Schematic diagram of correction of aberrant IGF2 imprinting by nuclear transfer-induced epigenetic reprogramming. The nuclei of tumor cells with loss of IGF2 imprinting (IGF2 LOI) were transferred into enucleated HBF1 and MBW2 fibroblasts that had maintenance of IGF2 imprinting (MOI). After epigenetic reprogramming, aberrant IGF2 imprinting in the transferred tumor nuclei was corrected.
View full figure (99 KB)Article
- The EMBO Journal (2006) 25, 5329 - 5338
- doi:10.1038/sj.emboj.7601399
Published online: 2 November 2006
Subject Category:
Correction of aberrant imprinting of IGF2 in human tumors by nuclear transfer-induced epigenetic reprogramming
Hui Ling Chen1,2,5, Tao Li1,3,5, Xin Wen Qiu1,3, Jie Wu4, Jian Qun Ling1,3, Zhi Hong Sun4, Weibo Wang2, Wei Chen1, Aiju Hou3, Thanh H Vu1,3, Andrew R Hoffman1,3,6 and Ji-Fan Hu1,4,6
- Medical Service, VA Palo Alto Health Care System, Palo Alto, CA, USA
- Department of Endocrinology, Xiangya Hospital, Central South University, Changsha, Hunan Province, PR China
- Department of Medicine, Stanford University Medical School, Palo Alto, CA, USA
- GMR Epigenetics Corporation, Palo Alto, CA, USA
- These authors contributed equally to this work
- These authors are senior authors of this report
Correspondence to:
Andrew R Hoffman, Department of Medicine, Stanford University Medical School, Palo Alto, CA 94304, USA. Tel.: +1 650 858 3930; Fax: +1 650 856 8024; E-mail: arhoffman@stanford.edu
Ji-Fan Hu, Department of Medicine, PAIRE, VA Palo Alto Health Care System, Palo Alto, CA 94304, USA. Tel.: +1 650 493 5000 x 63175; Fax: +1 650 856 8024; E-mail: jifan@stanford.edu
Received 1 June 2006; Accepted 27 September 2006
Abstract
Loss of genomic imprinting of insulin-like growth factor II (IGF2) is a hallmark of many human neoplasms. We attempted to correct this aberrant epigenotype by transferring nuclei from human tumor cells that showed loss of IGF2 imprinting into enucleated mouse and human fibroblasts that had maintained normal IGF2 imprinting. After nuclear transfer, the abnormal biallelic expression of IGF2 in tumor nuclei transiently converted to normal monoallelic imprinted expression in the reconstructed diploid cells. In tetraploid hybrid cells, however, normal IGF2 imprinting was permanently restored in the tumor genome. Inhibition of the synthesis of putative trans imprinting factors with cycloheximide led to loss of IGF2 imprinting in normal cultured fibroblasts, suggesting that normal cells produce proteins that act in trans to induce or maintain genomic imprinting. These data demonstrate that an abnormal tumor epigenotype can be corrected by in vitro reprogramming, and suggest that loss of imprinting is associated with the loss of activity of non-CTCF trans imprinting factor(s) that are either inactivated or mutated in tumors.
Keywords:
- CTCF,
- DNA methylation,
- IGF2,
- imprinting,
- nuclear transfer
Introduction
Introduction
Top of pageInsulin-like growth factor II (IGF2) is an imprinted gene that is expressed only from the paternal allele in a tissue-specific, promoter-specific, and development-specific manner (DeChiara et al, 1990; Hu et al, 1995; Szabo and Mann, 1995). However, IGF2 imprinting is lost in a host of human neoplasms, resulting in biallelic IGF2 expression (Feinberg, 1993; Ogawa et al, 1993; Rainier et al, 1993) and abnormally high IGF2 production. Biallelic IGF2 expression is as an early event in tumorigenesis both in animal models (Christofori et al, 1994) and in human studies (Okamoto et al, 1997; Cui et al, 1998). Development of
-cell carcinomas in transgenic mice carrying the insulin regulatory region/ST-40 large T-antigen requires the abnormal activation of the maternal Igf2 allele as the second signal in the tumor pathway (Christofori et al, 1994). Biallelic activation of Igf2 coincides with the switch to the hyperproliferative stage in preneoplastic foci and tumors (Christofori et al, 1995), while homologous deletion of the Igf2 gene significantly reduces tumor burden (Christofori et al, 1994; Haddad and Held, 1997). We demonstrated that transcriptional suppression of IGF2 by targeted methylated hairpin oligonucleotides reduced the growth of implanted human hepatocarcinomas in mice and prolonged lifespan in those animals (Yao et al, 2003). Feinberg and co-workers have shown that loss of IGF2 imprinting in peripheral blood leukocytes may provide a potential biomarker in diagnosing individuals with high risk of colorectal cancer (Cui et al, 2003), and that tumor phenotype in Apc+/Min mice can be modified simply by altering IGF2 epigenotype (Sakatani et al, 2005), reinforcing the concept that IGF2 plays a role in cancer. While loss of IGF2 imprinting is a hallmark of tumorigenesis in a variety of human malignancies, including hepatoma, lung cancer, breast cancer, colorectal cancer, leiomyosarcoma, osteosarcoma, leukemia, and Wilms' tumor, the molecular mechanisms underlying this epigenetic change have not been elucidated.
In the mouse, Igf2 imprinting is regulated by parent-specific epigenetic modifications in the differentially methylated regions (DMRs) of the Igf2/H19 imprinting domain located on chromosome 7 (Razin and Cedar, 1994; Reik et al, 2000; Arney, 2003). An imprinting control region (ICR) that is located between the Igf2 and H19 contains four CTCF binding sites that are differentially methylated according to their parental origin (Bell and Felsenfeld, 2000; Hark et al, 2000). The methylated paternal allele blocks the binding of CTCF and allows access of two enhancers located downstream of H19 to the Igf2 promoters, permitting transcription of Igf2 and resulting in the silencing of H19 from the paternal allele. The unmethylated maternal allele, however, binds CTCF, which then insulates the enhancers from interacting with Igf2. As a result, Igf2 is suppressed and H19 is transcribed from the maternal allele. When this ICR DMR is deleted or mutated, the normally suppressed maternal Igf2 allele is expressed, leading to biallelic expression.
In human tumors, however, the regulation of IGF2 appears to be much more complicated, as loss of IGF2 imprinting (LOI) is not necessarily linked to, and may be independent of, epigenetic marks in the various DMRs, including the ICR. In some cases, IGF2 LOI is accompanied by alterations of DNA methylation at CTCF binding sites; however, in other tumors, IGF2 loss of imprinting persists even when the ICR maintains its normally differentially methylated state. In some tumors, persistent IGF2 imprinting is accompanied by abnormal epigenetic modifications, for example, hypomethylation or hypermethylation, at CTCF binding sites. Furthermore, aberrant imprinting of IGF2 is not necessarily linked with H19 allelic expression. In some cases, the genes are coordinately expressed with maternal IGF2 and paternal H19 imprinting remaining intact, while in other tumors, IGF2 can be biallelically or monoallelically expressed, independent of the imprinting status of H19 (Cui et al, 2002; Ulaner et al, 2003a). These data suggest that other mechanisms in addition to epigenetic modifications of the CTCF binding sites in the ICR are involved in the control of IGF2 imprinting in tumors.
In this communication, we tested an innovative concept that dysregulated IGF2 imprinting in tumor cells can be corrected or normalized by 'epigenetic reprogramming' following nuclear transfer, a technique that has been successfully used to reprogram somatic cells in animal cloning. We further attempted to examine whether aberrant IGF2 imprinting in tumors was corrected by supplementation of the missing trans imprinting factor(s) in tumors and/or of the repair of abnormal epigenetic modifications of cis elements in ICRs.
Results
Top of pageNuclear transfer-induced correction of aberrant IGF2 imprinting in tumor cells
We first tested whether the abnormal IGF2 epigenotype in tumor cells could be corrected by in vitro epigenetic reprogramming. We reasoned that the loss of imprinting in tumors could be reversed when nuclei from tumor cells were transferred into a cellular environment where IGF2 imprinting was normally maintained. The intact IGF2 imprinting system in normal cytoplasm would correct aberrant imprinting either by providing trans imprinting factors that were missing in tumor cells or by altering the existing epigenetic modifications in ICRs (Figure 1).
We employed nuclear transfer techniques that have been successfully used to reprogram the tumor epigenome (Tada et al, 1997; Li et al, 2003; Hochedlinger et al, 2004) in order to examine whether normal fibroblast cytoplasm could correct aberrant IGF2 imprinting in a series of human tumor cell lines. We were particularly interested in examining whether restoration of IGF2 imprinting would be accompanied by changes in epigenetic signals in these tumor cells, as has been reported in a mouse tumor model (Bell and Felsenfeld, 2000; Hark et al, 2000).
Two normal fibroblast cell lines, HBF1 (human) and MBW2 (mouse), that demonstrated maintenance of IGF2 imprinting (IGF2 MOI), served as host cell lines in which to reprogram the tumor nuclei. Four human tumor cell lines that showed loss of IGF2 imprinting (IGF2 LOI) with distinct DNA methylation patterns at the CTCF binding region and at DMR0 (Table I) were used to obtain nuclei for transfer into the normal fibroblasts. The human IGF2/H19 ICR contains seven differentially methylated binding sites that are normally methylated only on the maternal allele, while DMR0 is normally methylated on the paternal allele. In the first group of cell lines (WTCL and SKNEP), methylation in the ICR is the same as is seen in normal fibroblasts (HBF1 and MBW2), while DMR0 is hypomethylated compared to normal cells. In the H522 cell line, both the ICR and DMR0 sites are hypomethylated. Finally, HRT18 cells maintain normal methylation at the ICR DMR, but they are hypermethylated at DMR0. The fact that the epigenetic configuration of these cell lines varies despite the common epigenetic read-out of IGF2 LOI indicates that site-specific DNA methylation alone cannot be the sole regulator of imprinting. Comparison of the multiple epigenetic modifications in these tumor cells before and after nuclear transfer should therefore provide important information to guide our understanding of the mechanisms underlying IGF2 LOI in tumors.
Nuclei from the four tumor cell lines were isolated as karyoplasts, and cells from the two normal fibroblast cell lines were enucleated by Ficoll gradient centrifugation (Volloch et al, 1987). Tumor nuclei were then introduced into the enucleated fibroblasts by chemical fusion (Kishi et al, 2003) or electroporation (Peura and Vajta, 2003). Reconstructed cells, called cybrids to distinguish them from hybrids that contain the genomes of two cells, were collected for analyses of IGF2 imprinting and epigenetic modifications.
Prior to nuclear transfer into the mouse MBW2 fibroblasts, the four human tumor cell lines (WTCL, SKNEP, HRT18, and H522) expressed IGF2 biallelically (Figure 2A and B, lane 3, A and B alleles). In the reconstructed cybrid clones, IGF2 expression was relatively low (see the following section for IGF2 quantitation by real-time PCR). Nevertheless, in every reconstructed cybrid clone we observed monoallelic expression of IGF2 (Figure 2A, lanes 4–7 and Figure 2B, lanes 4–11). Control cells, in which tumor nuclei were transferred into enucleated tumor cells, continued to show biallelic IGF2 expression (Figure 2A, lane 8–9 and Figure 2B, lane 12). Imprinting of H19 was also restored in H522 cells (Figure 2B, bottom panel, lanes 4–11), the only cell line that contained an informative heterozygous Rsa1 polymorphic restriction enzyme site in the H19 coding region. Similar data were also obtained when tumor nuclei were transferred into enucleated human HBF1 fibroblasts (data not shown). Thus, the cytoplasm of normal fibroblasts is able to reset IGF2 epigenetic imprinting in nuclei derived from tumor cells that show biallelic expression of IGF2. It was also of interest to note that both mouse and human cytoplasts are able to induce imprinting in the human tumor nuclei. We preferred to use mouse fibroblasts as the host because we were able to track the introduced human nuclei in an unambiguous fashion in reconstructed cybrids simply by using human IGF2-specific primers.
Figure 2.
Epigenetic correction of aberrant IGF2 imprinting in human tumor cells. (A) Restoration of IGF2 imprinting in three tumor cell/fibroblast cybrids. Lane 1: 100 bp marker, lane 2: tumor genomic DNA (gDNA); lane 3: tumor cDNA, lanes 4–7: fusion cells, lanes 8–9: self-transferred control cells. In lanes 4–7, the nuclei (karyoplasts) of tumor cells were transferred into enucleated normal mouse MBW2 fibroblasts. In lanes 8–9, the nuclei of tumor cells were transferred into enucleated tumor cells of the identical cell line. The parental alleles of IGF2 were distinguished after treatment with Hha1. (B) Correction of IGF2 and H19 imprinting in H522 tumor cells. Lane 1: 100 bp marker, lanes 2: H522 genomic DNA (gDNA); lane 3: H522 cDNA (bi-allelic expression of IGF2), lanes 4–11: H522/MBW2 reconstructed cells; lanes 12: H522/H522 control reconstructed cells. In lanes 4–11, nuclei of H522 tumor cells were transferred into enucleated normal mouse MBW2 fibroblasts. Lane 12 shows controls, in which nuclei of H522 tumor cells were transferred into enucleated H522 cells. The parental alleles of IGF2 were separated by Apa1 and the parental alleles of H19 were distinguished by Rsa1 polymorphic restriction enzymes.
View full figure (88 KB)In a second group of controls, we cross-transferred IGF2 LOI tumor nuclei into other enucleated LOI tumor cytoblasts, for example, WTCL-SKNEP, WTCL-H522 and WTCL-HRT18. IGF2 was biallelically expressed in these cross-transferred cells (data not shown). These data suggest that the various tumor cell lines, each of which has distinct DNA methylation patterns at the DMRs, cannot 'complement' each other and repair IGF2 imprinting.
Alteration of IGF2 imprinting is independent of DNA methylation at known DMRs
To determine potential mechanisms underlying the restoration of imprinting, we examined DNA methylation at two critical DMR sites, the IGF2/H19 ICR (CTCF binding sites) and DMR0, which contains an IGF2 silencer (Constancia et al, 2000; Eden et al, 2001). Genomic DNA that was extracted from tumor cells that demonstrated IGF2 LOI and from reconstructed cybrids that expressed IGF2 monoallelically was treated with sodium bisulfite to convert unmethylated cytosines into uracil residues, and the DNA was then subjected to amplification with specific primers covering DMRs (Arney, 2003). No differences in DNA methylation at these loci were observed between the imprinted and LOI cells (Figure 3A). For example, the H522/MBW2 cybrids showed hypomethylation at both ICR and DMR0 sites, as did the native H522 cells (Figure 3A, lanes 3 and 4). Both WTCL/MBW2 and SKNEP/MBW2 cybrids were differentially methylated at the ICR and were hypomethylated at DMR0 (Figure 3A, lanes 6, 8 and 9), and HRT18/MBW2 cybrids were differentially methylated at the ICR and hypermethylated at DMR0; these patterns were identical to those found in the wild-type tumor cells. Similarly, we did not find a correlation between the restoration of IGF2 imprinting and DNA methylation in the recently discovered kvDMR1 located near the KCNQ1 gene (Smilinich et al, 1999; Engel et al, 2000) (data not shown).
Figure 3.
DNA methylation at DMRs in the IGF2/H19 imprinting domain. (A) DNA methylation by COBRA method (CTCF binding site, top panel; DMR0, bottom panel). Wt: wild-type tumor cells; Cy: nuclear transfer reconstructed cybrids. Lane 1: 100 bp marker, lanes 2, 5, 7 and 10: control tumor cells; lanes 3–4, 6, 8–9 and 11–12: tumor/MBW2 reconstructed cells. Genomic DNA was treated with sodium bisulfite. After amplification with primers specific for CTCF binding region and DMR0, PCR products were digested with Mlu1 (CTCF binding region site) and Hha1 (DMR0) to separate methylated and unmethylated DNA. (B) Results of bisulfite sequencing in H522 tumor cybrids. After sodium bisulfite treatment, genomic DNA was amplified with PCR, cloned into TA vector, and sequenced for the 'C' or 'T' at CpG sites. Locations of PCR primers are indicated by numbered arrows. A total of 15 CpG dinucleotides at the sixth CTCF binding site of the IGF2/H19 ICR are numbered from GenBank Accession No. AF087017. Each line represents a single sequenced PCR molecule. Black squares represent methylated CpG dinucleotides, and while squares represent unmethylated CpG dinucleotides. Left panel: control cybrids derived from transferring H522 nuclei into enucleated H522 tumor cells, which expressed IGF2 biallelically; right panel: tumor cybrids derived from transferring H522 nuclei into enucleated normal fibroblasts, which had correction of IGF2 imprinting and expressed IGF2 monoallelically.
View full figure (195 KB)We also confirmed the status of DNA methylation in H522 cybrids by other restriction enzymes (Supplementary Figure S1) and by the full bisulfilte sequencing method. DNA sequences covering the sixth CTCF binding site in the IGF2/H19 ICR and DMR0 were amplified with PCR, cloned into TA vector, and were sequenced for the 'T' or 'C' residues at the CpG sites to determine the status of DNA methylation. Figure 3B shows a typical example of the full DNA methylation sequencing of H522 tumor cells that had aberrant IGF2 imprinting. In both original tumor cells and control cybrids, DNA was hypomethylated in the IGF2/H19 ICR. After the correction of IGF2 imprinting by in vitro reprogramming, we did not observe any changes in DNA methylation.
Depletion of putative trans imprinting factors as a potential mechanism underlying loss of IGF2 imprinting in tumors
We then tested the possibility that the loss of IGF2 imprinting in tumors was caused by an alternative mechanism, that is, inactivation or mutation of trans-imprinting factors in the tumor genome. After nuclear transfer, the normal fibroblasts would provide the missing imprinting factors. We first tested this hypothesis by taking advantage of the fact that the reconstructed cybrids did not contain the normal fibroblast genome that would be necessary to make the new putative trans imprinting factors. Thus, pre-existing imprinting factors would be present in the cybrids for a defined period of time before they underwent metabolic degradation. Moreover, as the cells divide, no new factors could be made and the existing factors would become systematically diluted. If this assumption were true, we would observe reversion to biallelic expression in reconstructed cybrids after repeated cell divisions as the pre-existing imprinting factors are depleted by dilution and catabolism.
We therefore tested the effect of prolonged culture on IGF2 allelic expression. After 3–4 days of cell culture, the cybrids demonstrated normal IGF2 imprinting (Figure 4A, lanes 5–10 and Figure 4B, lanes 4–9), but by 5 days after nuclear transfer, biallelic IGF2 expression was again observed (Figure 4A, lanes 11–12 and Figure 4B, lanes 10–11). At the same time, H19 imprinting was also lost in H522/MBW2 cybrids. Control cells showed no changes in IGF2 imprinting (Figure 4A, lane 3). These data support the hypothesis that cytoplasmic trans imprinting factors are required for the maintenance of IGF2 imprinting. In reconstructed cybrids, pre-existing imprinting factors remaining in enucleated fibroblast cytoplasm probably had a relatively short half-life (<4 days) and, in conjunction with dilution from cell division, these putative factors were probably depleted at day 5. As a result of the depletion of pre-existing imprinting factors, all cybrids ultimately reverted to biallelic IGF2 expression starting from day 5.
Figure 4.
Time course of correction of IGF2 imprinting in reconstructed tumor cybrids. (A) Temporary correction of IGF2 imprinting in three reconstructed tumor cybrids. Lane 1: 100 bp marker; lanes 2: genomic DNA (gDNA); lane 3: cDNA (bi-allelic expression of IGF2); lane 4: self-transferred cells (control); lanes 5–12: reconstructed cells collected at different days following nuclear transfer into mouse fibroblasts. Two parental alleles of IGF2 were separated by Hha1 polymorphic restriction enzyme. (B) Temporary correction of IGF2 and H19 imprinting in H522 reconstructed tumor cybrids. Lane 1: 100 bp marker; lanes 2: genomic DNA (gDNA); lane 3: cDNA (bi-allelic expression of IGF2); lanes 4–9: reconstructed cells collected at different days following nuclear transfer into mouse fibroblasts. The parental alleles of IGF2 were separated by Apa1 and the parental alleles of H19 were distinguished by Rsa1 polymorphic restriction enzymes.
View full figure (92 KB)Restoration of IGF2 imprinting in the tumor genome in hybrid cells
To further assess the presence of putative trans imprinting factors, we directly fused normal mouse fibroblasts with each of the four human tumor cell lines. The resulting hybrid cells contained the nuclei of both the normal and the tumor cells. Because the mouse fibroblast genome should make a continuous supply of imprinting factors in the bi-nuclear hybrids, we predicted that we would observe a permanent conversion to IGF2 imprinting in the tumor genome. To select hybrid clones, we transfected MBW2 fibroblasts with pQCXIN vector (BD Biociences, CA) and tumor cells with pSM2c vector (Open Biosystems, AL). After cell fusion, hybrid cells were selected by both G418 and puromycin, and were used to analyze IGF2 allelic expression using primers specific for human IGF2. As predicted, IGF2 was expressed in a monoallelic manner in these hybrid cells (Figure 5, top panel, lanes 4–9), with no reversion to biallelic expression after at least 30 days of culture. These data strengthen the concept that the loss of IGF2 imprinting in the tumor cells was related to trans-factors that are deleted or mutated during tumorigenesis.
Figure 5.
Correction of IGF2 imprinting of the tumor genome in HRT18/MBW2 tetraploid hybrid cells. Lane 1: 100 bp marker; lanes 2: genomic DNA (gDNA); lane 3: cDNA (bi-allelic expression of IGF2); lanes 4–9: tetraploid fusion cells (permanent correction of IGF2 imprinting). Two parental alleles of IGF2 were separated by Hha1. PCR primers recognize human IGF2 but do not recognize mouse Igf2.
View full figure (41 KB)It is interesting to note that allelic expression of the mouse fibroblast Igf2 was not altered at all in the hybrids. While aberrant imprinting of the human IGF2 was corrected (Figure 5, top panel, lanes 4–9), the mouse Igf2 was still expressed monoallelically (Figure 5, bottom panel, lanes 4–9) as in BMW2 fibroblasts (lane 3). Similarly, we did not observe altered mouse Igf2 imprinting in cybrids reconstructed from enucleated tumor cytoplasts and fibroblast nuclei (data not shown). These data indicated that IGF2 imprinting is altered in a unidirectional manner in favor of the correction of tumor IGF2 LOI. The unidirectional correction of IGF2 imprinting thus suggests a 'loss', instead of 'gain' of function mechanism in tumor nuclei. It supports the hypothesis that IGF2 LOI in tumor cells may be related to the inactivation of trans imprinting factors. Supplementation of imprinting factors from normal fibroblasts corrects and restores normal IGF2 imprinting.
Alteration of IGF2 imprinting by inhibiting the synthesis of trans imprinting factors
Finally, we inhibited protein synthesis in normal fibroblasts using cycloheximide (CHX) in order to deplete the cells of the putative imprinting factors, predicting that these cells would gradually lose IGF2 imprinting, recapitulating the loss of imprinting in tumors. We treated human fibroblasts with various concentrations of CHX. In untreated control fibroblasts, IGF2 imprinting was maintained and only the A allele was expressed (Figure 6A, lanes 3), but in fibroblasts treated with CHX (0.5–2.0
g/ml), loss of IGF2 imprinting was apparent from day 5 of culture (Figure 6A, lanes 4–6). We also tested the effect of CHX treatment in a human pancreatic cancer cell (ASPC) that showed normal IGF2 imprinting (MOI) and had normal DNA methylation in the ICR but DNA hypomethylation at DMR0 (Table I). IGF2 was monoallelically expressed from the B allele in ASPC, but was biallelically expressed when cells were treated with various concentrations of CHX, resulting in increased expression of IGF2 in tumor cells (Figure 6B). CHX treatment, however, did not change the imprinting pattern in HRT18 and H522 tumor cells that already expressed IGF2 from both alleles (data not shown).
Figure 6.
Alteration of IGF2 imprinting in cells treated with CHX. (A) Human fibroblasts (HFB1). Lane 1: 100 bp marker, lanes 2: HBF1 genomic DNA (gDNA); lane 3: HBF1 cDNA (mono-allelic expression of IGF2); lanes 4–6: 1.0, 2.0, 3.0
g/ml CHX for 4 days; lanes 7–8: 0.5, 2.0
g/ml CHX for 5 days; lanes 9–10: 0.5, 2.0
g/ml CHX for 4 days, and followed by the withdrawal of CHX for 2 days. The parental alleles of IGF2 were separated by Apa1 and the parental alleles of H19 were distinguished by Rsa1. (B) Pancreatic cancer cells (ASPC). Lane 1: 100 bp marker; lanes 2: ASPC genomic DNA; lane 3: ASPC cDNA; lanes 4–6: 1.0, 2.0, 5.0 and 5.0
g/ml CHX for 5 days; lanes 8–10: 0.5, 5.0 and 5.0
g/ml CHX for 7 days. Two parental alleles of IGF2 were separated by Apa1 polymorphic restriction enzyme.
We further tested whether the withdrawal of CHX would restore IGF2 imprinting in treated cells. We first treated HFB1 cells with 0.5
g/ml CHX in six-well plates. At day 6, we collected half of the treated cells for IGF2 imprinting analysis and the remaining cells were re-seeded and cultured for 2 more days in the absence of CHX. HFB1 fibroblasts lose IGF2 imprinting at day 6 following the inhibition of protein synthesis, with both parental alleles detected in the treated cells (Figure 6A, lanes 7 and 8). Withdrawal of CHX led to restoration of IGF2 imprinting by 48 h (Figure 6A, lanes 9 and 10).
Interestingly, we found that alterations of IGF2 imprinting in CHX-treated human fibroblasts were not accompanied by changes in DNA methylation at CTCF binding sites in the ICR, DMR0 and kvDMR1 (Supplementary Figures S2–S5). Thus, these data also suggest that the maintenance of IGF2 imprinting in these human fibroblasts may be primarily dependent upon trans-acting factors.
Alteration of IGF2 imprinting is not associated with the abundance of CTCF protein
Our data thus reveal a previously unrecognized trans-acting mechanism that is required for maintaining normal IGF2 imprinting. As an insulator of transcription, CTCF is a good candidate to be one of the putative imprinting factors. When CTCF levels are diminished by RNA interference (RNAi) in mouse fibroblasts, Igf2 imprinting is partially lost (Ling et al, 2006).
We thus used Western blotting to examine the abundance of CTCF in tumor cells that had loss of IGF2 imprinting and in human fibroblasts collected before and after CHX treatment. The amount of CTCF protein did not decrease in CHX-treated human fibroblasts. On the contrary, the relative amount of CTCF was increased when protein synthesis was inhibited by CHX in fibroblasts (Figure 7, lanes 4) and in ASPC tumor cells (Figure 7, lane 2), where IGF2 imprinting was lost after CHX treatment. CTCF protein was not reduced in tumors cells that expressed IGF2 biallelically (Figure 7, lanes 5, 7 and 8). These data suggest that inactivation of non-CTCF trans imprinting factor(s) may be involved in the dysregulation of IGF2 imprinting in human tumors.
Figure 7.
The abundance of CTCF protein does not correlate with IGF2 imprinting in CHX-treated cells. CTCF protein was quantitated by Western blotting in CHX-treated cells. Lanes 1, 3, 5, 7 and 8: control cells; lanes 2, 4 and 6; CHX-treated cells. The same Western blot was stripped off and was stained for
-actin as the internal control.
The relation between genomic imprinting and IGF2 expression
Dysregulation of genomic imprinting is one of the important factors that contribute to the increased expression of IGF2 in tumors (Sakatani et al, 2005). We were interested in whether epigenetic correction of IGF2 imprinting following nuclear transfer would alter expression of the growth factor in tumor cybrids. We thus quantitated IGF2 mRNA transcripts in tumor cybrids using real-time PCR (Figure 8).
Figure 8.
Real-time PCR quantitation of IGF2 mRNA transcripts. LOI=loss of IGF2 imprinting. IGF2 and the housekeeping ribosomal L7 protein gene were co-amplified in each cDNA synthesized from control and tumor cybrids (H522, WTCL, SKNEP and HRT18) and CHX-treated fibroblasts (HFB1). IGF2 was quantitated in triplicate for each sample and was determined by a 'delta Ct and delta–delta Ct' calculation with reference to human L7 gene control. IGF2 expression was normalized and presented as the percentage by using the IGF2 level in controls as 100% (control: n=6; treatment: n=12).
View full figure (107 KB)IGF2 was biallelically expressed in original tumor cells and self-fused control cybrids. After the correction of IGF2 imprinting by transferring the tumor nuclei into normal fibroblasts, however, there was a trend toward reduced expression of IGF2 mRNA in all tumor cybrids although the change was not statistically significant (Figure 8). Similarly, we also observed increased expression of IGF2 in CHX-treated human fibroblasts (HFB1) that biallelically expressed IGF2 (Figure 8).
Discussion
Top of pageResetting the epigenotype of a cell, a process called epigenetic reprogramming, plays a critical role in the de-differentiation of the terminally differentiated nucleus into a state equivalent to that of a pluripotent zygote. Unlike genetic changes, epigenetic modifications are reversible and do not alter the messages encoded in genomic DNA. Using this powerful nuclear transfer method, Jaenisch and his co-workers (Hochedlinger et al, 2004) have shown that nuclei from melanoma cells can be reprogrammed to direct normal development of a mouse embryo. Their pioneer work definitively demonstrated that the removal of an abnormal epigenotype alone is enough to restore malignant cells to normal. Recently, Li et al (2003) confirmed this finding in medulloblastoma cells, finding that epigenetic reprogramming of medulloblastoma nuclei by somatic nuclear transfer abrogates the tumorigenic phenotype. In another study by Tada et al (1997), the nuclei of thymocytes were epigenetically reprogrammed when transferred into embryonic germ (EG) cells. After reprogramming, the epigenotype of the transferred somatic nucleus was altered and matched the epigenotype of pluripotent EG cells, resulting in demethylation of several imprinted genes including the paternally imprinted (maternally expressed) H19, p57kip2, Igf2r and the maternally imprinted Igf2, Peg3 and Peg1/Mest. Although the phenomenon is now well-established, the mechanisms involved in the epigenetic reprogramming of somatic nuclei remain largely unknown.
In this communication, we have demonstrated that the aberrant epigenotype of IGF2 can be corrected by transferring tumor nuclei into enucleated normal mouse or human fibroblasts. In every selected cybrid clone derived from four tumor cells (Figure 2) and from another colon cancer cell (HT29, data not shown), we observed correction of abnormal IGF2 imprinting in tumor nuclei. Thus, the cytoplasm of normal fibroblasts, whether from the human or the mouse, contains sufficient imprinting factors needed to reset the IGF2 imprint in nuclei derived from tumor cells.
It is especially interesting to note that aberrant IGF2 imprinting is corrected in tumor cells that have distinct patterns of DNA methylation in DMRs, which have been shown to be critical in regulating the allelic expression of the mouse Igf2. At first, we predicted that correction of epigenetic modifications in DMRs, especially the CTCF binding region in the ICR, would be necessary for resetting the normal IGF2 imprint in tumor nuclei. Following nuclear transfer, the imprinting machinery in the fibroblast cytoplasm would repair the altered DNA methylation in the DMRs, and this would lead to monoallelic expression of IGF2. Surprisingly, we did not observe any changes in DNA methylation at well-known DMRs (DMR0, CTCF binding region, and kvDMR1) in the cybrids that showed the correction of IGF2 imprinting. Similarly, we induced biallelic expression of IGF2 in normal human fibroblasts by the treatment of CHX (Figure 6A). Using both the COBRA method and bisulfite sequencing, we again did not find any changes in DNA methylation at these DMR sites. Thus, alterations of IGF2 imprinting may not necessarily be accompanied by changes of DNA methylation in known ICRs.
It is possible that DNA methylation at these DMRs may play different roles in IGF2 imprinting at different stages of the development. DNA methylation, as an imprinting signal, is critical to guide the establishment of IGF2 imprinting during the early embryogenesis, as has been demonstrated by many animal studies, including knockout, deletion, mutation, and transgenic models. It is possible that after imprinting has been established, monoallelic expression of IGF2 is faithfully maintained during cell replication by mechanisms that may not require or are less dependent upon DNA methylation. Thus, once imprinting is established, DNA methylation at DMRs may not be critical in controlling imprinting. This concept is supported by the lack of correlation between DNA methylation and the status of IGF2 imprinting as observed in this communication and in primary tumors reported by several groups (Moore et al, 1997; Sullivan et al, 1999; Cui et al, 2002).
Instead, data from this study strongly suggest a critical role of trans imprinting factor(s) in the maintenance of IGF2 imprinting. As an insulator of transcription, CTCF was first suspected to be a candidate imprinting factor. However, quantitation of CTCF protein abundance did not detect significant differences between IGF2 LOI and MOI tumors; CTCF levels did not change in human fibroblasts before and after the CHX treatment that alters IGF2 imprinting (Figure 7). We have previously shown that in IGF2 LOI tumor cells and in CNS where IGF2 is biallelically expressed, CTCF binding sites in the ICR were normally semimethylated, and CTCF binds to the unmethylated allele (Yang et al, 2003a; Ulaner et al, 2003b). In this study, we also found that CHX treatment did not change DNA methylation in the IGF2/H19 ICR (data not shown). Moreover, CHX-treated cells expressed H19 monoallelically even though IGF2 was biallelically expressed (Figure 6A, bottom panel). Taken together, these data indicate that other factors in addition to CTCF may play an important role in determining IGF2 allelic expression.
CTCF binding to the ICR is critical in the establishment of Igf2 imprinting in the mouse. Deletion of the locus containing the ICR led to biallelic expression of Igf2 (Leighton et al, 1995; Thorvaldsen et al, 1998). Mutation of each CTCF binding site in the ICR also altered IGF2 imprinting (Schoenherr et al, 2003). Using a transgenic RNAi-based approach to generate oocytes with reduced CTCF protein, Bartolomei and co-workers (Fedoriw et al, 2004) found that CTCF protected the ICR from de novo methylation during oocyte growth and was required for normal preimplantation development. However, this relatively straightforward regulation of mouse Igf2 imprinting by CTCF is not always apparent in human tumors. One possible explanation for the discrepancies is that most mouse studies altered the ICR or CTCF in early development before IGF2 imprinting was established. The maintenance of IGF2 imprinting, while it may be closely linked to the initiating process, could require additional mechanisms, for example, putative trans imprinting factor(s). In tumors, loss of IGF2 imprinting may be caused by dysfunction of a maintenance imprinting regulatory system. In addition, CTCF may require the presence of other partners to exert its function in regulating IGF2 imprinting. Although CTCF and its binding to the ICR is normal, the absence or mutation of putative CTCF partners or non-CTCF factors may cause abnormal IGF2 imprinting in tumors.
The putative imprinting factor(s) could be a tumor suppressor that controls the turnover of growth factors, like IGF2, in normal cells. Mutation or inactivation of the imprinting factors relaxes IGF2 imprinting and thus provides a growth advantage to tumor cells. It will be of great interest to learn whether the correction of IGF2 imprinting can alter tumor phenotypes in animal models, and if restoration to normal IGF2 imprinting may provide a novel molecular target for anti-tumor therapies. Gene therapy to supply the missing imprinting factor may restore normal control of IGF2 imprinting and may provide a therapeutic strategy to treat a variety of human malignancies with the abnormal IGF2 imprinting.
Chromatin remodeling is a potentially powerful method for altering the biological properties of a cell. Recently, Collas and co-workers used extracts derived from another cell type as an alternative strategy to reprogram a nucleus or a cell. For example, after exposure to the extracts of T cells, fibroblasts changed their gene expression pattern. This short in vitro reprogramming caused the upregulation of the hemotopoietic cell-specific marker genes IL2, IL7, CD3, CD4 and RANTES, and the downregulation of the fibroblast-specific genes, like integrin
1 (Hakelien et al, 2002). Similarly, when treated with extracts of undifferentiated NCCIT cells or mouse ES cells, epithelial 293T cells underwent genome-wide transcriptional programming and transitioned to a pluripotent cell phenotype involving a dynamic upregulation of hundreds of embryonic and stem cell markers (Taranger et al, 2005). It would be of interest to examine whether this simple strategy can be also used to replace the nuclear transfer method to reprogram tumor cells that have aberrant IGF2 imprinting. By exposing the normal fibroblasts to extracts that contain the intact trans-imprinting factor(s), this strategy may be used to correct biallelic IGF2 expression of tumor cells back to normal monoallelic expression.
In conclusion, in this study, we have demonstrated that aberrant IGF2 imprinting in human tumor cells can be corrected to a normal imprinting pattern. Although the specific mechanisms underlying the nuclear transfer-mediated imprinting correction are not yet clear, the study strongly suggests that, in addition to epigenetic marks in the IGF2/H19 DMRs, the absence of active non-CTCF trans imprinting factor(s) significantly contributed to the abnormal imprinting in tumors. We expect that this previously unappreciated mechanism may also be broadly applied to other imprinted genes. To date, nearly all of the relevant studies have examined alterations in cis- regulating elements at DMRs. Thus, in addition to searching for epigenetic modifications in known and other unidentified DMRs, we may have to switch our research focus to identify the trans-imprinting factors that are related to the maintenance of imprinting genes, including IGF2 in tumors.
Materials and methods
Top of pageCell lines
Tumor cell lines H522, HRT18 and ASPC were purchased from ATCC (Rockville, MD). WTCL was a kind gift from Dr Benjamin Tycko, and SKNEP and G401 from Dr Herman Yeger. Mouse fibroblast MBW2 cells were cultured from an F1 newborn mouse derived from breeding a M. spretus male with a C57B/6 female. Human fibroblast cells HBF1 were cultured from the skin of a human fetus (Hu et al, 1997; Hu et al, 1998).
Nuclear transfer
Cells in which IGF2 imprinting was maintained (HBF1 and MBW2) were used as the acceptor cells. They were enucleated by centrifugation through a Ficoll density gradient in the presence of cytochalasin B (Volloch et al, 1987). After centrifugation, the enucleated HBF1 and MBW2 cells (cytoplasts) were collected between the 15 and 18% Ficoll interfaces. The enucleated cells were stained with 0.4% Trypan blue to assess viability. Hematoxylin and eosin staining was used to determine the purity of separation.
Human tumor cell lines in which IGF2 was biallelically expressed were used as donor cells. The nuclei were purified as karyoplasts, which contained the intact nucleus surrounded by a thin layer of cytoplastic membrane. Karyoplasts were obtained from the bottom of the 30% region after Ficoll gradient centrifugation. After washing with PBS, the karyoplasts containing intact nuclei were collected by centrifugation at 2000 r.p.m. for 10 min and used for nuclear transfer. H&E staining was used to determine the purity of tumor nuclei.
Tumor nuclei were transferred into the enucleated fibroblasts by chemical cell fusion (Kishi et al, 2003) or electroporation using using BTX Electro Cell Manipulator 2001 (Peura and Vajta, 2003). Reconstructed cells were cultured in RPM 1640 (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum, and were used for the analysis of genomic imprinting. To create hybrid cells containing both fibroblast and tumor cell genomes, we transfected MBW2 fibroblasts with pQCXIN vector (Clontech BD Biociences, Palo Alto, CA) and tumor cells with pSM2c vector (Open Biosystems, Huntsville, AL). After cell fusion, hybrid cells were co-selected by G418 (200–400
g/ml) and puromycin (1–2
g/ml). Reconstructed cell clones were expanded and collected for the analyses of IGF2 imprinting and DNA methylation.
IGF2 imprinting
Total RNA was extracted from tissues by TRI-REAGENT (Sigma, St Louis, MO), according to the manufacturer's guide, and cDNA was synthesized with RNA reverse transcriptase. Genomic imprinting of IGF2 was examined by PCR in cDNA samples as previously described (Hu et al, 1996) using primers specific for three polymorphic restriction enzymes (Apa1, Alu1, and Hua1) in the last exon of human IGF2. Allelic expression of H19 was assessed by polymorphic restriction enzyme Rsa1.
PCR primers used to measure allelic expression of IGF2 and H19 included: IGF2, Apa1: #2505 (5'-primer)—CTTGGACTTTGAGTCAAATTGGCCT
#2506 (3'-primer)—GAGGAGCCAGTCTGGGTTGTTGCTA;
IGF2, Alu1: #2949 (5'-primer)—GTCCCCTCCTCTGCCATCACCTGA
#2950 (3'-primer)—GGATTTTGCCGGAAATATTAGCGT;
IGF2, Hua1: #3302 (5'-primer)—GGCCAAACGTCATCGTCCCCTGAT
#2428 (3'-primer)—ACGTGGAACCGAGAGATTTTCGGG;
H19, Rsa1: #4237 (5'-primer)—GGAGTTGTGGAGACGGCCTTGAGT
#4238 (3'-primer)—CCAGTCACCCGGCCCAGATGGAG.
Measurement of DNA methylation
Total nucleic acids (TNA) extracted from tumor cells were used to examine DNA methylation patterns. As previously described (Hu et al, 1997; Ulaner et al, 2003a), TNA was treated with sodium bisulfite, and DNA in the IGF2/H19 DMR was amplified with DNA methylation-specific primers designed for CTCF binding sites.
PCR primers used to quantitate DNA methylation at the CTCF binding site were #2035 (5'-primer): GATGGTAYGGAATTGGTTGTAGTTGTGG, and #2036 (5'-primer): TCCTATAAATATCCTATTCCCAAATAACC. After PCR, methylated and unmethylated DNA was separated by Mlu1. PCR primers used to measure DNA methylation at DMR0 were #2564 (5'-primer): GAGGTTTGGTAGAGAGGGTTATAGGT, and #2565 (3'-primer): CCAAATCCCAACTATATAACTAAATCCAC. After PCR, methylated and unmethylated DNA was separated by Hha1.
To examine the status of DNA methylation in every CpG site in DMRs, the amplified PCR DNAs were cloned into TA vector (Invitrogen, Carlsbad, CA) and were sequenced using the vector primer.
Cell treatment with CHX
Human fibroblasts cells (HBF1) were cultured in DMEM (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum and 100 U/ml of penicillin and 100
g/ml of streptomycin, and grown at 37°C with 5% CO2. ASPC, a pancreatic cancer cell line keeping normal IGF2 imprinting in cell culture, was maintained in RPMI 1640 medium as recommended by ATCC. Cells were seeded in six-well plates at the density of 2
105 cells/well. Twenty-four hours following plating, cells were replaced with fresh medium and were treated with different concentrations (0.0, 0.5, 1.0, 2.0 and 5.0
g/ml) of CHX. Tumor cells were collected after day 4 and analyzed for IGF2 imprinting and DNA methylation.
In a separate study, fibroblasts were first treated with 0.5 or 1.0
g/ml CHX. At day 5, cells were divided into two portions. Half the cells were collected to assess IGF2 imprinting. The other half were seeded in a new plate supplemented with fresh DMEM without CHX. After two days, cells were collected to assess IGF2 imprinting.
Western blotting of CTCF protein
Expression of CTCF protein was determined by Western blotting as previously described (Yao et al, 2003). Cells were lysed with boiling 1% SDS, 10 mM Tris–HCI, pH 7.4, sonicated for 30 s, and centrifuged at 15 000 g for 5 min. Supernatant lysates with equal amounts of protein were used for immunoblotting of CTCF protein using the mouse monoclonal anti-human CTCF antibody (1:500, Santa Cruz Biotechnology, CA).
Q-PCR quantitation of IGF2 transcripts in tumor cybrids
IGF2 mRNA expression in tumor cybrids was examined by TaqMan Q-PCR as previously described (Yang et al, 2003b; Vu et al, 2004). Briefly, total RNA was extracted by TRI-REAGENT (Sigma, St Louis, MO). IGF2 cDNA was synthesized with RNA reverse transcriptase and was quantitated by Q-PCR in triplicate using an ABI Prism 7900HT sequence detector (AB Applied Biosciences, CA) following the manufacturer's protocol. To quantitate PCR products, the housekeeping ribosomal L7 protein gene was co-amplified as the internal control. The primer sequences for assaying human IGF2 transcripts were #4702 (5'-primer): GCCAAGTCCGAGAGGGACGTGTCG and #4703 (3'-primer): CAGGTGTCATATTGGAAGAACTTGC. The sequences for the L7 primers were #1266 (5'-primer): CGAAAGGCAAGGAGGAAGCTTATCT and #1267 (3'-primer): CGAATTTCAGTTCTGTACATCTGCCT. After Q-PCR amplification, a 'melting curve analysis' was performed to confirm the homogeneity of all Q-PCR products. IGF2 cDNA was determined by a 'delta Ct and delta–delta Ct' calculation as described in the manufacturer's protocol with reference to human L7 gene control.
Acknowledgements
Top of pageWe thank Dr Benjamin Tycko for providing the WTCL cell line, Dr Lee J Helman for RH05 and RH28 cell lines, and Dr Herman Yeger for SKNEP and G401 cell lines. We also thank Dr Hengmi Cui for his useful technical discussion about colon cancer cell lines. This work was supported by the Department of Defense Grant (W81XWH-04-1-0597) and NIH SBIR Grant (R43 CA86664-01) to JFH, NIH Grant (DK36054) to ARH, and the Research Service of the Department of Veterans Affairs.
References
Top of pageArney KL (2003) H19 and Igf2—enhancing the confusion? Trends Genet 19: 17–23 | Article | PubMed | ISI | ChemPort |
Bell AC, Felsenfeld G (2000) Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature 405: 482–485 | Article | PubMed | ISI | ChemPort |
Christofori G, Naik P, Hanahan D (1994) A second signal supplied by insulin-like growth factor II in oncogene-induced tumorigenesis. Nature 369: 414–418 | Article | PubMed | ISI | ChemPort |
Christofori G, Naik P, Hanahan D (1995) Deregulation of both imprinted and expressed alleles of the insulin-like growth factor 2 gene during beta-cell tumorigenesis. Nat Genet 10: 196–201 | Article | PubMed | ISI | ChemPort |
Constancia M, Dean W, Lopes S, Moore T, Kelsey G, Reik W (2000) Deletion of a silencer element in Igf2 results in loss of imprinting independent of H19. Nat Genet 26: 203–206 | Article | PubMed | ISI | ChemPort |
Cui H, Cruz-Correa M, Giardiello FM, Hutcheon DF, Kafonek DR, Brandenburg S, Wu Y, He X, Powe NR, Feinberg AP (2003) Loss of IGF2 imprinting: a potential marker of colorectal cancer risk. Science 299: 1753–1755 | Article | PubMed | ISI | ChemPort |
Cui H, Horon IL, Ohlsson R, Hamilton SR, Feinberg AP (1998) Loss of imprinting in normal tissue of colorectal cancer patients with microsatellite instability. Nat Med 4: 1276–1280 | Article | PubMed | ISI | ChemPort |
Cui H, Onyango P, Brandenburg S, Wu Y, Hsieh CL, Feinberg AP (2002) Loss of imprinting in colorectal cancer linked to hypomethylation of H19 and IGF2. Cancer Res 62: 6442–6446 | PubMed | ISI | ChemPort |
DeChiara TM, Efstratiadis A, Robertson EJ (1990) A growth-deficiency phenotype in heterozygous mice carrying an insulin-like growth factor II gene disrupted by targeting. Nature 345: 78–80 | Article | PubMed | ISI | ChemPort |
Eden S, Constancia M, Hashimshony T, Dean W, Goldstein B, Johnson AC, Keshet I, Reik W, Cedar H (2001) An upstream repressor element plays a role in Igf2 imprinting. EMBO J 20: 3518–3525 | Article | PubMed | ISI | ChemPort |
Engel JR, Smallwood A, Harper A, Higgins MJ, Oshimura M, Reik W, Schofield PN, Maher ER (2000) Epigenotype–phenotype correlations in Beckwith–Wiedemann syndrome. J Med Genet 37: 921–926 | Article | PubMed | ISI | ChemPort |
Fedoriw AM, Stein P, Svoboda P, Schultz RM, Bartolomei MS (2004) Transgenic RNAi reveals essential function for CTCF in H19 gene imprinting. Science 303: 238–240 | Article | PubMed | ISI | ChemPort |
Feinberg AP (1993) Genomic imprinting and gene activation in cancer. Nat Genet 4: 110–113 | Article | PubMed | ISI | ChemPort |
Haddad R, Held WA (1997) Genomic imprinting and Igf2 influence liver tumorigenesis and loss of heterozygosity in SV40T antigen transgenic mice. Cancer Res 57: 4615–4623 | PubMed | ChemPort |
Hakelien AM, Landsverk HB, Robl JM, Skalhegg BS, Collas P (2002) Reprogramming fibroblasts to express T-cell functions using cell extracts. Nat Biotechnol 20: 460–466 | Article | PubMed | ISI | ChemPort |
Hark AT, Schoenherr CJ, Katz DJ, Ingram RS, Levorse JM, Tilghman SM (2000) CTCF mediates methylation-sensitive enhancer-blocking activity at the H19/Igf2 locus. Nature 405: 486–489 | Article | PubMed | ISI | ChemPort |
Hochedlinger K, Blelloch R, Brennan C, Yamada Y, Kim M, Chin L, Jaenisch R (2004) Reprogramming of a melanoma genome by nuclear transplantation. Genes Dev 18: 1875–1885 | Article | PubMed | ISI | ChemPort |
Hu J, Vu T, Hoffman A (1995) Differential biallelic activation of three insulin-like growth factor II promoters in the mouse central nervous system. Mol Endocrinol 9: 628–636 | Article | PubMed | ChemPort |
Hu JF, Oruganti H, Vu TH, Hoffman AR (1998) The role of histone acetylation in the allelic expression of the imprinted human insulin-like growth factor II gene. Biochem Biophys Res Commun 251: 403–408 | Article | PubMed | ISI | ChemPort |
Hu JF, Vu TH, Hoffman AR (1996) Promoter-specific modulation of insulin-like growth factor II genomic imprinting by inhibitors of DNA methylation. J Biol Chem 271: 18253–18262 | Article | PubMed | ISI | ChemPort |
Hu JF, Vu TH, Hoffman AR (1997) Genomic deletion of an imprint maintenance element abolishes imprinting of both insulin-like growth factor II and H19. J Biol Chem 272: 20715–20720 | Article | PubMed | ISI | ChemPort |
Kishi M, Itagaki Y, Takakura R, Sudo T, Teranishi M (2003) Effect of polyethylene glycol and dimethyl sulfoxide on the fusion of bovine nuclear transfer using mammary gland epithelial cells. Cloning Stem Cells 5: 43–49 | Article | PubMed | ChemPort |
Leighton PA, Saam JR, Ingram RS, Stewart CL, Tilghman SM (1995) An enhancer deletion affects both H19 and Igf2 expression. Genes Dev 9: 2079–2089 | Article | PubMed | ISI | ChemPort |
Li L, Connelly MC, Wetmore C, Curran T, Morgan JI (2003) Mouse embryos cloned from brain tumors. Cancer Res 63: 2733–2736 | PubMed | ISI | ChemPort |
Ling JQ, Li T, Hu JF, Vu TH, Chen HL, Qiu XW, Cherry AM, Hoffman AR (2006) CTCF mediates interchromosomal colocalization between Igf2/H19 and Wsb1/Nf1. Science 312: 269–272 | Article | PubMed | ISI | ChemPort |
Moore T, Constancia M, Zubair M, Bailleul B, Feil R, Sasaki H, Reik W (1997) Multiple imprinted sense and antisense transcripts, differential methylation and tandem repeats in a putative imprinting control region upstream of mouse Igf2. Proc Natl Acad Sci USA 94: 12509–12514 | Article | PubMed | ChemPort |
Ogawa O, Eccles MR, Szeto J, McNoe LA, Yun K, Maw MA, Smith PJ, Reeve AE (1993) Relaxation of insulin-like growth factor II gene imprinting implicated in Wilms' tumour. Nature 362: 749–751 | Article | PubMed | ISI | ChemPort |
Okamoto K, Morison IM, Taniguchi T, Reeve AE (1997) Epigenetic changes at the insulin-like growth factor II/H19 locus in developing kidney is an early event in Wilms tumorigenesis. Proc Natl Acad Sci USA 94: 5367–5371 | Article | PubMed | ChemPort |
Peura TT, Vajta G (2003) A comparison of established and new approaches in ovine and bovine nuclear transfer. Cloning Stem Cells 5: 257–277 | Article | PubMed | ChemPort |
Rainier S, Johnson LA, Dobry CJ, Ping AJ, Grundy PE, Feinberg AP (1993) Relaxation of imprinted genes in human cancer. Nature 362: 747–749 | Article | PubMed | ISI | ChemPort |
Razin A, Cedar H (1994) DNA methylation and genomic imprinting. Cell 77: 473–476 | Article | PubMed | ISI | ChemPort |
Reik W, Constancia M, Dean W, Davies K, Bowden L, Murrell A, Feil R, Walter J, Kelsey G (2000) Igf2 imprinting in development and disease. Int J Dev Biol 44: 145–150 | PubMed | ISI | ChemPort |
Sakatani T, Kaneda A, Iacobuzio-Donahue CA, Carter MG, de Boom Witzel S, Okano H, Ko MS, Ohlsson R, Longo DL, Feinberg AP (2005) Loss of imprinting of Igf2 alters intestinal maturation and tumorigenesis in mice. Science 307: 1976–1978 | Article | PubMed | ISI | ChemPort |
Schoenherr CJ, Levorse JM, Tilghman SM (2003) CTCF maintains differential methylation at the Igf2/H19 locus. Nat Genet 33: 66–69 | Article | PubMed | ISI | ChemPort |
Smilinich NJ, Day CD, Fitzpatrick GV, Caldwell GM, Lossie AC, Cooper PR, Smallwood AC, Joyce JA, Schofield PN, Reik W, Nicholls RD, Weksberg R, Driscoll DJ, Maher ER, Shows TB, Higgins MJ (1999) A maternally methylated CpG island in KvLQT1 is associated with an antisense paternal transcript and loss of imprinting in Beckwith–Wiedemann syndrome. Proc Natl Acad Sci USA 96: 8064–8069 | Article | PubMed | ChemPort |
Sullivan MJ, Taniguchi T, Jhee A, Kerr N, Reeve AE (1999) Relaxation of IGF2 imprinting in Wilms tumours associated with specific changes in IGF2 methylation. Oncogene 18: 7527–7534 | Article | PubMed | ISI | ChemPort |
Szabo PE, Mann JR (1995) Allele-specific expression and total expression levels of imprinted genes during early mouse development: implications for imprinting mechanisms. Genes Dev 9: 3097–3108 | Article | PubMed | ISI | ChemPort |
Tada M, Tada T, Lefebvre L, Barton SC, Surani MA (1997) Embryonic germ cells induce epigenetic reprogramming of somatic nucleus in hybrid cells. EMBO J 16: 6510–6520 | Article | PubMed | ISI | ChemPort |
Taranger CK, Noer A, Sorensen AL, Hakelien AM, Boquest AC, Collas P (2005) Induction of dedifferentiation, genomewide transcriptional programming, and epigenetic reprogramming by extracts of carcinoma and embryonic stem cells. Mol Biol Cell 16: 5719–5735 | Article | PubMed | ChemPort |
Thorvaldsen JL, Duran KL, Bartolomei MS (1998) Deletion of the H19 differentially methylated domain results in loss of imprinted expression of H19 and Igf2. Genes Dev 12: 3693–3702 | Article | PubMed | ISI | ChemPort |
Ulaner GA, Vu TH, Li T, Hu JF, Yao XM, Yang Y, Gorlick R, Meyers P, Healey J, Ladanyi M, Hoffman AR (2003a) Loss of imprinting of Igf2 and H19 in osteosarcoma is accompanied by reciprocal methylation changes of a CTCF-binding site. Hum Mol Genet 12: 535–549 | Article | PubMed | ISI | ChemPort |
Ulaner GA, Yang Y, Hu JF, Li T, Vu TH, Hoffman AR (2003b) CTCF binding at the insulin-like growth factor-II (IGF2)/H19 imprinting control region is insufficient to regulate IGF2/H19 expression in human tissues. Endocrinology 144: 4420–4426 | Article | PubMed | ISI | ChemPort |
Volloch V, Schweitzer B, Rits S (1987) Synthesis of globin RNA in enucleated differentiating murine erythroleukemia cells. J Cell Biol 105: 137–143 | Article | PubMed | ChemPort |
Vu TH, Li T, Hoffman AR (2004) Promoter-restricted histone code, not the differentially methylated DNA regions or antisense transcripts, marks the imprinting status of IGF2R in human and mouse. Hum Mol Genet 13: 2233–2245 | Article | PubMed | ISI | ChemPort |
Yang Y, Hu JF, Ulner G, Li T, Yao X, Vu TH, Hoffman AR (2003a) Epigenetic regulation of Igf2/H19 imprinting at CTCF insulator binding sites. J Cell Biochem 90: 1038–1055 | Article | ChemPort |
Yang Y, Li T, Vu TH, Ulaner GA, Hu JF, Hoffman AR (2003b) The histone code regulating expression of the imprinted mouse Igf2r gene. Endocrinology 144: 5658–5670 | Article | PubMed | ChemPort |
Yao XM, Hu JF, Daniels M, Shiran H, Zhou XJ, Yien HF, Lu HQ, Zeng ZL, Wang QX, Li T, Hoffman AR (2003) A methylated oligonucleotide inhibits IGF2 expression and enhances survival in a model of hepatocellular carcinoma. J Clin Invest 111: 265–273 | Article | PubMed | ISI | ChemPort |



