¹Sidney Kimmel Cancer Center, San Diego, CA, USA

²Division of Gastroenterology/Hepatology, Scripps Clinic and Research Foundation, La Jolla, CA, USA

Correspondence to: W F Reynolds, PhD, Sidney Kimmel Cancer Center, 10835 Altman Row, San Diego, CA 92121, USA. E-mail: wreynolds@skcc.org

This study was supported by grants to W.R. from the National Institutes of Health (RO1AG17879 and RO1CA72995) and the California Cancer Research Program (97-12013), and clinical research center grants from Scripps Clinic (MO1-RR00833).

The hepatitis C virus (HCV) is a major cause of liver disease and the complications of cirrhosis. Liver biopsies, performed prior to the development of liver cirrhosis, characteristically show an inflammatory cell infiltrate with varying degrees of fibrosis. Precisely how HCV infection induces hepatic fibrogenesis is unknown. Recent studies suggest the release of oxidants, cytokines and proteases from the host immune system are key to the development of fibrosis. Macrophages and neutrophils, cells heavily represented in the inflammatory cell response, contain the oxidant generating enzyme myeloperoxidase (MPO). Cellular levels of MPO can be influenced by a functional promotor polymorphism, -463G/A, which precedes the MPO gene. We examined the relationship between this MPO promotor genotype and the degree of fibrosis in 166 patients with chronic HCV infection. All patients had previously participated in clinical drug trials for the treatment of chronic HCV infection. The MPO genotype was determined from cryo-preserved lymphocytes obtained from patients prior to treatment. The degree of fibrosis was estimated from liver biopsy specimens obtained prior to treatment. We found that patients with the MPO GA/AA genotype were more likely to have advanced fibrosis scores compared with those with the GG genotype: Of the patients with GG genotype, 78% (79 of 102 cases) had lower Knodell Fibrosis scores of 0 or 1, compared to 56% (37 of 64 cases) of patients with GA/AA genotype (P < 0.05). The mechanism(s) by which MPO contributes to fibrosis progression remains to be determined.

Genes and Immunity (2002) 3, 345-349. doi:10.1038/sj.gene.6363880

hepatitis C virus; myeloperoxidase; hepatic fibrosis

Introduction

Chronic hepatitis C virus (HCV) affects nearly 3 million individuals in the United States and 170 million people worldwide. It is a leading cause of cirrhosis and end stage liver disease in developed countries. Approximately 70 to 80% of infected individuals develop chronic hepatitis C.^1,2 The hallmarks of chronic HCV infection are liver fibrosis and inflammation. Over a 20 to 25 year period, almost a quarter of chronic HCV-infected patients develop cirrhosis. The exact mechanism(s) by which HCV leads to fibrosis or cirrhosis in some patients and less severe liver injury in others are not well understood. Epidemiological studies have identified several factors associated with the evolution of chronic HCV-related cirrhosis. Host factors including age at acquisition of the infection, gender, and the lifetime history of alcohol use positively correlate with the degree of liver fibrosis.³ The importance of viral factors such as genotype and viral load as direct causes of liver injury is controversial, although both are important in predicting response to therapy.⁴

A generally held hypothesis is that the host immune response to HCV infected hepatocytes is responsible for liver injury and the subsequent development of hepatic fibrosis. The cellular elements comprising the host immune response are neutrophils, monocyte-macrophages (Kupffer cells) and lymphocytes. Neutrophils and monocyte-macrophages contain myeloperoxidase (MPO), an enzyme which catalyzes the reaction between chloride and hydrogen peroxide to generate hypochlorous acid and other reactive oxidants.⁵ Several studies show that the local release of oxidants, together with cytokines, damage 'bystander' hepatocytes. This leads to the activation of hepatic stellate cells.^6,7,8,9 Stellate cells produce extracellular matrix in the liver and their activity is recognized to be a central event in the development of hepatic fibrosis.^7,10

Cellular levels of MPO can be influenced by a functional promotor polymorphism, -463G/A, preceding the MPO gene at chromosome 17q23.1. The -463G/A base exchange creates an SP1 transcription factor binding site in the G allele,¹¹ and an estrogen receptor binding site in the A allele.¹² The GG genotype is linked to two to three-fold higher expression of MPO mRNA and protein compared with the GA or AA genotypes.¹³ Recent studies show MPO genotype to be associated with increased risk for a variety of inflammatory and autoimmune conditions.^{11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26} This suggests the local cellular expression of MPO may play a role in the pathogenesis of different disease states. In the present study, we investigated the relationship between the MPO promoter polymorphism and liver fibrosis in patients with chronic (HCV) hepatitis.

Results

Patient characteristics

The demographic details of the study group are summarized in Table 1. Briefly, the average age of the patients was 48 ± 8 years, and most were Caucasian men who currently drank less than 10 grams of alcohol per day. The mean duration of HCV infection was approximately 21 years. Over half of patients likely acquired the disease through blood transfusion or the sharing of needles and syringes used for intravenous drug use. The majority of patients (62%) were infected with genotype 1 HCV. The serum alanine transferase (ALT) levels were approximately three times the upper limit of normal and median serum HCV RNA concentrations were 3.9 ´ 10⁶ copies/ml.

There were 102 (61%) patients with genotype GG, 53 (32%) patients with gentoype GA and 11 (7%) patients with genotype AA. The frequencies of MPO genotypes within the study group were similar to those previously reported in normal populations.^12,21,17 In order to assess the influence of the GG genotype, which may be associated with a higher level of MPO activity, the degree of liver fibrosis in patients with GG genotype were compared with those with non-GG (GA/AA) genotype. Male gender, alcohol history and duration of infection in a patient with chronic HCV infection are known to adversely effect liver fibrosis.³ In order to establish whether any differences in the relationship between MPO genotype and liver fibrosis (see below) were independently associated, we compared the demographic features in patients with GG and non-GG MPO genotype using multivariate analysis (Table 2). Patients with GG and non-GG genotypes had similar mean age (47 ± 8 and 48 ± 9 years respectively), duration of infection (21 years), serum HCV RNA levels (3.1 ´ 10⁶ ± 2.3 ´ 10⁵ and 3.4 ´ 10⁶ ± 2.8 ´ 10⁵ copies/mL respectively) and baseline serum ALT values (128 ± 7.2 and 134 ± 9.4 IU/mL respectively). However, there were significantly more patients with HCV genotype 1 who carried MPO genotype GG (67% GG) compared with patients with HCV genotypes 2, 3 or 6 (50% GG) (P = 0.03). The relationship between current alcohol consumption and MPO genotype GG and non-GG could not be reliably estimated given the large proportion of patients in both groups who were unable to estimate their alcohol intake (38% and 31%, respectively).

MPO GA/AA genotype is associated with more fibrosis compared with GG genotype

The relationship between MPO genotype and fibrosis is shown in Figure 1. There was a significant difference amongst the groups (P < 0.05) in that patients with genotype GG had lower fibrosis scores compared with patients who had non-GG genotype. There were 79 (78%) patients with GG genotype with Knodell Fibrosis scores of 0 and 1 compared with 37 (58% who had non-GG genotype. This difference between MPO genotypes GG and non-GG was most apparent when comparing patients with portal fibrosis (Knodell score 1) and bridging fibrosis (Knodell score 3) (P < 0.001), as opposed to those with cirrhosis (Knodell score 4).

Interestingly, there were differences between percentages of MPO genotypes in HCV-1 infected patients versus non-HCV-1 infected patients: 67% of those with HCV-1 were GG genotype, compared to 50% of non-HCV-1 (2a, b, 3a, b, 4, 6) (P = 0.03). This raised the possibility that combinations of MPO and HCV genotypes could affect fibrosis. However, analysis showed no significant differences; patients with GA/AA genotype and HCV-1 had a mean Knodell fibrosis score of 1.86, compared with 1.72 for GA/AA and non-HCV-1 (Table 2) (P = 0.69). Patients with GG and HCV-1 had a mean score of 1.43, compared with 1.3 for GG and non-HCV-1 (P = 0.66). Irrespective of MPO genotype, HCV genotype did not correlate with the degree of fibrosis in this study group. HCV-1 genotypes had a mean fibrosis score of 1.57, compared with 1.51 for non-HCV-1 (P = NS).

Discussion

We found a clear relationship between MPO genotype and the severity of fibrosis in patients with chronic HCV infection. Patients with GA/AA genotype had more fibrosis compared to patients with GG genotype. These findings could not be reliably explained by differences in the duration of disease, alcohol history or gender; factors known to adversely effect the rate of fibrosis in patients with HCV. The trend we observed for increased fibrosis in GA/AA compared with GG genotypes was due to significant differences between the two groups with portal and bridging fibrosis, although a similar association was not observed in cirrhotic patients.

Precisely why the GG genotype is associated with less rather than more fibrosis compared with non-GG genotype is unclear. In vitro studies suggest that the GG genotype is associated with a two to three-fold higher expression of MPO mRNA and protein than the GA or AA genotypes.¹³ Thus, individuals with GG genotype would be predicted to have more oxidant-related hepatocyte damage compared with those of non-GG genotype. If so, this should result in greater stellate cell activation. However, our study shows the converse to be the case. Additionally, the reasons for not observing this effect for the GA/AA genotypes in cirrhotic patients relative to GG genotypes are not clear. This may be related to the relatively small number of patients with cirrhosis in this study (ie, a type II error). Alternatively the role of oxidant-related stellate cell activation and hepatocyte damage may be altered in cirrhosis compared to those with mild/moderate fibrosis, resulting in relative changes in the MPO genotype association. This hypothesis will require confirmation in larger studies.

The mechanisms through which MPO could be associated with hepatic fibrosis are unknown but likely to involve oxidants. Based on previous studies of MPO involvement in other inflammatory disease states, one possible mechanism is that invading neutrophils or monocyte-macrophages release MPO at inflammatory sites within the liver, and MPO generated hypochlorous acid and other oxidants damage bystander hepatic cells, eventually leading to fibrosis. Consistent with this fact, one of the hallmarks of the histopathological liver changes of chronic HCV infection is that of a chronic inflammatory cell infiltrate. MPO gene expression might also be induced in Kupffer cells, as resident macrophages in the liver. This phenomenon has also been observed in resident brain macrophage-microglia surrounding Alzheimer's plaques.¹⁵ In addition to direct damage of hepatocytes, macrophage-generated oxidants are thought to stimulate production of extracellular matrix by Kupffer cells in the liver.⁸ These hypotheses all assume that higher MPO expression leads to more fibrosis, which seems likely based on the ability of MPO to generate hypochlorous acid and other reactive oxidizing species.

MPO also has inhibitory effects on natural killer cell activity and T cell proliferation.^27,28 Recent studies show the level of cytotoxic T cell (CTL) activity strongly influences the course of fibrosis in patients with chronic HCV infection.²⁹ Thus lower MPO expression in patients with genotype GA/AA may lead to higher CTL activity. However, this hypothesis remains to be tested. Less MPO expression might also stimulate the local T cell response against viral-positive hepatocytes, thus promoting fibrosis. Consistent with that concept, disruption of the MPO gene in mice led to exacerbated atherosclerosis,³⁰ and increased incidence of experimental autoimmune encephalomyelitis, a CD4 T cell mediated demyelinating disease which is a model for multiple sclerosis.³¹

A number of studies now suggest that MPO genotype is differentially associated with various disease states. The GG genotype has been associated with increased incidence of myeloid leukemia,¹³ multiple sclerosis (females),²⁰ Alzheimer's disease (females),¹⁵ lung cancer¹⁷ (males),²⁶ aerodigestive tract cancers,^21,22 and gastrointestinal complications in chronic granulomatous disease,²⁵ while the GA/AA genotypes have been associated with increased risk in aging Finnish males for Alzheimer's disease¹² and lung cancer.¹⁹ The latter examples suggest that the A allele may be the higher expressing allele in certain inflammatory conditions, due to particular cytokines or transcription factors, such as estrogen receptor, or due to myeloid cell types involved, such as macrophage versus neutrophil or monocyte.

The proposed mechanisms for MPO involvement in these various disease states are related, yet different. MPO generated oxidants are likely to damage DNA in promyelocytes, increasing the frequency of breakpoints leading to myeloid leukemia. MPO is able to activate tobacco precarcinogens, such as benzo(a)pyrene, to generate compounds which form covalent links to DNA, increasing lung cancer risk.^17,18 MPO generated oxidants released by invading macrophages may damage the myelin sheath in multiple sclerosis,²⁰ or promote crosslinking of amyloid beta in Alzheimer's disease.³² MPO is known to oxidize low-density lipoprotein,³³ which promotes atherosclerosis, and consume NO,³⁴ which could inhibit dilation of coronary arteries.

In summary, the findings of this preliminary study suggest that in patients with chronic HCV infection, those carrying MPO genotypes GA/AA had more severe fibrosis compared to patients with the GG genotype. Whether this difference is peculiar to chronic HCV infection or maybe representative of other causes of hepatitis is unknown. Whilst we have documented this association in a clinical group of patients with chronic hepatitis C infection, further basic investigation will be required to mechanistically link these two factors, and to explore these associations in chronic hepatitis C and other chronic liver diseases.

Materials and methods

Subjects

All patients with chronic HCV infection, who participated in clinical (anti-viral) treatment trials at Scripps Clinic and Research Foundation between 1994 and 1999 were identified. These trials excluded patients with other serious comorbid disease (for example, anemia and human immunodeficiency virus infection). Of these, 166 patients had stored cryopreserved peripheral blood mononuclear cells from which MPO genotype could be identified and subsequently correlated with severity of liver fibrosis (see below). A profile of each patient was collated and maintained in a central database. From this database, estimates for duration of infection were made. The earliest date of blood transfusion and intravenous drug use to the time of liver biopsy were used to estimate duration of infection. Where these risk factors were not present, other potential portals of infection (eg, mucosal injury, body piercing, multiple sexual partners, intranasal cocaine) were used. Patients estimated their current alcohol intake.

All patients had HCV infection confirmed by antibody testing and by reverse-transcriptase polymerase chain reaction reaction (RT-PCR). Anti-HCV antibodies were detected by enzyme-linked immunosorbent assay (Ortho Diagnostics, Raritan, NJ, USA). Serum HCV RNA assays were performed by a quantitative PCR assay with a sensitivity of 100 copies per milliliter (National Genetics Institute, Los Angeles, CA, USA). HCV genotyping was performed as described elsewhere.³⁵ Chronic infection was confirmed by biochemical evidence of ongoing liver damage (elevated ALT values of greater than 6 month duration) and liver biopsy findings consistent with chronic hepatitis.

Fibrosis score

All patients had liver biopsies performed before initiating anti-viral treatment. These biopsies were used to correlate the MPO genotype with the degree of fibrosis. Two pathologists, who had no knowledge of the patients genotype or clinical data, independently assessed inflammatory activity and fibrosis using the Knodell and Metavir scoring systems.^36,37 A separate series of biopsy specimens from 20 patients with chronic HCV infection was used to correlate the scores between the two pathologists. There was a high degree of correlation (r = 0.82).

Genotyping of myeloperoxidase

All clinical information was organized into a database prior to MPO genotypic analysis of genomic DNA. MPO genotyping was performed blindly, without knowledge of the clinical or treatment demographics or the biopsy fibrosis score. The genomic DNA was extracted from the cryopreserved white blood cells using standard procedures.

Polymerase chain reaction (PCR) was performed with 50-100 ng of genomic DNA with 0.2 g of each primer in a 25 l reaction volume containing 50 mM KCl, 10 mM Tris-HCl pH 8.3, 1.5 mM MgCl₂, 200 M nucleotides, and 1 unit of Taq polymerase (Perkin Elmer Cetus). Primers (Genset, Inc.) were 5' CGGTATAGGCACACAA TGGTGA 3' and 5' GCAATGGTTCAAGCGATTCTTC 3'. The cycling conditions were 95°C for 6 min, followed by 35 cycles at 95°C for 30 s, 62°C -0.3°C per cycle, for 1 min, and 72°C for 30 s. The 350 bp reaction product was digested overnight with 10 units of AciI restriction enzyme, which cuts at -463 of the G allele and a second common site to give rise to fragments of 169, 120, and 61 bp. The A allele gives rise to fragments of 289 and 61 bp.

Statistical analysis

All statistical significance was assessed at the 0.05 level. Means and standard deviations were computed for all continuous data. Categorical data were summarized using frequencies. Difference among MPO GA/AA genotype and liver fibrosis scores were assessed using the ANOVA test. Categorical variables were analyzed using chi-square. Post hoc relationships were assessed using paired Student's t-tests. Multivariate analysis was completed using step-wise logistic regression.

1 Alter HJ. New kit on the block: evaluation of second-generation assays for detection of antibody to the hepatitis C virus. Hepatology 1992; 15: 350-353. MEDLINE

2 Alter H. Discovery of non-A, non-B hepatitis and identification of its etiology. Am J Med 1999; 107: 16S-20S. MEDLINE

3 Poynard T, Bedossa P, Opolon P. Natural history of liver fibrosis progression in patients with chronic hepatitis C. The OBSVIRC, METAVIR, CLINIVIR, and DOSVIRC groups. Lancet 1997; 349: 825-832. MEDLINE

4 McHutchison JG, Gordon SC, Schiff ER et al. Hepatitis Interventional Therapy Group. Interferon alfa-2b alone or in combination with ribavirin as initial treatment for chronic hepatitis C. N Engl J Med 1998; 339: 1485-1492. MEDLINE

5 Klebanoff SJ. Myeloperoxidase. Proc Assoc Am Physicians 1999; 111: 383-389. MEDLINE

6 Casini A, Galli G, Salzano R, Rotella CM, Surrenti C. Acetaldehyde-protein adducts, but not lactate and pyruvate, stimulate gene transcription of collagen and fibronectin in hepatic fat-storing cells. J Hepatol 1993; 19: 385-392. MEDLINE

7 Milani S, Herbst H, Schuppan D, Surrenti C, Riecken EO, Stein H. Cellular localization of type I, III and IV procollagen gene transcripts in normal and fibrotic human liver. Am J Pathol 1990; 137: 59-70. MEDLINE

8 Wu J, Zern MA. Hepatic stellate cells: a target for the treatment of liver fibrosis. J Gastroenterol 2000; 35: 665-672. MEDLINE

9 Poli G. Pathogenesis of liver fibrosis: role of oxidative stress. Mol Aspects Med 2000; 21: 49-98. MEDLINE

10 Kent G, Gay S, Inouye T, Bahu R, Minick OT, Popper H. Vitamin A-containing lipocytes and formation of type III collagen in liver injury. Proc Nat Acad Sci USA 1976; 73: 3719-3772. MEDLINE

11 Piedrafita FJ, Molander RB, Vansant G, Orlova EA, Pfahl M, Reynolds WF. An Alu element in the myeloperoxidase promoter contains a composite Sp1-thyroid hormone-retinoic acid response element. J Biol Chem 1996; 271: 14412-14420. MEDLINE

12 Reynolds WF, Hiltunen M. , Pirskanen M et al. MPO and ApoE4 polymorphisms interact to increase risk for Alzheimer's disease in Finnish males. Neurology 2000; 55: 1284-1290. MEDLINE

13 Reynolds WF, Chang E, Douer D, Ball E, Kanda V. An allelic association implicates myeloperoxidase in the etiology of acute promyelocytic leukemia. Blood 1997; 90: 2730-2737. MEDLINE

14 Nikpoor B, Turecki G, Fournier C, Theroux P, Rouleau GA. A functional myeloperoxidase polymorphic variant is associated with coronary artery disease in French-Canadians. Am Heart J 2000; 142: 336-339.

15 Reynolds WF, Rhees J, Maciejewski D et al. Myeloperoxidase polymorphism is associated with gender specific risk forAlzheimer's disease. Exp Neurol 1999; 15: 31-41.

16 Foster CB, Lehrnbecher T, Mol F et al. Host defense molecule polymorphisms influence the risk for immune-mediated complications in chronic granulomatous disease. J Clin Invest 1998; 102: 2146-2155. MEDLINE

17 London SJ, Lehman TA, Taylor JA. Myeloperoxidase genetic polymorphism and lung cancer risk. Cancer Res 1997; 57: 5001-5003. MEDLINE

18 Rojas M, Godschalk R, Alexandrov K et al. Myeloperoxidase -463A variant reduces benzo[a]pyrene diol epoxide DNA adducts in skin of coal tar treated patients. Carcinogenesis 2001; 22: 1015-1018. MEDLINE

19 Misra RR, Tangrea JA, Virtamo J et al. Variation in the promoter region of the myeloperoxidase gene is not directly related to lung cancer risk among male smokers in Finland. Cancer Lett 2001; 164: 161-167. MEDLINE

20 Nagra RM, Becher B, Tourtellotte WW et al. Immunohistochemical and genetic evidence of myeloperoxidase involvement in multiple sclerosis. J Neuroimmunol 1997; 78: 97-107. MEDLINE

21 Cascorbi I, Henning S, Brockmoller J et al. Substantially reduced risk of cancer of the aerodigestive tract in subjects with variant -463A of the myeloperoxidase gene. Cancer Res 2000; 60: 644-649. MEDLINE

22 Matsuo K, Hamajima N, Shinoda M et al. Possible risk reduction in esophageal cancer associated with MPO -463 A allele. J Epidemiol 2001; 11: 109-114. MEDLINE

23 Hamajima N, Matsuo K, Suzuki T et al. Low expression myeloperoxidase genotype negatively associated with Helicobacter pylori infection. Jpn J Cancer Res 2001; 92: 488-493. MEDLINE

24 Le Marchand L, Seifried A, Lum A, Wilkens LR. Association of the myeloperoxidase -463G-->a polymorphism with lungcancer risk. Cancer Epidemiol Biomarkers Prev 2000; 9: 181-184. MEDLINE

25 Foster CB, Lehrnbecher T, Mol F et al. Host defense molecule polymorphisms influence the risk for immune-mediated complications in chronic granulomatous disease. J Clin Invest 1998; 102: 2146-2155. MEDLINE

26 Schabath MB, Spitz MR, Zhang X, Delclos GL, Wu X. Genetic variants of myeloperoxidase and lung cancer risk. Carcinogenesis 2000; 21: 1163-1166. Article MEDLINE

27 El-Hag A, Clark RA. Immunosuppression by activated human neutrophils. Dependence on the myeloperoxidase system. J Immunol 1987; 139: 2406-2413. MEDLINE

28 El-Hag A, Clark RA. Down-regulation of human natural killer activity against tumors by the neutrophil myeloperoxidase system and hydrogen peroxide. J Immunol 1984; 133: 3291-3297. MEDLINE

29 Eckels DD, Wang H, Bian TH, Tabatabai N, Gill JC. Immunobiology of hepatitis C virus (HCV) infection: the role of CD4 T cells in HCV infection. Immunol Rev 2000; 174: 90-97. MEDLINE

30 Brennan M, Gaur A, Pahuja A, Lusis AJ, Reynolds WF. Mice lacking myeloperoxidase are more susceptible to experimental autoimmune encephalomyelitis. J Neuroimmunol 2001; 112: 97-105. MEDLINE

31 Brennan ML, Anderson MM, Shih DM et al. Increased atherosclerosis in myeloperoxidase-deficient mice. J Clin Invest 2001; 107: 401-403. MEDLINE

32 Galeazzi L, Ronchi P, Franceschi C, Giunta S. In vitro peroxidase oxidation induces stable dimers of beta-amyloid (1-42) through dityrosine bridge formation. Amyloid 1999; 1: 7-13.

33 Daugherty A, Dunn JL, Rateri DL, Heinecke JW. Myeloperoxidase, a catalyst for lipoprotein oxidation, is expressed in human atherosclerotic lesions. J Clin Invest 1994; 94: 437-444. MEDLINE

34 Abu-Soud HM, Hazen SL. Nitric oxide is a physiological substrate for mammalian peroxidases. J Biol Chem 2000; 275: 37524-37532. MEDLINE

35 Stuyver L, Rossau R, Wyseur A, Duhamel M, Vanderborght B, Van Heuverswyn H. Typing of hepatitis C virus isolates and characterization of new subtypes using a line probe assay. J Gen Virol 1993; 74: 1093-1102. MEDLINE

36 Knodell RG, Ishak KG, Black WC et al. Formulation and application of a numerical scoring system for assessing histological activity in asymptomatic chronic active hepatitis. Hepatology 1981; 1: 431-435. MEDLINE

37 Metavir. Intraobserver and interobserver variations in liver biopsy interpretation in patients with chronic hepatitis C. Hepatology 1994; 20: 15-20.

Figure 1 Figure depicting relationship between myeloperoxidase (MPO) promoter genotype and Knodell fibrosis score. Fibrosis stage 0 represents no fibrosis; stage 1 indicates portal fibrosis only; stage 3 indicates bridging fibrosis between portal tracts; and stage 4 indicates established cirrhosis. Genotype GG patients have lower fibrosis scores compared to non-GG patients (P < 0.05).

Table 1 Demographic details of the study patients

Table 2 Demographic details of the GG and non-GG MPO phenotype subgroups of patients