/ml using purified human 1AT protein (Enzyme Research Laboratories Ltd, Indiana, USA) as standard. 96-well microtitre plates were coated with affinity purified goat anti-1AT in 0.1 m bicarbonate buffer pH 9.0 overnight at 4°C. Following several washes with TBS with 1% Tween 20 and blocking nonspecific binding with 1% BSA in TBS for 30 min, the serum or culture medium was added and left to incubate for 120 min at room temperature. After three washes, a secondary antibody, rabbit anti-human 1AT was added for a further 120 min. After another round of washing to get rid of excess antibody, a third layer, goat anti-rabbit conjugated to HRP (DAKO, Ely, UK) was incubated for 120 min. More washes were carried out and the reaction was visualised with the addition of 0.5 mg/ml o-phenylediamine (OPD; Sigma, Poole, UK) and measured on an ELISA reader at 450 nm. Statistical analysis was carried out using a one way analysis of variance (ANOVA) followed by multiple comparisons with the student Neuman Keuls method.

Screening for antibodies against alpha1 anti-trypsin in serum

The serum used in the determination of the 1AT level was also used to detect if any antibodies were made against the human 1AT. This was also carried out by ELISA. A 96-well plate was coated with 0.5 mg/ml 1AT (Sigma) overnight at 4°C. After washing in TBS containing 1% Tween 20 and blocking nonspecific binding with 1% BSA in TBS for 30 min, the serum from experimental mice were added for 120 min at room temperature. Following several washes, antibodies bound to the protein were detected using goat anti-mouse antibody conjugated to HRP (DAKO) and visualised using OPD substrate as above. The standard curve was made up using a serial dilution of a mouse monoclonal antibody against human 1AT (Biogenesis, Poole, UK).

Examination of CK levels in the serum

Serum samples were prepared by clot retraction and spinning to remove any red blood cells. Samples were stored at -70°C until assayed. 1 l of serum was placed into an ELISA plate (Greiner, Stonehouse, UK) and 200 l of prewarmed assay buffer added. The NAC activated CK assay kit from Boehringer (Lewes, UK) was used. Several bottles of buffer and reagent were prepared and warmed to 37°C to ensure uniformity of reagent mix across all the samples. Serum plus assay mix was incubated in the ELISA plate reader at 37°C (Anthos HTIII) for 3 min and then assayed for increasing absorbance every minute over a perid of 10 min. The maximun rate of change in optical density over three time-points was used to calculate the number of units of creatine kinase by using a Precinorm U control standard from Boehringer and the Biolise software package (Anthos Labtech, Salzburg, Austria).

Immunocytochemical identification of muscle fibres containing 1AT

Treated muscles were removed and snap frozen in isopentane cooled in liquid nitrogen. 6 m sections were cut transversally across the entire TA muscle. Serial sections were stained with H&E and antibodies against dystrophin and/or 1AT as follows:

Alpha1 anti-trypsin: Sections were fixed in 2% paraformaldehyde for 10 min. Following several washes in PBS and blocking the endogenous peroxidase activity with 1% hydrogen peroxide for 10 min, the sections were incubated in rabbit anti-human 1AT antibody (Sigma) for 60 min followed by goat anti-rabbit antibody conjugated to horse radish peroxidase for a further 60 min. The substrate di-amino benzidine, DAB was added in the presence of 0.1% hydrogen peroxide until a visible signal is seen. The sections were counterstained with haematoxylin and viewed under a microscope.

Dystrophin: The cell clone used in these experiments was derived from a non-dystrophic mouse. Muscles fibres formed from such clones express dystrophin which can easily be identified in the mdx mice which is deficient in this protein.²³ The muscle sections were blocked for non-specific binding using 20% goat serum in PBS with 1% BSA for 20 min, followed by rabbit anti-dystrophin antibody (P6, gift from Peter Strong, Sheffield University, Sheffield, UK) for 60 min at 1:400 dilution. After several washes in PBS, a biotinylated swine anti-rabbit antibody (1:500 dilution; Amersham, Little Chalfont, UK) was added for a further 60 min. The immune specificity was localised by a Streptavidin HRP (DAKO) and visualised by the addition of DAB as a substrate in the presence of 0.1% hydrogen peroxide. The sections were examined from the whole distance along the TA muscle and the section with the highest number of positive fibres was reported. 2000-3000 fibres were assessed per cross-section.

PCR for plasmid DNA in frozen muscle sections

DNA samples were extracted from eight frozen sections (6 m thick) of individual mice by immersing the sections directly in 0.5 ml of buffer containing Proteinase K and heated at 55°C overnight. The solutions were centrifuged and the supernatant was used as a template to PCR the plasmid fragment using forward and reverse primers. The primers were designed so the amplification crossed the border between the promoter sequence and 1AT cDNA. The product of the first PCR was used for a second round of PCR using nested primers. The primers for CMV were: TTGACTCACGGGTTCCA, forward and GGCTGTAGCGATGCTCACTG, reverse giving a product of 582 bp. The nested primers were AAA TGGGCGGTAGGCGTGTA, forward and TTGGT GCTGTTGGACTGGTG, reverse, giving a product of 405 bp. For the MCK promoter the primers were: GGACTGAGGGCAGGCTGTAA, forward and TTGGT GCTGTTGGACTGGTG, reverse, giving an expected band of 575 bp and the nested primers were TCA CACCCTGTAGGCTCCTC and ATAGGCTGAAGGCG AACTCA resulting in a product of 249 bp. The PCR conditions were as follows: 2 mm magnesium chloride was used with 28 cycles per run with Taq polymerase (Advanced Biotechnologies, Surrey, UK). The annealing temperature for the PCR was 57°C.

The PCR products were analysed on polyacrylamide gel. Muscle sections which were not plasmid injected or injected with vector alone, were used as control.

Acknowledgements

The authors would like to thank Dr Peter Strong for the P6 antibody, Jamie Morrison for technical assistance, Kim Wells for performing the CK assay and critical reading of the manuscript.

1 Partridge TA. Skeletal muscle as a target for gene therapy. Gene Therapy 1994; 1: 77-79, MEDLINE

2 Dahler A et al. Expression vectors encoding human growth hormone (hGH) controlled human muscle-specific promotors: prospects for regulated production hGH delivered by myoblast transfer or intravenous injection. Eur J Cell Biol 1994; 45: 305-310,

3 Miller G et al. Expression of factor VII by muscle cells in vitro and in vivo following direct gene transfer: modelling genetherapy for haemophilia. Gene Therapy 1995; 2: 736-742, MEDLINE

4 Morral N et al. Immune responses to reporter protein and high viral dose limit duration of expression with adenoviral vectors: comparison of E2a wild-type and E2a-deleted vectors. Hum Gene Ther 1997; 8: 1275-1286, MEDLINE

5 Wells KE et al. Immune responses, not promoter inactivation, are responsible for decreased long-term expression following plasmid gene transfer into skeletal muscle. FEBS Lett 1997; 407: 164-168, MEDLINE

6 Yao S, Kurachi K. Implanted myoblasts not only fuse with myofibers but also survive as muscle precursor cells. J Cell Sci 1993; 105: 957-963, MEDLINE

7 Chamberlain JS, Jaynes JB, Hauschka SD. Regulation of creatine kinase induction in differentiating mouse myoblast. Mol Cell Biol 1985; 5: 484-492, MEDLINE

8 Levy M et al. Characterization of plasmid DNA transfer into mouse skeletal muscle: evaluation of uptake mechanism, expression and secretion of gene products into blood. GeneTherapy 1996; 3: 201-211,

9 Schneider G et al. Genomic DNA transfer with a high-capacity adenovirus vector results in improved in vivo gene expression and decreased toxicity. Nat Genet 1998; 18: 180-183, MEDLINE

10 Beauchamp JR et al. Dynamics of myoblast transplantation reveal a discrete minority of precursors with stem cell-like properties as the myogenic source. J Cell Biol 1999; 144: 1113-1122, MEDLINE

11 Dai Y, Roman M, Naviaux RK, Verma IM. Gene therapy via primary myoblasts: long-term expression of factor IX protein following transplantation in vivo. Proc Natl Acad Sci USA 1992; 89: 10892-10895, MEDLINE

12 Yao SN, Smith KJ, Kurachi K. Primary myoblast-mediated gene transfer: persistent expression of human factor IX in mice. Gene Therapy 1994; 1: 99-107, MEDLINE

13 Wang JM, Zheng H, Blaivas M, Kurachi K. Persistent systemic production of human factor IX in mice by skeletal myoblast-mediated gene transfer: feasibility of repeat application to obtain therapeutic levels. Blood 1997; 90: 1075-1082, MEDLINE

14 Coulton GR et al. The mdx mouse skeletal muscle myopathy: I. A histological, morphometric and biochemical investigation. Neuropathol Appl Neurobiol 1988; 14: 53-70, MEDLINE

15 McMahon J et al. Inflammatory responses following direct injection of plasmid DNA into skeletal muscle. Gene Therapy 1998; 5: 1283-1290, MEDLINE

16 Nehls M et al. New members of the winged-helix protein family disrupted in mouse and rat nude mutations. Nature 1994; 372: 103-107, MEDLINE

17 Messina J, Gilkeson G, Pisetsky D. Stimulation of in vitro murine lymphocytes proliferation by bacterial DNA. J Immunol 1991; 147: 1759-1764, MEDLINE

18 Krieg A et al. CpG motifs in bacterial DNA trigger B cell activation. Nature 1995; 374: 546-549, MEDLINE

19 Manthorpe M et al. Gene therapy by intramuscular injection of plasmid DNA: studies on firefly luciferase gene expression in mice. Hum Gene Ther 1993; 4: 419-431, MEDLINE

20 Hartikka J et al. An improved plasmid DNA expression vector for direct injection into skeletal muscle. Hum Gene Ther 1996; 7: 1205-1217, MEDLINE

21 Qin L et al. Promoter attenuation in gene therapy: interferon-gamma and tumor necrosis factor-alpha inhibit transgene expression. Hum Gene Ther 1997; 8: 2019-2029, MEDLINE

22 Harms JS, Splitter GA. Interferon-gamma transgene expression driven by SV40 or CMV promoters but augments expression driven by the mammilian MHC I promoter. Hum Gene Ther 1995; 6: 1291-1297, MEDLINE

23 Morgan JE et al. Myogenic cell lines derived from transgenic mice carrying a thermolabile T antigen: a model system for the derivation of tissue-specific and mutation-specific cell lines. Dev Biol 1994; 162: 486-498, MEDLINE

24 Partridge TA et al. Conversion of mdx myofibres from dystrophin-negative to -positive by injection of normal myoblasts. Nature 1989; 337: 176-179, MEDLINE

25 Wells DJ. Improved gene transfer by direct plasmid injection associated with regeneration in mouse skeletal muscle. FEBS Lett 1993; 332: 179-182, MEDLINE

Figure 1 Serum levels of human 1AT of individual mdx-nude injected with plasmid DNA constructs driven by the CMV (a) and the MCK (b) promoters. The graphs show variation in the level of secreted protein in the serum of different mice. The peak level declined rapidly in both constructs. As controls we tested serum from untreated mdx-nude mice and mdx-nude mice injected with a related CMV-minidystrophin plasmid. In neither case could we detect any expression of human 1AT.

Figure 2 Photomicrograph of a polyacrylamide gel showing the PCR product derived from DNA extract of few muscle sections, where the muscle had been injected with the CMV promoter driving the human 1AT cDNA and removed after 1 week (lanes 1, 2), 2 weeks (lanes 3, 4), 4 weeks (lanes 5, 6) and 10 weeks (lanes 7, 8). Lane 9 contained control plasmid DNA that was carried out under the same conditions. Low intensity bands can be seen in both lanes 2 and 3 at close examination of the original gel. Negative controls produced no bands (data not shown).

Figure 3 Serum levels of human 1AT of individual MF1-nude injected with plasmid DNA constructs driven by the CMV promoter (a) and the vector alone (b). In a, there is a variation in the level of secreted 1AT between animals, as seen in Figure 1. However a slower rate of decline is noted following the initial peak compared with mdx-nude mice in Figure 1. The vector alone shows no human protein in sera of mice injected (b).

Figure 4 Titre of total 1AT-specific immunoglobulin and IgG in sera of seven mice, 8 weeks after injection with pCMV1AT. No 1AT-specific antibodies were detected in untreated or the pretreated mice. The graph also shows the serum level of 1AT at 8 weeks after injection and the number of stained fibres in the injected muscles.

Figure 5 Photomicrograph of a muscle section labelled for human 1AT and visualised with peroxidase staining 1 week following plasmid DNA injection in MF1/nude mouse. Different fibres show different levels of the protein inside the cytoplasm. This variability remains the same when sections are stained 12 weeks after plasmid DNA injection.

Figure 6 Comparison between levels of human 1AT protein detected in sera of six mice at each time point ± s.e.m. The mice were injected with human 1AT cDNA driven by either CMV (a) or MCK (b) as a plasmid DNA (histogram) or implanted with transfected myoblasts (line). (*) Refers to significant decrease in 1AT level (P < 0.05) for injected plasmid compared with the peak activity (**) for both CMV and MCK driven constructs. No significant change was seen in 1AT level using transfected cells. As controls we tested serum from untreated mdx-nude mice, mdx-nude mice injected with control T2-2 cells and mdx-nude mice injected with a related CMV-minidystrophin plasmid. None of these control groups showed any expression of human 1AT.

Figure 7 Photomicrographs showing staining for dystrophin around the periphery of muscle fibres. Such positive fibres can only be generated by the implanted myoblasts since the recipient mdx-nude mouse lacks the protein dystrophin. The lower panel shows an adjacent section labelled for human 1AT showing co-localisation of the human protein with some of the dystrophin-labelled fibres. Note that no fibre staining for 1AT was seen in dystrophin-negative fibres.

Table 1 Levels of alpha 1 anti-trypsin secreted in medium

Table 2 Construction of expression vectors