Article

  • The EMBO Journal (2006) 25, 3110 - 3122
  • doi:10.1038/sj.emboj.7601187

Published online: 8 June 2006

Recruitment of PRC1 function at the initiation of X inactivation independent of PRC2 and silencing

Stefan Schoeftner1, Aditya K Sengupta1, Stefan Kubicek1, Karl Mechtler1, Laura Spahn2, Haruhiko Koseki3, Thomas Jenuwein1 and Anton Wutz1

  1. Research Institute of Molecular Pathology, Vienna, Austria
  2. Centre of Molecular Medicine, Vienna, Austria
  3. RIKEN Research Center for Allergy and Immunology (RCAI), RIKEN Yokohama Institute, Suehiro, Tsurumi-ku, Yokohama, Japan

Correspondence to:

Anton Wutz, Research Institute of Molecular Pathology, Vienna Biocenter, Dr. Bohr-Gasse 7, 1030 Vienna, Austria. Tel.: +43 1 797 30 521; Fax: +43 1 798 87153; E-mail: wutz@imp.univie.ac.at

Received 4 October 2005; Accepted 17 May 2006


In mammals X inactivation is initiated by expression of Xist RNA and involves the recruitment of Polycomb repressive complex 1 (PRC1) and 2 (PRC2), which mediate chromosome-wide ubiquitination of histone H2A and methylation of histone H3, respectively. Here, we show that PRC1 recruitment by Xist RNA is independent of gene silencing. We find that Eed is required for the recruitment of the canonical PRC1 proteins Mph1 and Mph2 by Xist. However, functional Ring1b is recruited by Xist and mediates ubiquitination of histone H2A in Eed deficient embryonic stem (ES) cells, which lack histone H3 lysine 27 tri-methylation. Xist expression early in ES cell differentiation establishes a chromosomal memory, which allows efficient H2A ubiquitination in differentiated cells and is independent of silencing and PRC2. Our data show that Xist recruits PRC1 components by both PRC2 dependent and independent modes and in the absence of PRC2 function is sufficient for the establishment of Polycomb-based memory systems in X inactivation.


  • Keywords:

    • Eed,
    • Polycomb,
    • Ring1b,
    • X inactivation,
    • Xist

Introduction

Top

Mammals equalise the dosage of X-linked genes between males and females by inactivation of one of the two female X chromosomes early in development. In female mice the paternal X chromosome is silenced in preimplantation embryos giving rise to the imprinted pattern of X inactivation in the extraembryonic lineages. In the cells forming the embryo, the inactive X (Xi) becomes reactivated at the blastocyst stage, followed by random inactivation of either the paternal or the maternal X before gastrulation (Huynh and Lee, 2003; Mak et al, 2004; Okamoto et al, 2004). Random X inactivation is recapitulated during the differentiation of mouse embryonic stem (ES) cells. The formation of an inactive X chromosome comprises an ordered series of chromatin modifications, including post-translational modifications of histones and the recruitment of Polycomb group (PcG) complexes (Plath et al, 2002). Initiation of silencing depends on the expression of the noncoding Xist RNA (Borsani et al, 1991; Brockdorff et al, 1991; Brown et al, 1991a, 1991b). However, Xist is dispensable for the maintenance of the Xi at later stages of differentiation, when multiple pathways including DNA methylation and hypoacetylation of histone H4 stably propagate the inactive state (Csankovszki et al, 2001; Hernandez-Munoz et al, 2005). The silent state at the initiation of X chromosome inactivation is initially reversible (Wutz and Jaenisch, 2000) and is associated with chromosome-wide tri-methylation of histone H3 on lysine 27 (H3K27me3), mono-methylation of histone H4 on lysine 20 (H4K20m1) and ubiquitination of lysine 119 on histone H2A (H2AK119ub1) as well as the recruitment of the Polycomb repressive complexes 1 (PRC1) and 2 (PRC2; Cao et al, 2002; Plath et al, 2003; de Napoles et al, 2004; Fang et al, 2004; Kohlmaier et al, 2004).

PRC2 contains the Ezh2, Eed, Suz12 and RbAp46/48 proteins and has histone H3 specific lysine methylase activity (Cao et al, 2002; Czermin et al, 2002; Kuzmichev et al, 2002, 2004; Muller et al, 2002). Recruitment of PRC2 by Xist and appearance of H3K27me3 along the Xi are among the earliest events in X inactivation (Mak et al, 2002; Plath et al, 2003; Silva et al, 2003). This has led to the prevailing view that PRC2 and H3K27me3 have a crucial function in X inactivation. However, recruitment of the PRC2 complex and H3K27me3 also occur in the absence of transcriptional silencing (Plath et al, 2003; Kohlmaier et al, 2004). In differentiated cells Xist is necessary but not sufficient for recruitment of H3K27me3, and thus H3K27me3 also depends on epigenetic information residing on the chromosome (Kohlmaier et al, 2004). When Xist is expressed during an early time window in differentiation, a chromosomal memory is established that enables efficient histone methylation later in differentiation. This memory is maintained in differentiated cells independent of Xist and gene silencing (Kohlmaier et al, 2004). Establishment of the memory temporally coincides with the transition from reversible to irreversible silencing, consistent with a role in the maintenance of X inactivation. The observation that recruitment of PRC2 and H3K27me3 is strictly dependent on Xist RNA and is reversible excludes PRC2 as a stable component of the memory. However, this finding is compatible with a role of PRC2 in memory establishment.

PcG complexes are thought to maintain a transcriptional memory for several developmental control genes in flies and mammals (Ringrose and Paro, 2004). It has been proposed that PRC2 recruits PRC1 based on the specificity of the chromodomain of Polycomb towards H3K27me3 (Fischle et al, 2003; Min et al, 2003). Eed is required for the maintenance of the paternal Xi exclusively in differentiating extraembryonic trophoblast cells (Wang et al, 2001). However, no defect in the maintenance of imprinted X inactivation has been observed in Eed mutant trophoblast stem cells or extraembryonic endoderm tissue, which lack H3K27me3 (Kalantry et al, 2006). In trophoblast stem cells, Eed is necessary for Xist RNA stabilisation and reactivation of the Xi is observed only after onset of differentiation. The function of Eed in the initiation of random X inactivation in embryonic cells has not been studied and its significance in the embryo proper remains unclear.

Here, we test the idea that PRC2 acts to recruit PRC1 in random X inactivation. Contrary to the expectation we find that Xist recruits the PRC1 protein Ring1b independent of H3K27me3 and Ring1b acts independently in the establishment of memory systems for the maintenance of X inactivation. This suggests that the present models for PcG complex recruitment in X inactivation need to be revised.

Xist mediated H2A ubiquitination is regulated by a memory in differentiated cells and independent of gene silencing

Biochemically purified mammalian PRC1 consists of several PcG proteins, including Ring1b, and its histone H2A lysine 119 specific ubiquitination activity has been shown (de Napoles et al, 2004; Wang et al, 2004). To investigate the function of PRC1 in X inactivation we have elucidated the kinetics of H2AK119ub1 in ES cells containing an inducible Xist expression system (Figure 1A). In the clone 36 ES cell line, an Xist cDNA transgene under control of the doxycycline inducible promoter is inserted into chromosome 11, and recapitulates chromosome-wide silencing (Wutz and Jaenisch, 2000). In DeltaSX ES cells, the endogenous Xist locus has been modified by a targeted deletion of repeat A sequences of Xist, which are required for silencing, and concomitant introduction of an inducible promoter. This achieves inducible expression of a mutant Xist RNA, which does not cause gene silencing and thus circumvents the lethality associated with inactivation of the single X chromosome in this male ES cell line (Wutz et al, 2002). H2AK119ub1 was established rapidly upon Xist induction in undifferentiated clone 36 ES cells. Importantly, induction of the silencing-deficient Xist RNA in DeltaSX ES cells was also able to establish H2AK119ub1 on the chromosome (Figure 1B), indicating that H2AK119ub1 is not sufficient for gene silencing in X inactivation.

Figure 1.

Figure 1 :

PRC1 recruitment by Xist. (A) Overview of the inducible Xist expression system (TetOP) on chromosome 11 and the X in clone 36 and DeltaSX ES cells, respectively. In clone 36 ES cells, Xist induction silences a linked puromycin marker gene (puro). In DeltaSX cells, the A repeat of Xist (triangle) is deleted. (B) Recruitment of the PRC1 components Ring1b and Mph1 as well as resulting H2AK119ub1 was observed by combined Xist RNA FISH (red) and immunofluorescence analysis (green) in undifferentiated DeltaSX ES cells after 3 days Xist induction. (C) H2AK119ub1 is regulated by a chromosomal memory in differentiated cells. Bar graphs representing the percentage of nuclei with focal H2AK119ub1 signals (grey bars) and Xist RNA (white bars) is given (above). Error bars represent the standard deviation. Below a scheme of the ES cell differentiation time course showing the presence (black) or absence (white) of doxycycline. An asterisk marks the Xist induction scheme revealing the chromosomal memory. (D) Analysis of H3K27me3 in parallel cultures to (C).

View full figure (215 KB)

We next studied the kinetics and stability of H2AK119ub1 during ES cell differentiation. We induced Xist starting at different time points in differentiating clone 36 ES cells and measured the levels of H2AK119ub1 and H3K27me3 at day 12 of differentiation (Figure 1C and D). In continuous presence of doxycycline, we detected a strong focal H2AK119ub1 signal in 69% of the nuclei, whereas no focus was observed if Xist was not induced. When Xist was turned off after 8 days of differentiation, focal H2AK119ub1 staining was observed in 7% of the cells on day 12 showing that H2AK119ub1 was reversible and Xist-dependent during differentiation. Xist induction starting from day 4 in differentiation resulted in low levels of H2AK119ub1 (16%) at day 12 compared to cultures where induction had occurred early. Therefore, in differentiated cells Xist is not sufficient for efficient imposition of H2AK119ub1, suggesting that H2A ubiquitination could be regulated by a chromosomal memory similar to H3K27me3. To test this, we induced Xist expression during the first 4 days of differentiation in clone 36 ES cells, subsequently turned off Xist for 4 days by withdrawing doxycycline and then measured H2AK119ub1 levels after re-induction of Xist for 4 more days. H2AK119ub1 staining was observed in 70% of these cells comparable to the percentage after 12 days of differentiation in continuous presence of doxycycline (Figure 1C). We conclude that Xist expression during an early time window in ES cell differentiation establishes a memory that is maintained independently of Xist. Reinduction of Xist in conjunction with this memory allows efficient H2AK119ub1 in differentiated cells. The recruitment of PRC1 mediated H2AK119ub1 therefore parallels the recruitment of PRC2 mediated H3K27me3 (Figure 1D) and could be a result of a dependency of PRC1 recruitment on H3K27me3.

Generation of ES cells lacking Eed

To directly investigate the function of the PRC2 complex in the recruitment of PRC1 at the initiation of X inactivation, we disrupted the Eed gene by targeting in clone 36 and DeltaSX ES cells. The targeting vector replaced sequences encoding the first and second WD40 domains of the Eed protein with a stop cassette, which terminates transcription resulting in a null allele (Supplementary Figure 1A). After removal of the selection cassette from targeted ES clones by Cre-recombinase mediated deletion, the second allele of Eed was targeted using the same strategy. This yielded the cell lines 36Eed-/- (clone 1 and 2) and DeltaSXEed-/-, derivatives of clone 36 and DeltaSX ES cells, respectively. Northern analysis confirmed the absence of wild-type Eed transcripts in these cells (Figure 2A). Two truncated Eed RNA species were observed in Eed-/- ES cells consistent with the termination of transcription at the introduced stop cassette. Western analysis revealed that Eed protein was absent in the Eed-/- cell lines (Figure 2B), while in control clone 36 and DeltaSX ES cell lines the four Eed isoforms were resolved. We further reconstituted Eed expression in 36Eed-/- (clone 2) ES cells by introducing a transgene expressing an amino terminal fusion of the enhanced green fluorescent protein (EGFP) with the short Eed isoform. In these 36EedTG ES cells, we observed one protein migrating with the expected molecular weight of the EGFP-Eed fusion protein and a faster migrating product likely due to proteolysis (Figure 2B). In Eed deficient ES cells, Suz12 RNA levels were reduced whereas steady-state levels of the Ezh2 transcripts remained unchanged compared to control cell lines (Figure 2A). Western analysis revealed that Ezh2 is drastically reduced below detection limit and Suz12 was found in reduced amount in Eed-/- cells (Figure 2B). In 36EedTG cells, Ezh2 and Suz12 RNA and protein levels were rescued confirming that the effect was specific and caused by the lack of Eed (Figure 2B, and data not shown).

Figure 2.

Figure 2 :

Generation of ES cells lacking Eed. (A) Northern analysis of Eed, Suz12 and Ezh2 in undifferentiated control clone 36 and Eed deficient 36Eed-/- ES cells after Xist was induced for 3 days (+) or not (-); Gapdh as loading control. (B) Western analysis of Eed, Ezh2 and Suz12 in nuclear extracts from uninduced ES cells (-) or induced for 3 days (+). hnRNP A as loading control, asterisk indicates a nonspecific band. (C–E) Indirect immunofluorescence (green) of Eed (C), Ezh2 (D) or Suz12 (E) and subsequent Xist RNA FISH (red) of representative nuclei of undifferentiated 36Eed-/- and control clone 36 ES cells after 3 days of Xist induction. DAPI (blue) stains DNA. Statistics of the number of nuclei showing colocalisation of Suz12 staining with Xist in 36 and 36Eed-/- ES cells. Error bars indicate standard deviation (n>600).

View full figure (364 KB)

Eed deficient 36Eed-/- and DeltaSXEed-/- ES cells showed a reduced ability to form colonies compared to control 36 and DeltaSX ES cells but proliferation and self-renewal of ES cells was largely independent of Eed (Supplementary Figure 1B and C). Furthermore, the plating efficiency is rescued in 36EedTG ES cells showing that the defect is specific and due to lack of Eed. Eed-/- ES cells could be induced to differentiate with retinoic acid, but showed a reduced developmental potential indicated by the formation of irregular shaped embroid bodies and the absence of contractile structures indicative of cardiomyocytes in embroid body outgrowths (Supplementary Figure 1D and E, and data not shown).

Xist recruits Suz12 independent of functional PRC2

Western analysis of Eed deficient ES cells revealed reduced Suz12 protein levels compared to control 36 ES cells and a loss of Ezh2 protein (Figure 2B). This was verified by combined immunofluorescence Xist RNA fluorescence in situ hybridisation (FISH) analysis on ES cells, after 3 days of Xist induction with doxycycline. In control clone 36 ES cells, 89, 79 and 88% of cells showed colocalisation of Xist RNA with Eed, Ezh2 and Suz12, respectively (Figure 2C–E; Table I). In Eed deficient 36Eed-/- ES cells Xist RNA showed normal localisation and no signal for Eed and Ezh2 was detected consistent with the loss of these proteins (Figure 2C and D). The Suz12 signal was markedly decreased in Eed deficient cells. However, we observed colocalisation of Suz12 with Xist RNA in 13 and 7% of 36Eed-/- clone 1 and clone 2 ES cells, respectively (Figure 2E). This demonstrates that recruitment of Suz12 by Xist RNA can occur, at least in part, independent of Ezh2 and Eed suggesting a role for Suz12 in PRC2 recruitment in X inactivation.

Xist recruits PRC1 independent of Eed and H3K27me3 in ES cells

To study the chromosomal marks at the initiation of X inactivation in Eed deficient ES cells, we performed combined Xist RNA FISH immunofluorescence analysis on 36Eed-/- and control ES cells (Figure 3 and Table I). After Xist induction for 3 days, we observed a strong focal H3K27me3 staining colocalising with Xist RNA in clone 36 ES cells. However, in 36Eed-/- ES cells di- and tri-methylation of H3K27 were drastically reduced and no colocalisation with Xist was observed consistent with a loss of PRC2 function in these cells (Figure 3B and C). A faint H3K27me3 signal was still observed at pericentric heterochromatin possibly due to weak cross-reactivity of the antibody with H4K20me3 (Peters et al, 2003). We detected a robust H3K27me1 signal at pericentric heterochromatin in 36Eed-/- cells comparable to controls (Figure 3A). In 36EedTG ES cells transgenic expression of EGFP-Eed rescued H3K27me3 (Supplementary Figure 1F).

Figure 3.

Figure 3 :

Histone modifications in Eed deficient ES cells. (A–E) Combined Xist RNA FISH (red) indirect immunofluorescence of indicated histone modifications (green) analysis on undifferentiated 36Eed-/- and control 36 ES cells after 3 days Xist expression. Representative images are shown, statistics see Table I. (F) Western analysis of mono-, di- and tri-methylation of H3K27 in 36Eed-/- clones 1 and 2 and control 36 ES cells after Xist induction for 3 days (+) or not (-); loading control hnRNP A. (G) Mass-spectrometric analysis of histone H3 lysine 27 methylation in clone 36, 36Eed-/- and 36EedTG ES cells. The percentage of the indicated modification state is given for three independent experiments; error bars indicate standard deviation.

View full figure (313 KB)

H2AK119ub1 and H4K20me1 are two marks associated with the initiation of X inactivation. H2AK119ub1 colocalised with Xist RNA in 97 and 98% of clone 36 and 36Eed-/- ES cells, respectively (Figure 3E). A robust H4K20me1 signal colocalising with Xist RNA was detectable in 82% control clone 36 ES cells. In 36Eed-/- ES cells, the H4K20me1 signal appeared less intense and was detected in 50% (clone 1) and 36% (clone 2) cells (Figure 3D). We conclude that ubiquitination of H2A on lysine 119 is independent of Eed, but PRC2 function supports the establishment of H4K20me1 by Xist (Table I).

We observed normal H2A ubiquitination upon Xist expression in Eed deficient cells, which in ES cells is thought to be mediated by Ring1b, a core component of PRC1 (Figure 3E). To assess if PRC1 was indeed recruited by Xist independent of PRC2, we performed immunofluorescence analysis using antisera specific for the PRC1 core components Ring1b, Mph1 and Mph2. Colocalisation of Ring1b with Xist RNA was observed in ES cells independent of Eed (Figure 4A). The Mph1 signal colocalised with Xist in 48% of control 36 ES cells, but no colocalisation was observed in 36Eed-/- ES cells (Figure 4B). Colocalisation of Mph2 with Xist RNA was observed only in differentiated cells (Figure 4C), and was detected in 33% of clone 36 but not in Eed deficient 36Eed-/- ES cells on day 8 of differentiation. We conclude that recruitment of Mph1 and Mph2 by Xist is dependent on PRC2 function, but Ring1b is recruited independently of PRC2, Mph1 and Mph2. Despite the lack of detectable Mph1 and Mph2 recruitment, the Ring1b protein is enzymatically active as shown by ubiquitination of H2A.

Figure 4.

Figure 4 :

Recruitment of PRC1 components in the absence of Eed. (A, B) Indirect immunofluorescence (IF) of Ring1b (A), Mph1 (B) and subsequent Xist RNA FISH (red) analysis on undifferentiated 36Eed-/- and control clone 36 ES cells after Xist expression for 3 days. (C) Analysis for Mph2 in ES cells differentiated for 8 days in the presence of doxycycline. The percentage of nuclei showing focal IF staining colocalising with Xist RNA is given for undifferentiated (ES), day 3 (DD3) and day 8 (DD8) of differentiation. Error bars represent standard deviation (n>350).

View full figure (243 KB)

PRC2 is critical for H3K27me2 and H3K27me3 in ES cells

To assess if disruption of Eed in 36Eed-/- and DeltaSXEed-/- ES cells indeed caused a loss of PRC2 function, we performed an analysis of histone modifications. By Western analysis H3K27me2 and H3K27me3 were lost in 36Eed-/- and DeltaSXEed-/- ES cells, but we found mono-methylation of H3K27 only slightly reduced consistent with our immunofluorescence data (Figure 3F). The mono-, di- and tri-methylation states of histone H3 lysine 9 or of H4 lysine 20, and ubiquitination of histone H2A lysine 119 were not altered in Eed deficient ES cells (data not shown).

To further quantify the histone methylation marks, we performed a mass spectrometric analysis of nuclear extracts prepared from undifferentiated 36Eed-/- and DeltaSXEed-/- and control ES cells. In control 36 ES cells, 17% of bulk histone H3 were mono-methylated, 58% di-methylated and 14% tri-methylated on lysine 27 (Figure 3G) consistent with previous reports (Peters et al, 2003). In Eed deficient ES cells, H3K27me3 and H3K27me2 were dramatically reduced compared to controls, but only a moderate reduction in the H3K27me1 signal was observed (Figure 3G). The loss of H3K27 di- and tri-methylation in Eed deficient ES cells resulted in a concomitant increase in unmodified but not mono-methylated H3K27. Di- and tri-methylation of H3K27 was restored in 36EedTG ES cells to 42 and 7%, corresponding to 72 and 50% of wild-type levels, respectively (Figure 3G). The methylation levels of H3K9 or H4K20 were unchanged by the absence of Eed (Supplementary Figures 2B and 3). However, H3K36me2 levels were significantly reduced from 50% in control clone 36 ES cells to 34% in 36Eed-/- ES cells, and 31% in DeltaSXEed-/- ES cells (Supplementary Figures 2A and 5). Restoration of H3K36me2 levels in 36EedTG to 43% demonstrated that the PRC2 complex regulates global H3K36me2 marks.

We conclude that in ES cells PRC2 is crucial for H3K27 di- and tri-methylation, but has no detectable contribution to H3K9 methylation. The H3K27me1 mark on pericentric heterochromatin was unaffected in Eed deficient ES cells (Figure 3A).

Initiation of silencing by Xist is independent of PRC2

In clone 36 ES cells inducible Xist expression causes reversible silencing of a puromycin resistance gene, which was cointegrated with the Xist cDNA transgene on chromosome 11 (Wutz and Jaenisch, 2000). To establish whether Eed is required for initiation of silencing, we induced Xist expression in 36Eed-/- ES cells for 3 days and analysed puromycin resistance gene expression by Northern (Figure 5A). Silencing was equally efficient in control 36, 36EedTG and Eed deficient ES cells, demonstrating that Eed and H3K27me3 are dispensable for initiation of silencing by Xist.

Figure 5.

Figure 5 :

Initiation and maintenance of silencing independent of Eed. (A) Northern analysis of PGKpuromycin, (puro) silencing in 36Eed-/- and control clone 36 cells after Xist induction for 24, 48 and 72 h; Gapdh as loading control. (B) Maintenance of puro silencing in cells differentiated in the presence (+; lanes 2, 5 and 8) or absence (-; 1, 4 and 9) doxycycline, or differentiated for 4 days in the presence followed by 4 days in the absence of doxycycline (lanes 3, 6 and 7). (C) Northern analysis of puro expression in embryoid bodies outgrowths established in the presence of doxycycline (+) or without (-) after 4 weeks. (D) Quantitative expression analysis of Cct4, Npm1, Igf2b and Tk1 on chromosome 11 in control 36 and 36Eed-/- ES cells at day 8 of differentiation in the absence (red bars), continuous presence (blue bars) of doxycycline, or presence of doxycycline for the first 4 days (green bars). Means of three independent measurements normalised to Gapdh are shown, error bars represent standard deviation. Scheme on the left shows the genes relative to the Xist transgene.

View full figure (214 KB)

To investigate the role of Eed for the maintenance of silencing, we induced Xist in differentiating 36Eed-/- and control 36 ES cells. In retinoic acid differentiated cells in the presence of doxycycline for 8 days or for 4 days followed by 4 days without Xist induction, we observed efficient maintenance of silencing of the puromycin gene compared to cultures, in which Xist had not been induced (Figure 5B). Notably, there was no difference between Eed deficient 36Eed-/- and control 36 ES cells demonstrating that the shift from reversible to irreversible gene silencing had occurred in the absence of PRC2 function. To test the function of Eed for the maintenance of silencing in a more physiological differentiation model, we established embryoid body outgrowth cultures from Eed deficient 36Eed-/- and control 36 ES cells in the presence or absence of doxycycline and measured expression of the puromycine marker gene after 4 weeks of differentiation. Northern analysis revealed that silencing was maintained in the absence of Eed (Figure 5C). Finally to establish that long-range silencing was maintained as opposed to merely silencing of the marker gene in proximity of the Xist transgene, we established differentiated cultures by induction with retinoic acid and measured expression of genes on chromosome 11 by quantitative PCR analysis. The Npm1 gene, which is located 20 Mb from the transgene integration site, was repressed by Xist on day 8 of differentiation in 36Eed-/- as well as in control cells to approximately 50%. Npm1 repression was also maintained in cells that were differentiated in the presence of doxycycline for 4 days followed by 4 days without (Figure 5D). The repression of three other genes Cct4, Igf2b1 and Tk1 in differentiated cells showed the same trend but was more variable, probably because of heterogeneous regulation in the differentiated cultures. We conclude that Eed is not required for the initiation of Xist mediated silencing, and that PRC2 function and H3K27me3 are dispensable for the maintenance of long-range silencing.

Memory recruitment for H2AK119ub1 is independent of PRC2 function

We observed that H2AK119ub1 is regulated by a chromosomal memory in differentiated cells. To investigate whether this memory would be established in Eed deficient ES cells and could still contribute in this context to Xist-mediated silencing, we analysed the establishment of H2AK119ub1 in Eed deficient 36Eed-/- (clone 1 and 2) and DeltaSXEed-/- ES cells (Figure 6A). The latter express a mutant Xist RNA that does not cause transcriptional repression, thus allowing us to follow memory establishment on an active chromosome. In all ES cell lines, Xist expression at early differentiation enabled efficient H2AK119ub1 at later time points comparable to control clone 36 ES cells (Figures 1C and 6A). We induced Xist expression for 4 days beginning at the start of differentiation, followed by withdrawal of doxycycline for 4 days. After this Xist RNA and H2AK119ub1 had been lost from the chromosome and then Xist expression was re-induced for 4 more days. In these cells we observed efficient re-ubiquitination (70, 59, 60 and 31% in 36, 36Eed-/- clone 1, 36Eed-/- clone 2 and DeltaSXEed-/- ES cells, respectively). This is comparable to cells, which were differentiated in continuous presence of doxycycline (69, 61, 58 and 41%). Importantly, efficient re-establishment of H2AK119ub1 was observed in differentiated DeltaSXEed-/- ES cells and was therefore independent of silencing. In contrast, Xist induction starting at day 4 in differentiation resulted in focal H2AK119ub1 staining in a low percentage of cells (16, 19, 22 and 17%). Moreover, when Xist expression was turned off by withdrawing doxycycline from the medium H2AK119ub1 was lost from the chromosome at all time points examined in ES cell differentiation (Figure 6, and data not shown). We conclude that Xist expression establishes a chromosomal memory independent of Eed and gene silencing suggesting a possible explanation for maintenance of X inactivation in Eed deficient embryonic cells.

Figure 6.

Figure 6 :

A chromosomal memory independent of silencing and Eed. (A) The percentage of nuclei showing focal staining for H2AK119ub1 or H3K27me3 (grey bars) and Xist RNA (white bars) is given (above). Error bars represent the standard deviation. Underneath the ES cell differentiation time course is depicted and the presence (black) or absence (white) of doxycycline is indicated. The Xist induction scheme revealing a chromosomal memory for H2AK119ub1 and H3K27me3 is marked by an asterisk. (B) Summary of recruitment of PRC1 and PRC2 by Xist in X inactivation.

View full figure (80 KB)

Discussion

Top

PRC1 recruitment in X inactivation is strictly dependent on Xist RNA

Using an inducible Xist expression system we have analysed the recruitment of PRC1 function in X inactivation. We find that Xist recruits Ring1b and concomitant H2AK119ub1 independent of transcriptional silencing. Recruitment of Polycomb complexes has been associated with heritable silencing of genes (Ringrose and Paro, 2004). We find that PRC1 and PRC2 also associate in the absence of gene silencing with the chromosome expressing Xist. Polycomb recruitment alone is therefore not sufficient for transcriptional repression in X inactivation. This is consistent with data in the fly where loading of PcG proteins onto Polycomb response elements (PREs) precedes the silencing of developmental control genes (Orlando et al, 1998). Polycomb binding and H3K27me3 on PREs has been observed independent of silencing (Ringrose et al, 2004) and loss of dRING function leads to derepression of genes despite of persistence of H3K27me3 (Wang et al, 2004). Alternatively, coordinate loading of PcG complexes on the promoter and a PRE could be required for repression. It is tempting to speculate that in X inactivation Xist repeat A acts as a signal to repress gene expression, thereby enabling recruitment of promoters to the PcG territory of the chromosome. In DeltaSX ES cells, promoters would then be predicted not to associate with the repressive PcG territory established by the silencing deficient Xist RNA lacking repeat A.

We find that PRC1 recruitment is dependent on Xist RNA localisation and is reversible throughout ES cell differentiation when Xist is turned off. From this we conclude that PRC1 is not stable once loaded onto the chromosome, but depends on Xist and a chromosomal memory. Consistent with this, dynamic turnover of PRC1 has been observed on chromatin in the fly (Ringrose et al, 2004; Ficz et al, 2005). In striking contrast to the fly, where noncoding RNA transcription over PREs has been associated with gene activation (Schmitt et al, 2005; Sanchez-Elsner et al, 2006), in X inactivation the noncoding Xist RNA is associated with the repressed state. This suggests different mechanisms for Polycomb loading in the fly and in X inactivation and demonstrates a novel strictly RNA dependent recruitment mode for mammalian PRC1.

H2AK119ub1 activity of PRC1 does not require Mph1 or Mph2

Using Eed-deficient ES cells we show that the recruitment of the PRC1 core proteins Mph1 and Mph2 by Xist is dependent on Eed. This observation is consistent with the idea that PRC2 has a recruitment function for PRC1 components. A fly PRC1 core complex has been reconstituted containing the four components Psc, Pc, Ph and dRing (Francis et al, 2001). A similar composition has been proposed for mammalian PRC1 like complexes based on purification and reconstitution experiments (Lavigne et al, 2004; Wang et al, 2004). However, we observe in Eed deficient ES cells that Ring1b is not only recruited by Xist in the absence of the PRC1 core components Mph1 and Mph2 but also appears to be functional as demonstrated by the concomitant ubiquitination of lysine 119 on histone H2A. Thus, in X inactivation Ring1b is either functional alone and can be recruited independently of other PRC1 members by Xist, or is part of a distinct complex that is yet to be identified (Ogawa et al, 2002; Dou et al, 2005; Isono et al, 2005b).

Based on our data we therefore propose two mechanisms for recruitment of PRC1 function by Xist in X inactivation (Figure 6b). A PRC2 dependent mode involves the binding of the Polycomb chromodomain to the H3K27me3 mark and operates via Mph1 or Mph2. This is predicted from biochemical evidence that H3K27me3 acts as a affinity signal recognised by the chromodomain of mammalian homologues of Polycomb (Fischle et al, 2003; Min et al, 2003). Our data provide evidence for a second mode of recruitment for PRC1 function. In the absence of PRC2 function, Xist can recruit Ring1b independent of the PRC1 core proteins Mph1 or Mph2. Both recruitment modes for PRC1 by Xist act synergistically to mediate H2AK119ub1 in the initiation of X inactivation.

Ring1b and PRC2 are regulated by a chromosomal memory

Establishment of H2AK119ub1 is restricted to an early time window in ES cell differentiation such that little H2AK119ub1 is imposed if Xist is induced at late time points in ES cell differentiation. Thus, Xist expression during an early window in differentiation establishes a chromosomal memory that in differentiated cells is required for H2AK119ub1. This memory is established at the time when X inactivation becomes irreversible and is stably maintained independent of Xist expression. To date, the molecular nature of this chromosomal memory is unknown. Our data demonstrate that the memory regulating the imposition of H2AK119ub1 and H3K27me3 in differentiated cells is independent of silencing. Recruitment of both PRC1 and PRC2 is also dependent on Xist RNA localisation and both histone marks are lost from the chromosome when Xist is turned off. Hence, H2AK119ub1 and H3K27me3 are reversible modifications and depend on Xist expression. We conclude that PRC1 and PRC2 are not stably maintained on the Xi throughout ES cell differentiation and can be excluded as integral components of the memory. Yet, the recruitment of PcG proteins early in X inactivation is consistent with a role in the establishment of a special chromatin structure that functions as chromosomal memory. Importantly, our data demonstrate that once established this chromatin structure is self-perpetuating and stable in the absence of Xist, PRC1 and PRC2. We show that a chromosomal memory regulating H2AK119ub1 is established independent of PRC2, Mph1 and Mph2.

Eed and H3K27me3 are not crucial for X inactivation in embryonic cells

Disruption of Eed in ES cells caused a lack Eed and Ezh2 protein and reduced levels of Suz12 consistent with earlier reports (Pasini et al, 2004; Montgomery et al, 2005). In the absence of Eed the levels of Ezh2 protein, which contains the catalytically active SET domain required for PRC2 histone methylase function, are reduced below detection. This could be the result of impaired translation or enhanced turnover of Ezh2 protein in the absence of Eed. In support of this notion, the disruption of PRC2 function in Eed deficient ES cells is clearly demonstrated by the loss of H3K27me3 in Eed deficient ES cells. Interestingly, we find that Xist RNA can recruit Suz12 independent of a functional PRC2 complex. Suz12 is a core component of the biochemically purified PRC2 complex, suggesting that PRC2 might be recruited at least in part via Suz12 in X inactivation. Consistent with this Suz12 also has roles in position effect variegation in fly and thus can act independent of PRC2 (Birve et al, 2001).

Western, immunofluorescence and mass spectrometric analyses show that disruption of PRC2 function leads to a specific loss of di- and tri- but not mono-methylation of H3K27 in vivo without affecting global levels of H3K9 methylation. This finding is consistent with and extends data from Suz12 deficient embryos (Pasini et al, 2004). Notably, the H3K27me1 marks at pericentric heterochromatin are not affected by loss of PRC2 function consistent with an independent regulation. In ES cells, Xist expression leads to rapid establishment of H3K27me3 along the chromosome, which requires PRC2 function. From mass spectrometric data we obtained a rough estimate that induction of Xist causes an approximately seven-fold increase in H3K27me3. Such an increase would require that 90% of the nucleosomes of the Xist expressing chromosome are tri-methylated on H3 lysine 27, compared to 14% total nuclear average (Supplementary Figure 2; Peters et al, 2003). Given that in bulk chromatin 60% of histone H3 is di-methylated on lysine 27, the effect of Xist is a shift from di- to a tri-methyl marks that could provide increased affinity for PRC1. Our observation that recruitment of Mph1 and Mph2 by Xist is abolished in the absence of PRC2 supports this view.

Reactivation of the paternal Xi was observed previously in differentiating trophoblast stem cells in Eed deficient embryos, indicating a role for PRC2 in maintenance of X inactivation (Wang et al, 2001). However, maintenance of the Xi in trophoblast stem cells and extraembryonic endoderm is not affected by a mutation in Eed (Kalantry et al, 2006). Imprinted X inactivation is initiated very early in embryogenesis and a maternal contribution of Eed could possibly function early in the initiation of imprinted X inactivation in Eed mutant embryos. Using Eed deficient ES cells, we can rule out PRC2 function at the initiation of Xist mediated silencing in embryonic cells. Xist expression in ES cells lacking functional PRC2 fails to establish H3K27me3 and recruit Mph1 and Mph2. However, in the absence of Eed, stable X inactivation can still be achieved. This unexpected finding suggests that functionally redundant mechanisms compensate for the loss of PRC2 function to maintain Xist mediated silencing in ES cell differentiation. PRC1 and PRC2 function independently in gene regulation as indicated by the requirement of both Eed and Ring1b for embryonic development (Wang et al, 2002; Voncken et al, 2003). Our data show that Ring1b can be recruited by Xist independent of PRC2. This recruitment of PRC1 function provides a likely explanation for the lack of an obvious defect on Xi maintenance in Eed deficient embryonic cells. This is in contrast to PRC2 action in the regulation of other genes, where a recruitment function of PRC2 is essential (Zhang et al, 2004). The requirement of PRC2 for recruitment of some PRC1 components is also observed in X inactivation as Xist is unable to recruit Mph1 and Mph2 in the absence of Eed. In conclusion, we find that Xist can establish a chromatin structure that mediates a chromosomal memory in X inactivation independent of PRC2, suggesting the masking of a more dramatic defect in the maintenance of X inactivation in Eed deficient cells by an PRC2 independent mechanism for recruitment of PRC1 function by Xist. Future studies will be directed to establish the interplay between transcriptional silencing and the PcG complex mediated chromosomal memory during X inactivation.

Materials and methods

Top

Cell culture and generation of ES cell lines

ES cells were cultured as described previously (Wutz and Jaenisch, 2000). Xist expression was induced by the addition of 1 mug/ml of doxycycline. Differentiation medium contained 100 nM all-trans-retinoic acid and no LIF. Embryoid bodies were generated by the hanging drop method in medium without LIF. After 2 days aggregates were pooled and cultured in suspension for 3 days and subsequently plated on gelatin-coated culture dishes for 3 weeks. Cell numbers were determined using a Casy 1 cell counter (Schaerfe System GmbH, Germany).

For construction of the Eed targeting vector, a 12 kb XhoI–ClaI genomic fragment was subcloned from a BAC isolated from the RPCII22 129 mouse BAC library (CHORI). The 2.8 kb SacI–EcoRI fragment containing three exons coding for WD40 domains 1 and 2 of the Eed protein were replaced by a stop cassette containing the adenoviral splice acceptor and polyadenylation signal separated by a loxP-flanked hygromycin-thymidine kinase selection cassette. Finally, a diphtheria toxin A chain cassette was inserted for counter selection of random insertions (see Figure 1B). Targeted clones were identified after selection with Hygromycin B (130 mug/ml) by Southern analysis of EcoRV digested DNA using probe pEed by a 12 kb band (wild-type band runs at 23 kb). The targeting frequency was between 17 and 37%. After Cre recombinase mediated excision of the selection cassette, the second allele was targeted using the same strategy yielding Eed-/- cells. For pCAG–EGFP-Eed-IREShygPA the short Eed isoform, corresponding to the human isoform 3 (Kuzmichev et al, 2004), was tagged with EGFP at the N-terminus and cloned into pCAG-IREShygPA. 36Eed-/- clone 2 ES cells were electroporated with 50 mug of pCAG-EGFP-Eed-IREShygPA to generate 36EedTG cells.

Immunostaining and RNA FISH

ES cells were attached to poly-l-lysine coated coverslips or cytospun using a Cytospin 3 centrifuge (Thermo Shandon, USA). Differentiated cells were grown on Roboz slides (CellPoint Scientific, USA). Immunostaining was performed as described (Peters et al, 2003; Kohlmaier et al, 2004). Briefly, cells were fixed for 10 min at RT in 4% PFA in PBS, permeabilised for 5 min at RT in 0.1% Na Citrate/0.1% Triton X-100, blocked for 60 min at RT in PBS containing 5% (wt/vol) BSA, 0.1% Tween-20. For H2AK119ub1 immunostaining cells were pre-extracted in 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, 10 mM Pipes pH 6.8 and 0.5% Triton for 2 min at RT before fixation.

RNA FISH probes were generated by random priming (Stratagene, USA) using Cy3-dCTP (Amersham). After immunostaining, cells were fixed in 4% PFA in PBS for 10 min at 4°C, de-hydrated, hybridised and washed as described (Wutz and Jaenisch, 2000). Images were obtained using a fluorescence microscope (Zeiss Axioplan) equipped with a CCD camera and the MetaMorph image analysis software (Universal Imaging, USA).

RNA and protein analysis

Northern analysis was performed using 20 mug of RNA (Trizol; Invitrogen) as described previously (Wutz and Jaenisch, 2000). Antibodies for histone lysine methylation states and Western analysis were previously described (Peters et al, 2003; Kohlmaier et al, 2004) and the following dilutions were used (immunostaining/Western blot): alpha-H3K9m1 (#4858, 1:1000/1:500); alpha-H3K9m2 (#4677, 1:1000/1:1000); alpha-H3K9m3 (#4861, 1:750/1:1000); alpha-H3K27m1 (#8835, 1:6,000/1:1000); alpha-H3K27m2 (#8841, 1:1000/1:2,000); alpha-H3K27m3 (#6523, 1:1000/1:7,000); alpha-H4K20m1 (#0077, 1:500/1:3,000); alpha-H4K20m2 (#0080, 1:1000/1:1000); alpha-H4K20m3 (#0083, 1:3,000/1:3,000). Additional antibodies were as follows: alpha-H2AK119ub1 (alpha-ubiquityl-Histone H2A, clone E6C5; #05-678 Upstate Biotechnology, Lake Placid, New York, USA), 1:50/1:400; alpha-Suz12 (# 07-379; Upstate), 1:1000/1:1000; alpha-Eed (rabbit polyclonal antiserum, AKS and AW, unpublished results); 1:1000 alpha-Ezh2 (rabbit polyclonal antiserum, M Busslinger unpublished results); 1:1000/1:1000); alpha-Ring1b (Atsuta et al, 2001), 1:100 for IF; alpha-Mph1 (Isono et al, 2005a), 1:5 for IF; alpha-Mph2 (Isono et al, 2005a), 1:100 for IF; alpha-hnRNP A1 (4B10 mouse monoclonal antiserum), 1:1000 for Western. Secondary antibodies: Alexa A-11034 Fluor 488 goat anti-rabbit IgG (H+L) and Alexa A-11034 Fluor 488 goat anti-mouse IgG (H+L) all at 1:500 (Molecular Probes, USA); HRP-conjugated AffiniPure goat anti-rabbit IgG (H+L), 1:10 000 and HRP-conjugated AffiniPure goat anti-mouse IgG (H+L), 1:5000 (Jackson ImmunoResearch Laboratories. Inc., USA).

Quantitative PCR expression analysis

Random primed cDNA was generated from 10 mug total RNA from clone 36 and Eed-/- ES cells using the Superscript II Reverse transcription kit (Invitrogen). Quantitative PCR using the Taqman method (Applied Biosystems) for Tk1 (primers:

GCAACAGCTTCTCCACACATGA, GCGGAGCATGCAGGCT;

probe: CGGAACACCATGGACGCATTGC),

Npm1 (TGTAGAGGAAGATGCAGAGTCTGAA, CCTCCAGGAGCAGATCGCT;

AGGAGGACGTAAAACTCTTAGGCATGTC),

Igfbp2 (CGGCAAAGGCGGCAA, TGGCACTACCACCTCAGCTG;

ACGGTGAATGAGCTGCAGAACTTGACC),

Cct4 (CCTACCAGGACCGCGACA, GCTTTGGCCGCGGAA;

CCAGCCCAGATCCGCTTCAGCAAT) and

Gapdh (CATGGCCTTCCGTGTTCCTA, TGTCATCATACTTGGCAGGTTTCT;

TCGTGGATCTGACGTGCCGCC)

on a ABI PRISM 7000 detection machine was performed in triplicate as described (Pauler et al, 2005). Quantification was achieved by the standard curve method using serial dilutions of cDNA generated from uninduced ES cells at day 8 of differentiation. Samples were normalised to Gapdh and the expression levels of uninduced clone 36 ES cells at day 8 of differentiation were set to 100 for each gene.

Nuclear extracts and mass spectrometry

ES cell cultures where harvested by trypsination and feeders were removed by plating on cell culture dishes twice for 30 min. Nuclear extracts were prepared as described (Peters et al, 2003). For mass spectrometry 20 mug of nuclear extracts were separated by 15% SDS–PAGE and bands containing histone H3 and H4 were excised after Coomassie staining. Processing of the samples and quantitative mass spectrometric analyses were carried out as described (Peters et al, 2003).



Acknowledgements

Top

We thank Gideon Dreyfuss, Arie Otte and Meinrad Busslinger for kindly providing antibodies, and Leonie Ringrose for critically reading the manuscript. This research is supported by the IMP through Boehringer Ingelheim and by grants from the GEN-AU initiative of the Austrian Ministry of Education, Science and Culture, and the European Union 6th framework program Epigenome Network of Excellence.

References

Top

Atsuta T, Fujimura S, Moriya H, Vidal M, Akasaka T, Koseki H (2001) Production of monoclonal antibodies against mammalian Ring1B proteins. Hybridoma 20: 43–46 | Article | PubMed | ISI | ChemPort |

Birve A, Sengupta AK, Beuchle D, Larsson J, Kennison JA, Rasmuson-Lestander A, Muller J (2001) Su(z)12, a novel Drosophila Polycomb group gene that is conserved in vertebrates and plants. Development 128: 3371–3379 | PubMed | ISI | ChemPort |

Borsani G, Tonlorenzi R, Simmler MC, Dandolo L, Arnaud D, Capra V, Grompe M, Pizzuti A, Muzny D, Lawrence C et al (1991) Characterization of a murine gene expressed from the inactive X chromosome. Nature 351: 325–329 | Article | PubMed | ISI | ChemPort |

Brockdorff N, Ashworth A, Kay GF, Cooper P, Smith S, McCabe VM, Norris DP, Penny GD, Patel D, Rastan S (1991) Conservation of position and exclusive expression of mouse Xist from the inactive X chromosome. Nature 351: 329–331 | Article | PubMed | ISI | ChemPort |

Brown CJ, Ballabio A, Rupert JL, Lafreniere RG, Grompe M, Tonlorenzi R, Willard HF (1991a) A gene from the region of the human X inactivation centre is expressed exclusively from the inactive X chromosome. Nature 349: 38–44 | Article | PubMed | ISI | ChemPort |

Brown CJ, Lafreniere RG, Powers VE, Sebastio G, Ballabio A, Pettigrew AL, Ledbetter DH, Levy E, Craig IW, Willard HF (1991b) Localization of the X inactivation centre on the human X chromosome in Xq13. Nature 349: 82–84 | Article | PubMed | ISI | ChemPort |

Cao R, Wang L, Wang H, Xia L, Erdjument-Bromage H, Tempst P, Jones RS, Zhang Y (2002) Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science 298: 1039–1043 | Article | PubMed | ISI | ChemPort |

Csankovszki G, Nagy A, Jaenisch R (2001) Synergism of Xist RNA, DNA methylation, and histone hypoacetylation in maintaining X chromosome inactivation. J Cell Biol 153: 773–784 | Article | PubMed | ISI | ChemPort |

Czermin B, Melfi R, McCabe D, Seitz V, Imhof A, Pirrotta V (2002) Drosophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell 111: 185–196 | Article | PubMed | ISI | ChemPort |

de Napoles M, Mermoud JE, Wakao R, Tang YA, Endoh M, Appanah R, Nesterova TB, Silva J, Otte AP, Vidal M, Koseki H, Brockdorff N (2004) Polycomb group proteins Ring1A/B link ubiquitylation of histone H2A to heritable gene silencing and X inactivation. Dev Cell 7: 663–676 | Article | PubMed | ISI | ChemPort |

Dou Y, Milne TA, Tackett AJ, Smith ER, Fukuda A, Wysocka J, Allis CD, Chait BT, Hess JL, Roeder RG (2005) Physical association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF. Cell 121: 873–885 | Article | PubMed | ISI | ChemPort |

Fang J, Chen T, Chadwick B, Li E, Zhang Y (2004) Ring1b-mediated H2A ubiquitination associates with inactive X chromosomes and is involved in initiation of X inactivation. J Biol Chem 279: 52812–52815 | Article | PubMed | ISI | ChemPort |

Ficz G, Heintzmann R, Arndt-Jovin DJ (2005) Polycomb group protein complexes exchange rapidly in living Drosophila. Development 132: 3963–3976 | Article | PubMed | ISI | ChemPort |

Fischle W, Wang Y, Jacobs SA, Kim Y, Allis CD, Khorasanizadeh S (2003) Molecular basis for the discrimination of repressive methyl-lysine marks in histone H3 by Polycomb and HP1 chromodomains. Genes Dev 17: 1870–1881 | Article | PubMed | ISI | ChemPort |

Francis NJ, Saurin AJ, Shao Z, Kingston RE (2001) Reconstitution of a functional core polycomb repressive complex. Mol Cell 8: 545–556 | Article | PubMed | ISI | ChemPort |

Hernandez-Munoz I, Lund AH, van der Stoop P, Boutsma E, Muijrers I, Verhoeven E, Nusinow DA, Panning B, Marahrens Y, van Lohuizen M (2005) Stable X chromosome inactivation involves the PRC1 Polycomb complex and requires histone MACROH2A1 and the CULLIN3/SPOP ubiquitin E3 ligase. Proc Natl Acad Sci USA 102: 7635–7640 | Article | PubMed | ChemPort |

Huynh KD, Lee JT (2003) Inheritance of a pre-inactivated paternal X chromosome in early mouse embryos. Nature 426: 857–862 | Article | PubMed | ISI | ChemPort |

Isono K, Fujimura Y, Shinga J, Yamaki M, J OW, Takihara Y, Murahashi Y, Takada Y, Mizutani-Koseki Y, Koseki H (2005a) Mammalian polyhomeotic homologues phc2 and phc1 act in synergy to mediate polycomb repression of hox genes. Mol Cell Biol 25: 6694–6706 | Article | PubMed | ISI | ChemPort |

Isono K, Mizutani-Koseki Y, Komori T, Schmidt-Zachmann MS, Koseki H (2005b) Mammalian polycomb-mediated repression of Hox genes requires the essential spliceosomal protein Sf3b1. Genes Dev 19: 536–541 | Article | PubMed | ISI | ChemPort |

Kalantry S, Mills KC, Yee D, Otte AP, Panning B, Magnuson T (2006) The Polycomb group protein Eed protects the inactive X-chromosome from differentiation-induced reactivation. Nat Cell Biol 8: 195–202 | Article | PubMed | ChemPort |

Kohlmaier A, Savarese F, Lachner M, Martens J, Jenuwein T, Wutz A (2004) A chromosomal memory triggered by Xist regulates histone methylation in X inactivation. PLoS Biol 2: E171 | Article | PubMed

Kuzmichev A, Jenuwein T, Tempst P, Reinberg D (2004) Different EZH2-containing complexes target methylation of histone H1 or nucleosomal histone H3. Mol Cell 14: 183–193 | Article | PubMed | ISI | ChemPort |

Kuzmichev A, Nishioka K, Erdjument-Bromage H, Tempst P, Reinberg D (2002) Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein. Genes Dev 16: 2893–2905 | Article | PubMed | ISI | ChemPort |

Lavigne M, Francis NJ, King IF, Kingston RE (2004) Propagation of silencing; recruitment and repression of naive chromatin in trans by polycomb repressed chromatin. Mol Cell 13: 415–425 | Article | PubMed | ISI | ChemPort |

Mak W, Baxter J, Silva J, Newall AE, Otte AP, Brockdorff N (2002) Mitotically stable association of polycomb group proteins eed and enx1 with the inactive X chromosome in trophoblast stem cells. Curr Biol 12: 1016–1020 | Article | PubMed | ISI | ChemPort |

Mak W, Nesterova TB, de Napoles M, Appanah R, Yamanaka S, Otte AP, Brockdorff N (2004) Reactivation of the paternal X chromosome in early mouse embryos. Science 303: 666–669 | Article | PubMed | ISI | ChemPort |

Min J, Zhang Y, Xu RM (2003) Structural basis for specific binding of Polycomb chromodomain to histone H3 methylated at Lys 27. Genes Dev 17: 1823–1828 | Article | PubMed | ISI | ChemPort |

Montgomery ND, Yee D, Chen A, Kalantry S, Chamberlain SJ, Otte AP, Magnuson T (2005) The murine polycomb group protein Eed is required for global histone H3 lysine-27 methylation. Curr Biol 15: 942–947 | Article | PubMed | ISI | ChemPort |

Muller J, Hart CM, Francis NJ, Vargas ML, Sengupta A, Wild B, Miller EL, O'Connor MB, Kingston RE, Simon JA (2002) Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell 111: 197–208 | Article | PubMed | ISI | ChemPort |

Ogawa H, Ishiguro K, Gaubatz S, Livingston DM, Nakatani Y (2002) A complex with chromatin modifiers that occupies E2F- and Myc-responsive genes in G0 cells. Science 296: 1132–1136 | Article | PubMed | ISI | ChemPort |

Okamoto I, Otte AP, Allis CD, Reinberg D, Heard E (2004) Epigenetic dynamics of imprinted X inactivation during early mouse development. Science 303: 644–649 | Article | PubMed | ISI | ChemPort |

Orlando V, Jane EP, Chinwalla V, Harte PJ, Paro R (1998) Binding of trithorax and Polycomb proteins to the bithorax complex: dynamic changes during early Drosophila embryogenesis. EMBO J 17: 5141–5150 | Article | PubMed | ISI | ChemPort |

Pasini D, Bracken AP, Jensen MR, Lazzerini Denchi E, Helin K (2004) Suz12 is essential for mouse development and for EZH2 histone methyltransferase activity. EMBO J 23: 4061–4071 | Article | PubMed | ISI | ChemPort |

Pauler FM, Stricker SH, Warczok KE, Barlow DP (2005) Long-range DNase I hypersensitivity mapping reveals the imprinted Igf2r and Air promoters share cis-regulatory elements. Genome Res 15: 1379–1387 | Article | PubMed | ChemPort |

Peters AH, Kubicek S, Mechtler K, O'Sullivan RJ, Derijck AA, Perez-Burgos L, Kohlmaier A, Opravil S, Tachibana M, Shinkai Y, Martens JH, Jenuwein T (2003) Partitioning and plasticity of repressive histone methylation states in mammalian chromatin. Mol Cell 12: 1577–1589 | Article | PubMed | ISI | ChemPort |

Plath K, Fang J, Mlynarczyk-Evans SK, Cao R, Worringer KA, Wang H, de la Cruz CC, Otte AP, Panning B, Zhang Y (2003) Role of histone H3 lysine 27 methylation in X inactivation. Science 300: 131–135 | Article | PubMed | ISI | ChemPort |

Plath K, Mlynarczyk-Evans S, Nusinow DA, Panning B (2002) Xist RNA and the mechanism of X chromosome inactivation. Annu Rev Genet 36: 233–278 | Article | PubMed | ISI | ChemPort |

Ringrose L, Ehret H, Paro R (2004) Distinct contributions of histone H3 lysine 9 and 27 methylation to locus-specific stability of polycomb complexes. Mol Cell 16: 641–653 | Article | PubMed | ISI | ChemPort |

Ringrose L, Paro R (2004) Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annu Rev Genet 38: 413–443 | Article | PubMed | ISI | ChemPort |

Sanchez-Elsner T, Gou D, Kremmer E, Sauer F (2006) Noncoding RNAs of Trithorax response elements recruit Drosophila Ash1 to Ultrabithorax. Science 311: 1118–1123 | Article | PubMed | ISI | ChemPort |

Schmitt S, Prestel M, Paro R (2005) Intergenic transcription through a polycomb group response element counteracts silencing. Genes Dev 19: 697–708 | Article | PubMed | ISI | ChemPort |

Silva J, Mak W, Zvetkova I, Appanah R, Nesterova TB, Webster Z, Peters AH, Jenuwein T, Otte AP, Brockdorff N (2003) Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes. Dev Cell 4: 481–495 | Article | PubMed | ISI | ChemPort |

Voncken JW, Roelen BA, Roefs M, de Vries S, Verhoeven E, Marino S, Deschamps J, van Lohuizen M (2003) Rnf2 (Ring1b) deficiency causes gastrulation arrest and cell cycle inhibition. Proc Natl Acad Sci USA 100: 2468–2473 | Article | PubMed | ChemPort |

Wang H, Wang L, Erdjument-Bromage H, Vidal M, Tempst P, Jones RS, Zhang Y (2004) Role of histone H2A ubiquitination in Polycomb silencing. Nature 431: 873–878 | Article | PubMed | ISI | ChemPort |

Wang J, Mager J, Chen Y, Schneider E, Cross JC, Nagy A, Magnuson T (2001) Imprinted X inactivation maintained by a mouse Polycomb group gene. Nat Genet 28: 371–375 | Article | PubMed | ISI | ChemPort |

Wang J, Mager J, Schnedier E, Magnuson T (2002) The mouse PcG gene eed is required for Hox gene repression and extraembryonic development. Mamm Genome 13: 493–503 | Article | PubMed | ISI | ChemPort |

Wutz A, Jaenisch R (2000) A shift from reversible to irreversible X inactivation is triggered during ES cell differentiation. Mol Cell 5: 695–705 | Article | PubMed | ISI | ChemPort |

Wutz A, Rasmussen TP, Jaenisch R (2002) Chromosomal silencing and localization are mediated by different domains of Xist RNA. Nat Genet 30: 167–174 | Article | PubMed | ISI | ChemPort |

Zhang Y, Cao R, Wang L, Jones RS (2004) Mechanism of Polycomb group gene silencing. Cold Spring Harb Symp Quant Biol 69: 309–317 | Article | PubMed | ChemPort |

Top

MORE ARTICLES LIKE THIS

These links to content published by NPG are automatically generated

NEWS AND VIEWS

Developmental biology Two paths to silence merge

Nature News and Views (16 Feb 2006)

The need for Eed

Nature Genetics News and Views (01 Apr 2003)