The EMBO Journal
 
Advanced search
Journal home
Aims and scope
Current issue
Advance Online Publication
Web Focuses
Archive:-
Browse by issue
Browse by subject
Browse by category
Free online sample issue
Press releases
Authors & Referees
Editorial process
Guide for authors
Submit an article
Guide for referees
Editorial Team, Senior Advisors and Advisory Editorial Board
Contact Editorial office
Customer services
Subscribe
Order sample copy
Purchase articles
Reprints and permissions
Contact NPG
Advertising
EMBO
www.embo.org
Article
Subject Categories: Signal Transduction | Immunology
The EMBO Journal (2007) 26, 4634–4645, doi:10.1038/sj.emboj.7601897
Published online 18 October 2007
Malt1 ubiquitination triggers NF-kappaB signaling upon T-cell activation
Andrea Oeckinghaus1, 2, 3, Elmar Wegener1, Verena Welteke1, Uta Ferch4, Seda Çöl Arslan2, Jürgen Ruland4, Claus Scheidereit2 and Daniel Krappmann1
1 GSF—National Research Center for Environment and Health, Institute of Toxicology, Neuherberg, Germany
2 Max-Delbrück—Center for Molecular Medicine, Berlin, Germany
3 Faculty of Biology, Chemistry and Pharmacy, Free University Berlin, Germany
4 Third Medical Department, Technical University of Munich, Klinikum rechts der Isar, Munich, Germany

To whom correspondence should be addressed
Daniel Krappmann, GSF—National Research Center for Environment and Health, Institute of Toxicology, Ingolstädter Landstrasse 1, Neuherberg 85764, Germany. Tel.: +49 89 3187 3461; Fax: +49 89 3187 3449; E-mail: Daniel.Krappmann@gsf.de

Received 17 July 2007; Accepted 26 September 2007; Published online 18 October 2007.
Abstract
Triggering of antigen receptors on lymphocytes is critical for initiating adaptive immune response against pathogens. T-cell receptor (TCR) engagement induces the formation of the Carma1–Bcl10–Malt1 (CBM) complex that is essential for activation of the IkappaB kinase (IKK)/NF-kappaB pathway. However, the molecular mechanisms that link CBM complex formation to IKK activation remain unclear. Here we report that Malt1 is polyubiquitinated upon T-cell activation. Ubiquitin chains on Malt1 provide a docking surface for the recruitment of the IKK regulatory subunit NEMO/IKKgamma. TRAF6 associates with Malt1 in response to T-cell activation and can function as an E3 ligase for Malt1 in vitro and in vivo, mediating lysine 63-linked ubiquitination of Malt1. Multiple lysine residues in the C-terminus of Malt1 serve as acceptor sites for the assembly of polyubiquitin chains. Malt1 mutants that lack C-terminal ubiquitin acceptor lysines are impaired in rescuing NF-kappaB signaling and IL-2 production in Malt1-/- T cells. Thus, our data demonstrate that induced Malt1 ubiquitination is critical for the engagement of CBM and IKK complexes, thereby directing TCR signals to the canonical NF-kappaB pathway.
Keywords: Malt1, NF-kappaB, regulatory ubiquitination, T-cell signaling

Introduction

The adaptive immune response is initiated upon specific recognition of antigens presented on the surface of antigen-presenting cells (APC) by T lymphocytes. Productive activation and clonal expansion of T cells requires the concerted action of the T-cell receptor (TCR) and the CD28 co-stimulatory receptor. TCR/CD28 co-engagement induces the formation of the immunological synapse at the contact site of T cell and APC through clustering of lipid rafts, receptor molecules and cytosolic signaling mediators (van der Merwe, 2002). TCR/CD28-initiated signaling networks ultimately promote the activation of several transcription factors including NFAT, AP-1 and NF-kappaB (Okamura and Rao, 2001).

NF-kappaB plays a key role for the regulation of T-cell activation by mediating the induction of various genes that control T-cell proliferation, activation and survival (Ghosh et al, 1998). The NF-kappaB transcription factor family comprises the Rel proteins p65 (RelA), RelB, c-Rel, NF-kappaB1 (p105/p50) and NF-kappaB2 (p100/p52), which can form various combinations of homo- and heterodimers. In unstimulated cells, NF-kappaB proteins are retained in the cytoplasm by their tight association with inhibitory (IkappaB) proteins (Hayden and Ghosh, 2004). TCR/CD28 co-ligation induces canonical NF-kappaB signaling, which involves phosphorylation and degradation of small cytosolic IkappaB inhibitors (IkappaBalpha, IkappaBbeta and IkappaBalt epsilon), and subsequent nuclear translocation and DNA binding of NF-kappaB. IkappaB phosphorylation is catalyzed by the IkappaB kinase (IKK) complex, which consists of the two catalytic subunits IKKalpha and IKKbeta and the essential regulatory subunit IKKgamma/NEMO. Hence, an elucidation of signaling mechanisms that control IKK activation is critical for understanding the regulatory events involved in T-cell activation (Rawlings et al, 2006; Schulze-Luehrmann and Ghosh, 2006; Weil and Israel, 2006).

TCR/CD28 stimulation induces receptor proximal tyrosine phosphorylation, followed by an association of phospholipase C-gamma, small G proteins (e.g., Rac and Ras) and guanine nucleotide exchange factors (e.g., SOS and Vav) to the immunological synapse (Weil and Israel, 2006). The protein kinase C (PKC) isoform PKCtheta is recruited to the immunological synapse upon T-cell activation (Monks et al, 1997), and was found to be indispensable for TCR triggered NF-kappaB activation (Sun et al, 2000; Bi et al, 2001). Genetic ablations in mice have revealed key molecules that couple PKCtheta activation to IKK/NF-kappaB signaling. These include Carma1 (CARD11), Bcl10, Malt1 and Caspase8 (Ruland et al, 2001, 2003; Egawa et al, 2003; Hara et al, 2003; Jun et al, 2003; Ruefli-Brasse et al, 2003; Su et al, 2005). The CARD-containing Carma1 protein is a member of the MAGUK (membrane-associated guanylate kinase) family of proteins (McAllister-Lucas et al, 2001). Carma1 is associated with the plasma membrane and recruited to the immunological synapse upon TCR/APC contact (Gaide et al, 2002). Bcl10 and Malt1, which were originally cloned from translocation breakpoints associated with malignant MALT (mucosa-associated lymphoid tissue) lymphomas (Akagi et al, 1999; Morgan et al, 1999; Willis et al, 1999; Zhang et al, 1999), are constitutively associated and recruited to Carma1 in a PKC-dependent manner (Matsumoto et al, 2005; Sommer et al, 2005). In T cells, PKCtheta phosphorylates Carma1 in a central linker region, which triggers a conformational change of Carma1 and thereby promotes homotypic interaction between the N-terminal CARDs of Carma1 and Bcl10 and thus Carma1–Bcl10–Malt1 (CBM) complex formation (Matsumoto et al, 2005). PDK1 associates with PKCtheta and Carma1 and might function as a molecular bridge to facilitate Carma1 phosphorylation (Lee et al, 2005).

The molecular mechanisms that trigger IKK activation downstream of the CBM complex on the route to NF-kappaB are not fully understood. Carma1, Bcl10 and Malt1 were shown to promote NF-kappaB activation by inducing IKKgamma polyubiquitination (Zhou et al, 2004; Shambharkar et al, 2007). TAK1 (transforming growth factor-beta-activated kinase 1) has been proposed to function as an IKK kinase in TCR signaling (Wang et al, 2001; Sun et al, 2004; Wan et al, 2006), and TAB2/3 contain ubiquitin-binding domains (UBDs) that can mediate recruitment of TAK1 to ubiquitinated IKKgamma (Kanayama et al, 2004). Malt1 was suggested to possess an intrinsic E3 ligase activity that catalyzes IKKgamma ubiquitination (Zhou et al, 2004). In addition, the RING ubiquitin ligase TRAF6 can either directly associate with the C-terminus of Malt1 via two conserved binding motifs (Sun et al, 2004), or is indirectly recruited to Malt1 through association with Caspase8 (Bidere et al, 2006). A role for TRAF6 in TCR-induced IKK activation is further supported by RNAi experiments (Sun et al, 2004; Bidere et al, 2006). However, T-cell-specific ablation of TRAF6 indicates that one or several other E3 ligases, for example, TRAF2, can compensate for the loss of TRAF6 (King et al, 2006). TRAF6 was shown to cooperate with the C-terminus of Malt1 to promote IKKgamma ubiquitination (Sun et al, 2004), and might thus contribute ubiquitin ligase activity. However, abrogation of IKKgamma ubiquitination caused only a partial reduction of PKC-dependent NF-kappaB activation in T cells (Zhou et al, 2004), hinting that other targets for regulatory ubiquitination must be involved in directing CBM complex formation to IKK activation upon TCR/CD28 co-engagement.

We have identified Malt1 as a novel substrate for induced regulatory ubiquitination in response to TCR/CD28 co-ligation. Malt1 ubiquitin chains provide docking surfaces for the recruitment of IKKgamma to the CBM complex. Congruently, NF-kappaB signaling in T cells critically depends on an intact ubiquitin-binding motif in IKKgamma. We further demonstrate that TRAF6 is an E3 ligase for Malt1 and induces the attachment of lysine 63-linked ubiquitin chains to the C-terminus of Malt1. Importantly, the replacement of ubiquitin acceptor sites on Malt1 impairs TCR induced NF-kappaB activation, demonstrating a crucial role for regulatory Malt1 ubiquitination. Thus, our data provide evidence that Malt1 ubiquitination is directing CBM complex formation to IKK activation in response to TCR/CD28 engagement.

Results

Carma1-associated Malt1 is ubiquitinated upon T-cell activation

To identify further interactions or modifications critical for T-cell activation, we investigated the formation of the cellular CBM complex by analyzing Bcl10 immunoprecipitates after gel-filtration chromatography of Jurkat T-cell lysates (Figure 1A). In unstimulated Jurkat T cells, a peak of preformed Bcl10–Malt1 eluted in the low-molecular-weight fractions. Activation of Jurkat cells by PMA/ionomycin (P/I) induced the association of Bcl10–Malt1 with Carma1. The cellular CBM complex migrated with an apparent molecular mass of more than 1500 kDa, a size that by far exceeds the expected molecular weight of a heterotrimer (approx260 kDa). We noticed the appearance of higher molecular weight forms of Carma1–Bcl10-associated Malt1, indicative of a modification. To determine whether Malt1 is modified by ubiquitin, we analyzed Malt1 precipitates after gel-filtration chromatography under denaturing conditions to prevent non-covalent protein interactions (1% SDS, see below). Indeed, modified Malt1 in the high-molecular-weight fraction was also detected by an anti-ubiquitin antibody (Figure 1B). To see whether Malt1 ubiquitination is a primary event in response to T-cell activation, we determined the onset of Malt1 ubiquitination, IKK phosphorylation and IkappaBalpha degradation after P/I treatment (Figure 1C). After direct immunoprecipitation (IP) of Malt1 from Jurkat lysates, we found that the appearance of ubiquitin-conjugated Malt1 slightly preceded IKK phosphorylation and subsequent IkappaBalpha degradation, suggesting that Malt1 ubiquitination could be involved in delivering the signal to IKK/NF-kappaB after T-cell activation. Further, Malt1 ubiquitination was transient and the disengagement of ubiquitin conjugates correlated with a decrease of IKK/NF-kappaB signaling as monitored by reappearance of IkappaBalpha 45–60 min after stimulation (Supplementary Figure 1). In line with P/I activation, CD3/CD28 receptor co-ligation promoted polyubiquitin conjugation of Malt1 in Jurkat T cells and primary CD4+ T cells (Figure 1D). Since we could not detect Malt1 degradation during the course of stimulation, the data suggest that Malt1 is modified by non-degradative regulatory ubiquitination that could be involved in signal propagation.

Figure 1
Figure 1
Malt1 ubiquitination in response to T-cell activation. (A) Carma1-associated Malt1 is modified in Jurkat T cells. Extracts of untreated and P/I-stimulated (20 min) Jurkat T cells were fractionated by gel-filtration chromatography, followed by Bcl10 IP of collected fractions. Elution profiles of Carma1, Bcl10 and Malt1 were analyzed by western blotting. Molecular-weight standards depict the peak elution of marker proteins. A nonspecific band recognized with the anti-Carma1 antibody is marked by an asterisk. (B) Carma1-associated Malt1 is ubiquitinated. Gel filtration was carried out as in panel A. Fractions were pooled (I: 9–11; II: 12–14; III: 16–18; IV: 20–22; V: 24–26; VI: 27–29; VII: 30–32) and denatured, followed by Malt1 IP and western blotting with ubiquitin antibody. (C) Onset of Malt1 ubiquitination precedes IKK activation. Jurkat T cells were stimulated for indicated times with P/I and lysed in co-IP buffer containing 1% SDS. Extracts were diluted 10-fold and immunoprecipitated with anti-Malt1 antibody. In parallel, IKKalpha was precipitated from co-IP buffer lysates for detection of IKK phosphorylation. (D) Malt1 ubiquitination in response to CD3/CD28 co-ligation. Jurkat T cells or murine CD4+ T cells were stimulated with anti-CD3/CD28 antibodies or P/I and analyzed as in panel C.

IKK activity is recruited to Malt1 through the ubiquitin-binding domain of IKKitalic gamma

IKKgamma was recently shown to contain a UBD (Ea et al, 2006; Li et al, 2006; Wu et al, 2006) and we asked whether IKKgamma can associate with ubiquitinated Malt1 in response to T-cell activation. Indeed, we detect ubiquitin-conjugated Malt1 in IKKgamma co-IPs from the extracts of activated Jurkat T cells (Figure 2A). An unspecific cross-reactivity that is detected in Malt1 western blots after co-IP is slightly larger than unmodified Malt1 (compare Figure 4B). Importantly, control IKKgamma IPs from stimulated Jurkat T cells prove that there is no unspecific binding of ubiquitinated Malt1 species (Supplementary Figure 2A). To determine if TAB2 and TAK1 associate with ubiquitin chains attached to Malt1, we performed co-IPs and found that both proteins are recruited to ubiquitinated Malt1 upon P/I stimulation (Figure 2B). Thus, different UBD-containing signaling mediators can be recruited to ubiquitin-conjugated Malt1 upon T-cell activation.

Figure 2
Figure 2
IKKgamma associates with ubiquitin-conjugated Malt1. (A) Cellular IKKgamma associates predominately with ubiquitinated Malt1. Extracts from P/I-stimulated Jurkat T cells were immunoprecipitated with anti-IKKgamma antibody and ubiquitin-modified Malt1 was detected by western blotting. Migration of an unspecific cross-reaction band slightly above 100 kDa in control and IKKgamma IPs is marked by an asterisk. Note that no unspecific binding of ubiquitinated Malt1 was observed (Supplementary Figure 2A). (B) TAB2/TAK1 associate with ubiquitin-conjugated Malt1. Experiments were carried out as in panel A, and IP was performed with either anti-TAB2 (left) or anti-TAK1 antibodies (right). An unspecific cross-reaction band also present in control IPs is marked by an asterisk. (C, D) IKKgamma mutants defective in polyubiquitin binding show impaired association with ubiquitin-conjugated Malt1. (C) Extracts of Jurkat T cells were incubated with recombinant Strep-IKKgamma wt, L329P and Y308S bound to streptactin beads. Malt1 association was analyzed by western blotting. (D) IKKgamma-negative Jurkat T cells reconstituted with HAIKKgamma wt or L329P were subjected to IKKgamma IP as in panel A. (E, F) IKKgamma-mutant L329P fails to rescue NF-kappaB signaling. (E) IKK kinase assay using GST-IkappaBalpha 1–53 as substrate was performed after Malt1 IP from extracts of IKKgamma wt and IKKgamma L329P-reconstituted IKKgamma-/- Jurkat T cells. (F) Jurkat T cells, IKKgamma-negative and rescued Jurkat cells were stimulated with P/I for 20 min and analyzed for IkappaBalpha degradation as an indicator for NF-kappaB activation. Detection of Erk phosphorylation served as stimulation control.
Figure 4
Figure 4
TRAF6 function for Malt1 ubiquitination upon activation of Jurkat T cells. (A) Inducible binding of Malt1 to TRAF6 coincides with Malt1 ubiquitination. Jurkat T cells were stimulated with P/I and Malt1 IP was performed for simultaneous detection of TRAF6 association and Malt1 ubiquitination. (B) TRAF6-associated Malt1 is ubiquitin conjugated. Jurkat T cells were lysed in co-IP buffer followed by anti-TRAF6 or control IP. Malt1 in lysates and TRAF6-associated Malt1 were analyzed in parallel to demonstrate the modification of TRAF6-associated Malt1. Asterisk indicates nonspecific cross-reaction band after IP. (C) siRNA-mediated reduction of TRAF6 impairs inducible Malt1 ubiquitination. Jurkat T cells were transfected with control or TRAF6 siRNAs. Seventy-two hours after transfection, the cells were stimulated for 20 min and lysed. Malt1 ubiquitination was analyzed as in Figure 1C. (D) siRNA-mediated reduction of TRAF6 impairs NF-kappaB signaling. Jurkat T cells were transfected with control or TRAF6 siRNAs and stimulated with P/I. Western blot analysis of lysates demonstrates delayed IkappaBalpha degradation upon TRAF6 knockdown. Induction of Erk phosphorylation was not altered. An unspecific band detected with the IkappaBalpha antibody is marked by an asterisk.

The functional relevance of the IKKgamma UBD to mediate interaction with ubiquitin-conjugated RIP1 was recently shown for TNFalpha signaling (Ea et al, 2006; Li et al, 2006; Wu et al, 2006). IKKgamma L329P and Y308S are two point mutants in the coiled-coil 2/leucine zipper of IKKgamma (242–350) that impair binding of IKKgamma to polyubiquitin chains and therefore its recruitment to ubiquitinated RIP1 (Li et al, 2006; Wu et al, 2006). To test whether the same mutants have a reduced affinity to ubiquitin-conjugated Malt1, we performed streptactin pull-down experiments from extracts of activated Jurkat cells using recombinant StrepIKKgamma wt, L329P and Y308S (Figure 2C). StrepIKKgamma wt preferentially associated with ubiquitin-conjugated Malt1 from stimulated Jurkat T-cell extracts, whereas the mutations L329P and Y308S reduce this interaction. Similar, transfected FlagIKKgamma L329P and Y308S have a reduced affinity to ubiquitinated Malt1 from P/I stimulated Jurkat T cells (Supplementary Figure 2B). Next, we analyzed the ability of IKKgamma L329P to associate with Malt1 and to rescue P/I-induced signaling in IKKgamma deficient Jurkat T cells (Figure 2D–F). In reconstitution experiments, the L329P mutation severely impaired the association of IKKgamma to ubiquitin-conjugated Malt1, even though the level of inducible Malt1 ubiquitination was equivalent in both cell lines (Supplementary Figure 2C). To verify the association of IKKs to Malt1, we also performed an in vitro kinase assay after Malt1 IP, using GSTIkappaBalpha 1–53 as substrate (Figure 2E). Anti-Malt1 IP coprecipitated inducible IKK activity that specifically phosphorylated serines 32/36 of IkappaBalpha (Supplementary Figure 2D). Moreover, IKK kinase activity was coprecipitated by an anti-Malt1 IP from extracts of Jurkat T cells reconstituted with IKKgamma wt, but not IKKgamma L329P. Mutation of IKKgamma at position L329 did not affect association to IKKalpha and IKKbeta (Wu et al, 2006, and data not shown). In addition, only IKKgamma wt was able to significantly rescue P/I-induced NF-kappaB activation, as determined by IkappaBalpha degradation in IKKgamma-deficient Jurkat T cells (Figure 2F). This shows that sensing of ubiquitin chains by IKKgamma is crucial for TCR-dependent NF-kappaB activation, and that Malt1 ubiquitin chains act as molecular bridges that connect CBM and IKK complexes.

TRAF6 functions as an E3 ligase for Malt1

TRAF6 was shown to interact with the C-terminus of Malt1 upon overexpression and in vitro (Sun et al, 2004), and we asked whether TRAF6 could act as an E3 ligase for Malt1. Indeed, coexpression of TRAF6 induced Malt1 ubiquitination in 293 cells (Figure 3A). Malt1 ubiquitination was dependent on the N-terminal RING domain of TRAF6 that confers ligase activity, although TRAF6Delta was still able to associate with Malt1 (Supplementary Figure 3A). To exclude background detection of TRAF6 autoubiquitination or other ubiquitin modifications, ubiquitination experiments were performed after cellular lysis under denaturing conditions (1% SDS). This lysis completely abolished the interactions of transfected or endogenous Malt1/TRAF6 or Malt1/Bcl10 (Supplementary Figure 3B, and data not shown), providing evidence that specifically Malt1 ubiquitination was detected. Since TRAF6 was shown to associate with the C-terminus of Malt1 (Sun et al, 2004), we asked whether it is also the C-terminus that is targeted by TRAF6 induced ubiquitination (Figure 3B). Indeed, TRAF6 induced strong ubiquitination of the C-terminal 200 amino acids (aa) (Malt1 612–813). In contrast, the very C-terminus of Malt1 (aa 684–813) was not ubiquitinated by TRAF6, suggesting the existence of potential acceptor lysines in the region between aa 612 and 683. However, reduced ubiquitination could partially result from decreased affinity due to the absence of the second TRAF6-binding site in Malt1 684–813 (data not shown and scheme Figure 5A).

Figure 3
Figure 3
TRAF6 can act as E3 ligase for Malt1. (A) TRAF6 induces Malt1 ubiquitination. HEK293 cells were cotransfected with MycMalt1 and FlagTRAF6 or TRAF6Delta (289–522), and lysed in co-IP buffer containing 1% SDS. Extracts were diluted 10-fold and ubiquitination was detected following MycMalt1 IP. (B) TRAF6 induces ubiquitin conjugation to the C-terminus of Malt1. 293 cells were cotransfected with Malt1 deletion constructs and XTRAF6 and analyzed as in panel A. Cross-reactions with heavy and light antibody chains after IP are marked by asterisks. (C) TRAF6 mediates the assembly of K63-linked ubiquitin chains to Malt1. In vitro ubiquitin conjugation to GST Malt1 (aa 482–813) was carried out by adding E1, energy-regenerating solution (ATP), E2 (Ubc13/Uev1a) and GST TRAF6, using either ubiquitin wt or lysine mutants K48-only, K63-only, K48R or K63R. Reactions were boiled in 1% SDS containing co-IP buffer and diluted 10-fold for Malt1 IP. Malt1 precipitates were analyzed for ubiquitination by western blotting.
Figure 5
Figure 5
TRAF6 and T-cell activation mediate the assembly of ubiquitin chains to multiple lysine residues in the C-terminus of Malt1. (A) Schematic presentation of lysines (K) in the C-terminus of Malt1. Mutated lysine residues are depicted by squares (Malt1 6R) or squares/circles (Malt1 11R). TRAF6 binding sites are marked by a line. (B) Multiple C-terminal lysine residues of Malt1 serve as acceptor sites for ubiquitin chain attachment. HEK293 cells were cotransfected with Malt1 wt, 6R and 11R constructs (aa 612–813) and XTRAF6, lysed in co-IP buffer containing 1% SDS and diluted 10-fold before FlagMalt1 IP. (C) TRAF6 mediates in vitro assembly of ubiquitin chains to multiple C-terminal lysine residues of Malt1. In vitro ubiquitin conjugation using GSTMalt1 wt, 6R or 11R (aa 482–813) was carried out as described in Figure 3C. (D) Mutation of C-terminal ubiquitin acceptor lysines impairs inducible Malt1 ubiquitination. Jurkat T cells were transfected with FlagMalt1 constructs and HAUbiquitin as indicated. Cells were stimulated (P/I 20 min) after 72 h and extracts were immunoprecipitated with HA beads followed by Flag western blotting. (E) C-terminal lysine mutations prevent the pull down of IKK activity by anti-Malt1 IP. Transfected Jurkat T cells were stimulated (P/I 15 min) and after lysis and Malt1 IP IKK kinase assay (KA) was carried out in the presence of GSTIkappaBalpha (1–53). (F) Lysine-to-arginine exchange in the C-terminus of Malt1 does not impair constitutive Bcl10 association and inducible TRAF6 interaction. Jurkat T cells were transfected with FlagMalt1 constructs. The association of endogenous Bcl10 and TRAF6 was determined after Flag IP. (G) C-terminal lysine mutations in Malt1 do not interfere with inducible CBM complex formation. Jurkat T cells were transfected and treated as in panel D. Inducible Carma1 association was determined by western blotting.

To demonstrate that TRAF6 can function as an E3 ligase for Malt1 in vitro and to characterize the linkage of TRAF6 induced C-terminal Malt1 ubiquitin chains, we established a cell-free ubiquitin conjugation assay for Malt1. Detection was performed by anti-ubiquitin western blotting after boiling of ubiquitination assays in 1% SDS buffer, to abolish any non-covalent protein interaction, followed by Malt1 IP (Figure 3C). Depending on E2 (Ubc13/Uev1a) and ATP, TRAF6 mediated the assembly of K63-linked ubiquitin chains to the C-terminus of Malt1.

Next, we addressed TRAF6 function for Malt1 ubiquitination upon activation of Jurkat T cells. Co-IPs revealed inducible binding of endogenous Malt1 and TRAF6 (Figure 4A), correlating with enhanced Malt1 ubiquitination and degradation of IkappaBalpha. Vice versa, the majority of Malt1 associated with TRAF6 was ubiquitin-conjugated after T-cell activation (Figure 4B). Moreover, a reduction of TRAF6 protein amounts using three independent siRNAs diminished stimulus-dependent Malt1 ubiquitination (Figure 4C). Congruent with previous results, siRNA-mediated inactivation of TRAF6 impaired NF-kappaB activation, as monitored by delayed degradation of IkappaBalpha (Figure 4D). These data demonstrate that TRAF6 can function as an E3 ligase mediating the attachment of K63-linked ubiquitin chains to the C-terminus of Malt1.

Multiple lysines in the C-terminus of Malt1 can serve as ubiquitin acceptor sites

For a functional analysis of Malt1 ubiquitination, we mutated C-terminal lysine residue(s) to map potential acceptor site(s) for the attachment of regulatory ubiquitin chains. We concentrated on the entire C-terminus of Malt1 (aa 612–813; 11 lysines), because we could not exclude that the reduced ubiquitination of Malt1 684–813 was at least partially due to decreased affinity to TRAF6 (scheme in Figure 5A). To further narrow the ubiquitination site, we exchanged pairs of lysines and all six lysines in the region 612–683 to arginines and also replaced all 11 lysines (11R) in the Malt1 C-terminus (612–813) (Figure 5B; Supplementary Figure 4A). None of the double mutants displayed reduced TRAF6-dependent Malt1 ubiquitination. Only combined exchange of all six lysine residues in the region 612–683 (Malt1 612–813 6R) significantly reduced Malt1 ubiquitination. As expected, ubiquitination was completely abolished when all eleven C-terminal lysines (Malt1 612–813 11R) were mutated to arginines. The affinity between Malt1 and TRAF6 was not altered by C-terminal lysine exchange (Supplementary Figure 4B and C). Malt1 ubiquitination was also reduced in an in vitro ubiquitin conjugation assay, if Malt1 6R or Malt1 11R instead of Malt1 wt was used as a substrate (Figure 5C). To determine if the presence of C-terminal lysine residues contributes to TCR-dependent Malt1 ubiquitination, we analyzed FlagMalt1 wt, 6R and 11R ubiquitination in Jurkat T cells (Figure 5D). Malt1 6R displayed a marked reduction and replacement of all C-terminal lysines in Malt1 11R nearly abolished inducible ubiquitin ligation, demonstrating the importance of the mapped acceptor lysines for stimulus-dependent Malt1 ubiquitination. Further, an in vitro kinase assay using GSTIkappaBalpha (1–53) as a substrate after IP of MycMalt1 wt, 6R and 11R revealed that C-terminal lysine to arginine exchange severely impaired the ability of Malt1 to pull down IKK kinase activity from the extracts (Figure 5E). Importantly, mutation of C-terminal lysines in Malt1 did not prevent constitutive association with endogenous Bcl10 or inducible interaction with TRAF6 or Carma1 (Figure 5F and G), demonstrating that lysine exchange in the C-terminus did not interfere with CBM complex formation and TRAF6 binding. Thus, TRAF6 and T-cell activation promote the assembly of ubiquitin chains to multiple lysine residues in the C-terminus of Malt1.

C-terminal Malt1 ubiquitination sites are required for NF-kappaB activation and IL-2 production

T cells from Malt1-deficient mice are defective in NF-kappaB activation and interleukin-2 (IL-2) production upon CD3/CD28 co-ligation or P/I stimulation (Ruefli-Brasse et al, 2003; Ruland et al, 2003). To investigate the functional consequences of C-terminal Malt1 ubiquitination for NF-kappaB signaling and T-cell activation, we rescued naive CD4+ T cells from Malt1-deficient mice by retroviral infection using FlagMalt1 wt, 6R, 11R and 314–813 constructs (Figure 6). Retroviral vectors contained an IRES sequence for simultaneous expression of the surface protein Thy1.1 to identify infected cells by FACS. As determined by Flag/Thy1.1 costaining, Thy1.1-positive cells (+) expressed equivalent amounts of FlagMalt1 wt and mutant proteins (Supplementary Figure 5A). We measured IkappaBalpha protein levels to monitor NF-kappaB activation (Figure 6A; Supplementary Figure 5B) and intracellular IL-2 production as a marker for T-cell activation (Figure 6B; Supplementary Figure 5C). Infection with empty vector or Malt1 314–813, a deletion mutant that cannot bind to Bcl10, did not rescue defective IkappaBalpha degradation in Malt1-/- T cells in response to P/I. In contrast, P/I treatment of Thy1.1+ Malt1 wt cells induced IkappaBalpha degradation, whereas Malt1 6R and 11R mutants were severely impaired in mediating IkappaBalpha degradation. Further, Malt1 wt, but not empty vector or Malt1 314–813, provoked a robust increase in IL-2 producing Thy1.1+ cells after CD3/CD28 costimulation. Again, mutation of C-terminal lysines (6R, 11R) significantly impaired the ability of Malt1 to rescue IL-2 production in Malt1-/- T cells. Thus, the data provide evidence that C-terminal ubiquitination of Malt1 is essential for NF-kappaB activation and IL-2 induction in response to T-cell activation.

Figure 6
Figure 6
Mutation of ubiquitin acceptor sites in Malt1 abrogates NF-kappaB activation and IL-2 production in primary T cells. Malt1-/- CD4-positive T cells were infected with retroviral constructs coupling Malt1 wt, Malt1 6R, Malt1 11R or Malt1 314–813 with Thy1.1 expression. Only Thy1.1-positive cells were analyzed before or after stimulation (see Supplementary Figure 5A). Uninfected Thy1.1 cells behaved like empty vector control (data not shown). (A) C-terminal ubiquitin acceptor lysines of Malt1 are required for P/I-induced IkappaBalpha degradation. IkappaBalpha protein amounts of Thy1.1-positive cells were measured by intracellular staining and FACS analysis, after stimulation with P/I for 20 min. Quantification of IkappaBalpha decrease was performed by determining the number of cells gated for low IkappaBalpha amounts (R3 in Supplementary Figure 5B). Numbers for Malt1 wt reconstitution were set to 100%. Bars and standard deviations are given for three independent experiments. (B) C-terminal ubiquitin acceptor lysines of Malt1 are required for CD3/CD28 co-ligation-induced IL-2 production. IL-2 amounts of Thy1.1-positive cells were measured by intracellular staining and FACS analysis, after stimulation, through CD3/CD28 antibody ligation for 3 h. Quantification of IL-2 increase was performed by determining the number of cells gated for high IL-2 amounts (R3 in Supplementary Figure 5C). Numbers for Malt1 wt reconstitution were set to 100%. Bars and standard deviations are given for three independent experiments. (C) Schematic model of the function of TRAF6-mediated Malt1 ubiquitination in TCR/CD28-induced NF-kappaB activation. T-cell activation provokes PKCtheta-dependent formation of the CBM complex, and recruitment of TRAF6 to Malt1. TRAF6 mediates ubiquitination of lysine residues in the C-terminal part of Malt1, a process that facilitates the association of IKKgamma and thereby the recruitment of the IKK complex to initiate the canonical NF-kappaB pathway.

Discussion

In T cells recruitment of Bcl10/Malt1 to Carma1 is essential for IKK activation in response to TCR/CD28 co-ligation, but the molecular mechanisms of IKK activation downstream of the CBM have not been fully elucidated. In our study, we present several lines of evidence that ubiquitination of Malt1 functionally links CBM and IKK complexes. First, Malt1 ubiquitination coincides with the activation of the IKK/NF-kappaB-signaling pathway. Second, IKKgamma associates with Malt1 ubiquitin chains and the ubiquitin-binding motif of IKKgamma is critical for NF-kappaB signaling in response to T-cell activation. Third, TRAF6 can catalyze the assembly of K63-linked ubiquitin chains in vitro and functions as a potential ubiquitin ligase for Malt1 in vivo. Fourth, T-cell activation induces the assembly of ubiquitin chains to multiple C-terminal lysines of Malt1 and conservative replacement (lysine to arginine exchange) of ubiquitin attachment sites strongly decreases the ability of Malt1 to mediate T-cell stimulation-dependent NF-kappaB signaling and IL-2 production. Collectively, the data demonstrate that polyubiquitination of Malt1 is essential for directing TCR signaling to the canonical NF-kappaB pathway.

We suggest the following model of IKK activation in T cells (Figure 6C). TCR/CD28 co-engagement initiates a series of receptor proximal signaling events that lead to the activation of PKCtheta (Sun et al, 2000). PKCtheta phosphorylation of Carma1 promotes recruitment of Bcl10–Malt1 to Carma1 and thus CBM complex formation (Matsumoto et al, 2005; Sommer et al, 2005). The ubiquitin ligase TRAF6 is recruited to the C-terminus of Malt1 and mediates the assembly of K63-linked ubiquitin chains to lysine residues in the vicinity. IKKgamma binds through its ubiquitin-binding moiety to ubiquitin chains on Malt1. Further, TAB2/TAK1 associate with ubiquitinated Malt1 upon T-cell stimulation, but it remains to be seen whether this is due to a direct interaction of the TAB2 UBD and Malt1-attached ubiquitin chains. TAK1 was shown to function as activating kinase for IKKbeta kinase (Wang et al, 2001; Sun et al, 2004; Wan et al, 2006), suggesting that recruitment of TAK1 to ubiquitinated Malt1 upon TCR engagement could lead to subsequent IKK activation. However, the necessity for TAK1 at this stage has not been completely resolved and alternatively, binding of IKKgamma to Malt1 ubiquitin chains could induce proximity and autoactivation of IKK complexes (Hayden and Ghosh, 2004). Future studies must determine whether recruitment of several UBD containing proteins is crucial for efficient signal propagation.

The function of Malt1 in TCR/CD28-induced IKK activation seems to be analogous to the role of RIP1 in TNFalpha-triggered NF-kappaB activation. It was shown that TNFalpha stimulation-induced RIP1 polyubiquitination, potentially catalyzed by the E3 ligase TRAF2, provides a platform for the recruitment of IKKs to the TNF receptor complex (Ea et al, 2006; Li et al, 2006; Wu et al, 2006). Nevertheless, there is a discrepancy between Malt1 and RIP1 regarding the mode of ubiquitination. A single lysine residue (K377) was shown to serve as the attachment site for ubiquitin chains to RIP1 (Ea et al, 2006; Li et al, 2006). However, mutation of RIP1 at position K377 diminished its inducible interaction with TNF receptor complexes (Ea et al, 2006), indicating that lack of ubiquitination could be caused by disturbed recruitment rather than mutation of the substrate attachment site. Based on in vivo and in vitro evidence, we find that for the assembly of ubiquitin chains to Malt1, any lysine within an acceptable distance seems to be sufficient, which is in agreement with observations that RING E3 ligases often do not precisely position the ubiquitin chain to specific acceptor lysines (Passmore and Barford, 2004). Since the C-terminal lysine mutants of Malt1 associate with Bcl10 and TRAF6 and integrate into the CBM complex, we can exclude that gross structural alterations have been evoked and that upstream signaling is defective.

A previous study has suggested that Bcl10/Malt1-induced ubiquitination of IKKgamma is crucial for NF-kappaB signaling in T cells, and that Malt1 contains intrinsic ubiquitin ligase activity (Zhou et al, 2004). Although we cannot completely exclude that Malt1 is a TRAF6-dependent E3 ligase, in our experiments we did not observe that Malt1 is significantly autoubiquitinated after overexpression in cells or in vitro (see Figure 3A and C, and data not shown). Thus, Malt1 does not seem to confer sufficient E3 ligase activity. In line with these observations, a separate study suggested that TRAF6 might be the E3 ligase that mediates Malt1-dependent IKKgamma ubiquitination (Sun et al, 2004). Carma1 and Bcl10–Malt1 can induce ubiquitination of IKKgamma on K399; however, K399R mutation has only very little effect on inducible NF-kappaB activation in T cells (Zhou et al, 2004; Shambharkar et al, 2007). Thus, the functional link between IKKgamma ubiquitination and NF-kappaB activation for T-cell activation is rather vague. It is tempting to speculate that different regulatory mechanisms are required for sustained productive T-cell activation. However, the kinetic of Malt1 ubiquitination and the mutagenesis of C-terminal Malt1 acceptor lysines suggest that attachment of ubiquitin chains to Malt1 is a key event to initialize IKK/NF-kappaB signaling in response to TCR/CD28 co-engagement.

Recently, it was suggested that T-cell activation can trigger phosphorylation and ubiquitination of the IKK complex by two distinct mechanisms (Shambharkar et al, 2007). Although Carma1 and Bcl10 are involved in TRAF6-dependent ubiquitination of IKKgamma, both proteins are dispensable for TAK1-dependent IKKalpha/beta phosphorylation. Mechanistically, it is unclear how these separate pathways are integrated. We find that the critical components, including Carma1, Bcl10, Malt1, TRAF6, TAB2/TAK1 and IKKgamma, are directly or indirectly associating, suggesting that they should act in concert. However, it might be that some components (e.g., TAK1) can perform certain tasks independent of the other mediators.

Previous studies have reported impaired IKK/NF-kappaB activation after siRNA-mediated downregulation of TRAF6 (Sun et al, 2004; Bidere et al, 2006). In line with this, we found that downregulation of TRAF6 resulted in a partial inhibition of Malt1 ubiquitination and NF-kappaB signaling. Unexpectedly, mice that lack expression of TRAF6 in T cells have no apparent abnormalities in NF-kappaB activation upon TCR engagement (King et al, 2006). However, the importance of regulatory K63-linked ubiquitination in TCR signaling is supported by the conditional excision of the UBC13 locus in T cells, as thymocytes from these mice are defective in IKK/NF-kappaB activation (Yamamoto et al, 2006). Altogether, the data indicate that one or several unknown E3 ligases compensate for the loss of TRAF6 in T cells. Based on siRNA experiments, Sun et al (2004) have suggested that TRAF2 could be involved in TCR-dependent NF-kappaB activation. Future studies must therefore determine whether TRAF2 or other E3 ligases might have a redundant function with TRAF6 in mediating TCR-induced NF-kappaB signaling.

Recent results demonstrated a conserved function of Bcl10–Malt1 in directing antifungal responses and G-protein-coupled receptors (GPCR) to NF-kappaB activation (Gross et al, 2006; Klemm et al, 2007; McAllister-Lucas et al, 2007; Wang et al, 2007). The Carma1 homologue Carma3 (CARD10) functions as a scaffold for GPCR-initiated NF-kappaB activation, which is abrogated by TRAF6 deficiency (Grabiner et al, 2007). Further, the CBM complex is critical for the survival of a subset of malignant lymphomas (Ngo et al, 2006). Chromosomal translocations leading to the generation of API2–Malt1 fusion proteins are associated with aggressive MALT lymphoma, and API2–Malt1 requires the C-terminus of Malt1 for triggering NF-kappaB activation (Zhou et al, 2005). Thus, C-terminal Malt1 ubiquitination may be relevant for activation of NF-kappaB in various physiological and pathological settings.

Materials and methods

Reagents and antibodies

The following antibodies were used: human CD3, human CD28, mouse IgG1, mouse IgG2a, mouse IgG1a–FITC, IKKalpha and IKKgamma (all from BD Biosciences); IkappaBalpha (C21), Myc (9E10), TRAF6 (H274), Malt1 (H300, B12), Bcl10 (331.1), TAB2 (H300), TAK1 (M579) and IKKgamma (FL419) (all from Santa Cruz Biotechnology); Carma1 (Abcam); flag M2 and flag M2–FITC (both from Sigma); ubiquitin (FK2; Biomol); IkappaBalpha, phospho-IKKalpha/beta and IKKbeta (all from Cell Signaling); Thy1.1-APC, IL-2–FITC (both eBioscience) and ICN anti-hamster (MP Biomedicals). The following reagents and siRNAs (100 nM) were used: PMA (200 ng/ml) and ionomycin (300 ng/ml; both from Calbiochem); IL-2 (20 U/ml; Roche), Brefeldin A (10 ng/ml; Sigma); Dynabeads CD4 and DetachaBead mouse CD4 (Dynal Invitrogen) and Streptactin Superflow resin (IBA); si TRAF6.1: GCACAGCAGUGCAAUGGAAUUUAUA (Invitrogen); si TRAF6.2: CCAGCUCCUGUAGCGCUGUAACAAA (Invitrogen); si TRAF6.3: CCACGAAGAGAUAAUGGAU (Eurogentec) and si control: CCAUCCUGAUGUCGCAAUGCCGAAA (Invitrogen).

Plasmids

All Malt1 constructs were cloned with N-terminal Flag (pEF vector; Invitrogen) or Myc (pRK5 vector) epitopes. Mutagenesis was performed by standard PCR. Flag/Myc or Express (X) TRAF constructs were expressed from pRK5 or pcDNA4-His-Express vectors (Invitrogen), respectively. FlagIKKgamma wt and mutants were cloned in pcDNA3 (Invitrogen). GST–Malt1 (493–824) and GST–TRAF6 were expressed from pGEX6p-1 (GE Healthcare). Retroviral FlagMalt1 constructs were cloned using the Gateway system (Invitrogen) into pMSCV-Thy1.1 that couples Thy1.1 and Malt1 expression via an IRES (Internal ribosome entry site) sequence.

Cell culture

HEK293 and Phoenix packaging cells were transfected using standard calcium phosphate precipitation protocols. Cell culture, transfection and stimulation of Jurkat T cells (P/I or CD3/CD28 antibody co-ligation) were performed as described (Scharschmidt et al, 2004). For RNA interference, Jurkat T cells were transfected with Atufect transfection reagent (Atugen, Berlin) and 100 nM siTRAF6 or control siRNA and analyzed after 72 h. Primary T cells were cultured in RPMI supplemented with 1% pen/strep, 1% glutamine, 10% FCS and 0.1% mercaptoethanol. Positive selection for CD4+ T cells was carried out with Dynabeads.

Retroviral infection of CD4-positive T cells and FACS analysis

Purified CD4+ T cells from spleen and lymph nodes of Malt1-/- mice (Ruland et al, 2003) were stimulated with plate-bound CD3/CD28 antibodies for 48 h essentially as described (Wegener et al, 2006). For retroviral infection, virus was harvested from Phoenix packaging cells 2 days after transfection and supplemented with Polybrene (4 mug/ml). CD4+ T cells were incubated with retroviral supernatant for 6 h and then resuspended and cultured in medium with IL-2 (20 U/ml) for 3 days before analysis. Infection efficiencies between 25–50% were achieved. Infected T cells were then stimulated with P/I or plate-bound CD3/28 antibodies for the indicated times. For determination of IL-2 production, Brefeldin A was added 1 h after CD3/28 stimulation. After Thy1.1–APC staining, activated cells were fixed, permeabilized and stained with primary anti-IkappaBalpha and secondary anti-mouse IgG1a–FITC antibodies or anti-IL-2–FITC antibody for FACS analysis. Quantifications of IkappaBalpha degradation and IL-2 production represent statistical analysis of three independent experiments.

Co-IP, cellular ubiquitination and gel filtration

For binding studies, cells were lysed in co-IP buffer (25 mM HEPES pH 7.5, 150 mM NaCl, 0.2% NP-40, 10% glycerol, 1 mM DTT, 10 mM sodium fluoride, 8 mM beta-glycerophosphate, 20 muM sodium vanadate and protease inhibitor cocktail). IP was carried out overnight at 4°C, and after washing precipitates were boiled and analyzed by western blotting. For detection of Malt1 ubiquitination, the lysis buffer was supplemented with 1% SDS. Before IPs, extracts were diluted 10-fold with co-IP buffer. For gel-filtration analysis, extracts from Jurkat T cells lysed in co-IP buffer without glycerol were fractionated on a Superose 6 column (GE Healthcare), followed by anti-Bcl10 IP. For detection of Malt1 ubiquitination, fractions were supplemented with 1% SDS and diluted to 0.1% SDS final concentration before anti-Malt1 IP.

Streptactin pull down

StrepIKKgamma wt, L329P and Y308S were expressed in Escherichia coli BL21(DE3), bound to streptactin beads and incubated overnight with extracts from Jurkat T cells (lysis in co-IP buffer with 1% Triton X-100 instead of NP-40; final concentration of Triton-X100 for pull down was 0.1%). Analysis of material bound to beads was by western blotting.

In vitro ubiquitination and kinase assays

Recombinant GST–Malt1 (482–813) and GST–TRAF6 were expressed in E. coli BL21(DE3)RIL and purified using glutathione sepharose. In vitro ubiquitination reactions (30 mul total volume) were performed in ubiquitination buffer (20 mM HEPES pH 7.2, 10 mM MgCl2, 1 mM DTT, protease inhibitor cocktail) with 50 nM E1, 875 nM E2 (Ubc13/Uev1a), 150 muM ubiquitin (wt, K63-only, K48-only, K63R or K48R) and energy-regenerating solution (all from Boston Biochemicals). The reactions were incubated for 2 h at 30°C, boiled in co-IP buffer containing 1% SDS and diluted 10-fold before Malt1 IP. For IKK kinase assays, untreated and P/I-stimulated Jurkat cells were lysed in co-IP buffer and Malt1 was precipitated using Malt1 (H300) or Myc antibodies. Kinase assays using GST IkappaBalpha (aa 1–53) as substrate were performed essentially as described previously (Scharschmidt et al, 2004).

Supplementary data

Supplementary data are available at The EMBO Journal Online (http://www.embojournal.org).

Acknowledgements

We thank Sandra Rohrmoser and Marc Schmidt-Supprian for helpful discussion, Evelyn Neve and Rudolf Dettmer for excellent technical assistance. We also thank SC Sun for the IKKgamma-negative Jurkat T cells, J Ashwell for the gift of IKKgamma wt and IKKgamma L329P-reconstituted cells and A Abbas for the retroviral vector. This work was supported by DFG grants to DK (UR2306) and JR.

References

Akagi T, Motegi M, Tamura A, Suzuki R, Hosokawa Y, Suzuki H, Ota H, Nakamura S, Morishima Y, Taniwaki M, Seto M (1999) A novel gene, MALT1 at 18q21, is involved in t(11;18) (q21;q21) found in low-grade B-cell lymphoma of mucosa-associated lymphoid tissue. Oncogene 18: 5785–5794 | Article | PubMed | ISI | ChemPort |

Bi K, Tanaka Y, Coudronniere N, Sugie K, Hong S, van Stipdonk MJ, Altman A (2001) Antigen-induced translocation of PKC-theta to membrane rafts is required for T cell activation. Nat Immunol 2: 556–563 | Article | PubMed | ISI | ChemPort |

Bidere N, Snow AL, Sakai K, Zheng L, Lenardo MJ (2006) Caspase-8 regulation by direct interaction with TRAF6 in T cell receptor-induced NF-kappaB activation. Curr Biol 16: 1666–1671 | Article | PubMed | ISI | ChemPort |

Ea CK, Deng L, Xia ZP, Pineda G, Chen ZJ (2006) Activation of IKK by TNFalpha requires site-specific ubiquitination of RIP1 and polyubiquitin binding by NEMO. Mol Cell 22: 245–257 | Article | PubMed | ISI | ChemPort |

Egawa T, Albrecht B, Favier B, Sunshine MJ, Mirchandani K, O'Brien W, Thome M, Littman DR (2003) Requirement for CARMA1 in antigen receptor-induced NF-kappa B activation and lymphocyte proliferation. Curr Biol 13: 1252–1258 | Article | PubMed | ISI | ChemPort |

Gaide O, Favier B, Legler DF, Bonnet D, Brissoni B, Valitutti S, Bron C, Tschopp J, Thome M (2002) CARMA1 is a critical lipid raft-associated regulator of TCR-induced NF-kappa B activation. Nat Immunol 3: 836–843 | Article | PubMed | ISI | ChemPort |

Ghosh S, May MJ, Kopp EB (1998) NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immunol 16: 225–260 | Article | PubMed | ISI | ChemPort |

Grabiner BC, Blonska M, Lin PC, You Y, Wang D, Sun J, Darnay BG, Dong C, Lin X (2007) CARMA3 deficiency abrogates G protein-coupled receptor-induced NF-{kappa}B activation. Genes Dev 21: 984–996 | Article | PubMed | ISI | ChemPort |

Gross O, Gewies A, Finger K, Schafer M, Sparwasser T, Peschel C, Forster I, Ruland J (2006) Card9 controls a non-TLR signalling pathway for innate antifungal immunity. Nature 442: 651–656 | Article | PubMed | ISI | ChemPort |

Hara H, Wada T, Bakal C, Kozieradzki I, Suzuki S, Suzuki N, Nghiem M, Griffiths EK, Krawczyk C, Bauer B, D'Acquisto F, Ghosh S, Yeh WC, Baier G, Rottapel R, Penninger JM (2003) The MAGUK family protein CARD11 is essential for lymphocyte activation. Immunity 18: 763–775 | Article | PubMed | ISI | ChemPort |

Hayden MS, Ghosh S (2004) Signaling to NF-kappaB. Genes Dev 18: 2195–2224 | Article | PubMed | ISI | ChemPort |

Jun JE, Wilson LE, Vinuesa CG, Lesage S, Blery M, Miosge LA, Cook MC, Kucharska EM, Hara H, Penninger JM, Domashenz H, Hong NA, Glynne RJ, Nelms KA, Goodnow CC (2003) Identifying the MAGUK protein Carma-1 as a central regulator of humoral immune responses and atopy by genome-wide mouse mutagenesis. Immunity 18: 751–762 | Article | PubMed | ISI | ChemPort |

Kanayama A, Seth RB, Sun L, Ea CK, Hong M, Shaito A, Chiu YH, Deng L, Chen ZJ (2004) TAB2 and TAB3 activate the NF-kappaB pathway through binding to polyubiquitin chains. Mol Cell 15: 535–548 | Article | PubMed | ISI | ChemPort |

King CG, Kobayashi T, Cejas PJ, Kim T, Yoon K, Kim GK, Chiffoleau E, Hickman SP, Walsh PT, Turka LA, Choi Y (2006) TRAF6 is a T cell-intrinsic negative regulator required for the maintenance of immune homeostasis. Nat Med 12: 1088–1092 | Article | PubMed | ISI | ChemPort |

Klemm S, Zimmermann S, Peschel C, Mak TW, Ruland J (2007) Bcl10 and Malt1 control lysophosphatidic acid-induced NF-kappaB activation and cytokine production. Proc Natl Acad Sci USA 104: 134–138 | Article | PubMed | ChemPort |

Lee KY, D'Acquisto F, Hayden MS, Shim JH, Ghosh S (2005) PDK1 nucleates T cell receptor-induced signaling complex for NF-kappaB activation. Science 308: 114–118 | Article | PubMed | ISI | ChemPort |

Li H, Kobayashi M, Blonska M, You Y, Lin X (2006) Ubiquitination of RIP is required for tumor necrosis factor alpha-induced NF-kappaB activation. J Biol Chem 281: 13636–13643 | Article | PubMed | ISI | ChemPort |

Matsumoto R, Wang D, Blonska M, Li H, Kobayashi M, Pappu B, Chen Y, Wang D, Lin X (2005) Phosphorylation of CARMA1 plays a critical role in T cell receptor-mediated NF-kappaB activation. Immunity 23: 575–585 | Article | PubMed | ISI | ChemPort |

McAllister-Lucas LM, Inohara N, Lucas PC, Ruland J, Benito A, Li Q, Chen S, Chen FF, Yamaoka S, Verma IM, Mak TW, Nunez G (2001) Bimp1, a MAGUK family member linking protein kinase C activation to Bcl10-mediated NF-kappaB induction. J Biol Chem 276: 30589–30597 | Article | PubMed | ISI | ChemPort |

McAllister-Lucas LM, Ruland J, Siu K, Jin X, Gu S, Kim DS, Kuffa P, Kohrt D, Mak TW, Nunez G, Lucas PC (2007) CARMA3/Bcl10/MALT1-dependent NF-kappaB activation mediates angiotensin II-responsive inflammatory signaling in nonimmune cells. Proc Natl Acad Sci USA 104: 139–144 | Article | PubMed | ChemPort |

Monks CR, Kupfer H, Tamir I, Barlow A, Kupfer A (1997) Selective modulation of protein kinase C-theta during T-cell activation. Nature 385: 83–86 | Article | PubMed | ISI | ChemPort |

Morgan JA, Yin Y, Borowsky AD, Kuo F, Nourmand N, Koontz JI, Reynolds C, Soreng L, Griffin CA, Graeme-Cook F, Harris NL, Weisenburger D, Pinkus GS, Fletcher JA, Sklar J (1999) Breakpoints of the t(11;18)(q21;q21) in mucosa-associated lymphoid tissue (MALT) lymphoma lie within or near the previously undescribed gene MALT1 in chromosome 18. Cancer Res 59: 6205–6213 | PubMed | ISI | ChemPort |

Ngo VN, Davis RE, Lamy L, Yu X, Zhao H, Lenz G, Lam LT, Dave S, Yang L, Powell J, Staudt LM (2006) A loss-of-function RNA interference screen for molecular targets in cancer. Nature 441: 106–110 | Article | PubMed | ISI | ChemPort |

Okamura H, Rao A (2001) Transcriptional regulation in lymphocytes. Curr Opin Cell Biol 13: 239–243 | Article | PubMed | ISI | ChemPort |

Passmore LA, Barford D (2004) Getting into position: the catalytic mechanisms of protein ubiquitylation. Biochem J 379 (Part 3): 513–525 | Article |

Rawlings DJ, Sommer K, Moreno-Garcia ME (2006) The CARMA1 signalosome links the signalling machinery of adaptive and innate immunity in lymphocytes. Nat Rev Immunol 6: 799–812 | Article | PubMed | ISI | ChemPort |

Ruefli-Brasse AA, French DM, Dixit VM (2003) Regulation of NF-kappaB-dependent lymphocyte activation and development by paracaspase. Science 302: 1581–1584 | Article | PubMed | ISI | ChemPort |

Ruland J, Duncan GS, Elia A, del Barco Barrantes I, Nguyen L, Plyte S, Millar DG, Bouchard D, Wakeham A, Ohashi PS, Mak TW (2001) Bcl10 is a positive regulator of antigen receptor-induced activation of NF-kappaB and neural tube closure. Cell 104: 33–42 | Article | PubMed | ISI | ChemPort |

Ruland J, Duncan GS, Wakeham A, Mak TW (2003) Differential requirement for Malt1 in T and B cell antigen receptor signaling. Immunity 19: 749–758 | Article | PubMed | ISI | ChemPort |

Scharschmidt E, Wegener E, Heissmeyer V, Rao A, Krappmann D (2004) Degradation of Bcl10 induced by T-cell activation negatively regulates NF-kappa B signaling. Mol Cell Biol 24: 3860–3873 | Article | PubMed | ISI | ChemPort |

Schulze-Luehrmann J, Ghosh S (2006) Antigen-receptor signaling to nuclear factor kappa B. Immunity 25: 701–715 | Article | PubMed | ISI | ChemPort |

Shambharkar PB, Blonska M, Pappu BP, Li H, You Y, Sakurai H, Darnay BG, Hara H, Penninger J, Lin X (2007) Phosphorylation and ubiquitination of the IkappaB kinase complex by two distinct signaling pathways. EMBO J 26: 1794–1805 | Article | PubMed | ISI | ChemPort |

Sommer K, Guo B, Pomerantz JL, Bandaranayake AD, Moreno-García ME, Ovechkina YL, Rawlings DJ (2005) Phosphorylation of the CARMA1 linker controls NF-kappaB activation. Immunity 23: 561–574 | Article | PubMed | ISI | ChemPort |

Su H, Bidere N, Zheng L, Cubre A, Sakai K, Dale J, Salmena L, Hakem R, Straus S, Lenardo M (2005) Requirement for caspase-8 in NF-kappaB activation by antigen receptor. Science 307: 1465–1468 | Article | PubMed | ISI | ChemPort |

Sun L, Deng L, Ea CK, Xia ZP, Chen ZJ (2004) The TRAF6 ubiquitin ligase and TAK1 kinase mediate IKK activation by BCL10 and MALT1 in T lymphocytes. Mol Cell 14: 289–301 | Article | PubMed | ISI | ChemPort |

Sun Z, Arendt CW, Ellmeier W, Schaeffer EM, Sunshine MJ, Gandhi L, Annes J, Petrzilka D, Kupfer A, Schwartzberg PL, Littman DR (2000) PKC-theta is required for TCR-induced NF-kappaB activation in mature but not immature T lymphocytes. Nature 404: 402–407 | Article | PubMed | ISI | ChemPort |

van der Merwe PA (2002) Formation and function of the immunological synapse. Curr Opin Immunol 14: 293–298 | Article | PubMed | ISI | ChemPort |

Wan YY, Chi H, Xie M, Schneider MD, Flavell RA (2006) The kinase TAK1 integrates antigen and cytokine receptor signaling for T cell development, survival and function. Nat Immunol 7: 851–858 | Article | PubMed | ISI | ChemPort |

Wang C, Deng L, Hong M, Akkaraju GR, Inoue J, Chen ZJ (2001) TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 412: 346–351 | Article | PubMed | ISI | ChemPort |

Wang D, You Y, Lin PC, Xue L, Morris SW, Zeng H, Wen R, Lin X (2007) Bcl10 plays a critical role in NF-kappaB activation induced by G protein-coupled receptors. Proc Natl Acad Sci USA 104: 145–150 | Article | PubMed | ChemPort |

Wegener E, Oeckinghaus A, Papadopoulou N, Lavitas L, Schmidt-Supprian M, Ferch U, Mak TW, Ruland J, Heissmeyer V, Krappmann D (2006) Essential role for IkappaB kinase beta in remodeling Carma1–Bcl10–Malt1 complexes upon T cell activation. Mol Cell 23: 13–23 | Article | PubMed | ISI | ChemPort |

Weil R, Israel A (2006) Deciphering the pathway from the TCR to NF-kappaB. Cell Death Differ 13: 826–833 | Article | PubMed | ISI | ChemPort |

Willis TG, Jadayel DM, Du MQ, Peng H, Perry AR, Abdul-Rauf M, Price H, Karran L, Majekodunmi O, Wlodarska I, Pan L, Crook T, Hamoudi R, Isaacson PG, Dyer MJ (1999) Bcl10 is involved in t(1;14)(p22;q32) of MALT B cell lymphoma and mutated in multiple tumor types. Cell 96: 35–45 | Article | PubMed | ISI | ChemPort |

Wu CJ, Conze DB, Li T, Srinivasula SM, Ashwell JD (2006) Sensing of Lys 63-linked polyubiquitination by NEMO is a key event in NF-kappaB activation [corrected]. Nat Cell Biol 8: 398–406 | Article | PubMed | ISI | ChemPort |

Yamamoto M, Okamoto T, Takeda K, Sato S, Sanjo H, Uematsu S, Saitoh T, Yamamoto N, Sakurai H, Ishii KJ, Yamaoka S, Kawai T, Matsuura Y, Takeuchi O, Akira S (2006) Key function for the Ubc13 E2 ubiquitin-conjugating enzyme in immune receptor signaling. Nat Immunol 7: 962–970 | Article | PubMed | ISI | ChemPort |

Zhang Q, Siebert R, Yan M, Hinzmann B, Cui X, Xue L, Rakestraw KM, Naeve CW, Beckmann G, Weisenburger DD, Sanger WG, Nowotny H, Vesely M, Callet-Bauchu E, Salles G, Dixit VM, Rosenthal A, Schlegelberger B, Morris SW (1999) Inactivating mutations and overexpression of BCL10, a caspase recruitment domain-containing gene, in MALT lymphoma with t(1;14)(p22;q32). Nat Genet 22: 63–68 | Article | PubMed | ISI | ChemPort |

Zhou H, Du MQ, Dixit VM (2005) Constitutive NF-kappaB activation by the t(11;18)(q21;q21) product in MALT lymphoma is linked to deregulated ubiquitin ligase activity. Cancer Cell 7: 425–431 | Article | PubMed | ISI | ChemPort |

Zhou H, Wertz I, O'Rourke K, Ultsch M, Seshagiri S, Eby M, Xiao W, Dixit VM (2004) Bcl10 activates the NF-kappaB pathway through ubiquitination of NEMO. Nature 427: 167–171 | Article | PubMed | ISI | ChemPort |

Top

MORE ARTICLES LIKE THIS

These links to content published by NPG are automatically generated

NEWS AND VIEWS

Linear polyubiquitylation: the missing link in NF?κB signalling

Nature Cell Biology News and Views (01 Feb 2009)

E2 enzymes: expanding the 'ubi-verse' of immune signaling

Nature Immunology News and Views (01 Sep 2006)

See all 9 matches for News And Views

Send to a friendSend to a friend
PDFDownload PDF
Abstract
Introduction
Results
Discussion
Materials and methods
Acknowledgements
References
Figures & Tables
Supplementary Information
Next article
Previous article
Table of contents
rights and permissionsRights and permissions
order commercial reprintsReprints
ToC alertRegister for table of contents by email
  Privacy policy Copyright © 2007 by the European Molecular Biology Organization