Article

• The EMBO Journal (2006) 25, 232 - 243
• doi:10.1038/sj.emboj.7600920

Published online: 15 December 2005

• Subject Categories:

  • Development | Differentiation and Death

The two Drosophila cytochrome C proteins can function in both respiration and caspase activation

Eli Arama¹, Maya Bader¹, Mayank Srivastava², Andreas Bergmann² and Hermann Steller¹

1. Strang Laboratory of Cancer Research, Howard Hughes Medical Institute, The Rockefeller University, New York, NY, USA
2. Department of Biochemistry and Molecular Biology, The University of Texas MD Anderson Cancer Center, Houston, TX, USA

Correspondence to:

Hermann Steller, Strang Laboratory of Cancer Research, Howard Hughes Medical Institute, The Rockefeller University, 1230 York Avenue, New York, NY 10021, USA. Tel.: +1 212 327 7075; Fax: +1 212 327 7076; E-mail: steller@rockefeller.edu

Received 4 October 2005; Accepted 22 November 2005

• Keywords:

  • apoptosis,
  • caspase,
  • cytochrome c,
  • Drosophila,
  • spermatogenesis

Introduction

Apoptosis is a morphologically distinct form of active cellular suicide that serves to eliminate unwanted and potentially dangerous cells (Thompson, 1995; Jacobson et al, 1997; Hengartner, 2000; Meier et al, 2000a; Baehrecke, 2002; Nelson and White, 2004). The key enzymes responsible for the execution of apoptosis are an evolutionarily conserved family of cysteine proteases known as caspases (Salvesen, 2002; Degterev et al, 2003; Abraham and Shaham, 2004). Caspases are present in an inactive or weakly active state in virtually all cells of higher metazoans, and their activity is carefully regulated by both activators and inhibitors (Song and Steller, 1999; Salvesen and Abrams, 2004). In vertebrates, the mitochondria play an important role in the control of apoptosis: they release cytochrome C and other pro-apoptotic proteins in response to various death signals (Zou et al, 1997; Green and Reed, 1998; Benedict et al, 2000; Larisch et al, 2000; Wang, 2001). In the cytosol, cytochrome C binds to Apaf-1 (Zou et al, 1997) which in turn promotes the assembly of a multiprotein complex, termed the 'apoptosome', and caspase-9 activation (Rodriguez and Lazebnik, 1999; Adams and Cory, 2002; Cain et al, 2002; Salvesen and Renatus, 2002). In the ensuing 'caspase cascade', many intracellular substrates are cleaved and apoptosis is executed (Slee et al, 1999; Riedl and Shi, 2004). However, the exact physiological role of cytochrome C for caspase activation remains to be determined, and a recent report on a mutant cytochrome c that fails to activate Apaf-1 in the mouse suggests that cytochrome C is required for caspase activation in only some mammalian cell types (Hao et al, 2005). In invertebrates, any role of cytochrome C for the activation of caspases has remained highly controversial (Kornbluth and White, 2005). Whereas RNAi experiments in Drosophila S2 cells have failed to reveal a role for cytochrome C in apoptosis, other reports suggest that cytochrome C may promote caspase activation (Dorstyn et al, 2002, 2004; Zimmermann et al, 2002). Drosophila contains two Apaf-1 isoforms: one with a WD40 repeat domain, the target for cytochrome C binding, and another lacking this domain, similar to Caenorhabditis elegans Ced-4. The large isoform can directly bind cytochrome C in vitro and promote cytochrome C-dependent caspase activation in lysates from developing embryos (Kanuka et al, 1999). Furthermore, an overt alteration in the cytochrome C immuno-staining can be detected in doomed cells in some Drosophila tissues, and the mitochondria from apoptotic cells can activate cytosolic caspases (Varkey et al, 1999). Finally, disruption of one of the two Drosophila cytochrome c genes, cyt-c-d, is associated with a failure to activate caspases in an apoptosis-like process during sperm terminal differentiation in Drosophila (Arama et al, 2003). In this process, also known as spermatid individualization, the majority of cytoplasm and cellular organelles are eliminated from the developing spermatids in an apoptosis-like process that requires caspase activity (Arama et al, 2003). However, it was suggested that the mutants used in our previous study may also affect other genes located in the vicinity of the cyt-c-d locus (Huh et al, 2004). Here, in order to rigorously address this issue, we conducted a series of genetic and transgenic rescue experiments that unequivocally establish a role of cytochrome C for caspase activation during Drosophila spermatogenesis. First, we isolated a point mutation in cyt-c-d that is defective in caspase activation. Next, we demonstrated that transgenic expression of cyt-c-d restores effector caspase activation and rescues all the sterility phenotypes associated with various cyt-c-d mutant alleles. We also investigated the possibility that cyt-c-p functions specifically in respiration, whereas cyt-c-d plays a role in caspase regulation. To our surprise, we found that expression of either cyt-c-d or cyt-c-p can restore caspase activation in cyt-c-d-deficient spermatids, demonstrating that both proteins are functionally equivalent. Other apoptosome proteins in Drosophila, Ark (Apaf-1) and Dronc (caspase-9) are also required for spermatid individualization, and their mutant phenotypes are similar to spermatids with a block in caspase activity. Surprisingly, however, we can still detect some active caspase-3 staining in these mutant testes, suggesting that cytochrome-C-d may function in yet other unknown pathways to promote caspase-3 activation. Finally, we have identified several mutants affecting spermatid mitochondria that provide a strong link between mitochondrial organization and caspase activation during sperm development.

Mutations in cyt-c-d block caspase activation during spermatid individualization

In order to identify genes required for caspase activation during spermatid differentiation in Drosophila, we sought to identify mutants that lacked CM1 staining, which detects the active form of the effector casepase drICE (Baker and Yu, 2001). For this purpose, we screened an existing collection of more than 1000 male-sterile mutant lines defective in spermatid individualization that were previously identified among a collection of about 6000 viable mutants generated in the laboratory of Dr Charles Zuker (Koundakjian et al, 2004; Wakimoto et al, 2004). We stained dissected testes from each line with CM1 (see Supplementary data) and identified 33 lines that were CM1-negative. However, the vast majority of male-sterile lines remained CM1-positive, even though many displayed severe defects in spermatid individualization (e.g. Figure 1F). Therefore, consistent with our earlier observations (Arama et al, 2003), caspase activation at the onset of spermatid individualization appears to be independent of other aspects of sperm differentiation, such as the assembly of the individualization complex or its movement. One of the mutants, line Z2-1091, failed to complement the sterility of bln¹, a P-element insertion in cyt-c-d, and was CM1-negative as a homozygote, in trans to a small deletion removing the cyt-c-d locus (Df(2L)Exel6039), or in trans to the cyt-c-d^bln1 allele (Figure 1C–E). In contrast, Z2-1091 complemented the lethality of K13905, a P-element insertion in cyt-c-p, and K13905 complemented the sterility of Z2-1091. Genomic sequence analyses of the transcription units of both cyt-c-d and cyt-c-p in Z2-1091 flies revealed a point mutation of TGG TGA at codon 62 in cyt-c-d, causing a change of Trp62 into a stop codon that results in a truncation of almost half of the protein (Figure 1H). We will henceforth refer to this allele as cyt-c-d^Z2-1091. Given the molecular nature of cyt-c-d^Z2-1091, it is very unlikely that this allele affects the function of genes adjacent to cyt-c-d (see below).

Figure 1.

(A–F) Mutations in cyt-c-d block caspase activation and spermatid individualization. Visualization of active drICE with anti-cleaved caspase-3 antibody (CM1; green) in wild-type (A), cyt-c-d^bln1 (B), cyt-c-d^Z2-1091 (C), cyt-c-d^Z2-1091/DF(2L)Exel6039 (D), cyt-c-d^Z2-1091/cyt-c-d^bln1 (E), and Z2-2468 (F). Whereas CM1-positive elongated spermatid cysts at different individualization stages can be readily seen in wild-type testes (A; white arrow pointing at a CB), no CM1-staining was detected in spermatids of flies homozygous for the P-element allele, bln¹ (B) and the point mutation allele, Z2-1091 (C). Similarly, spermatids of Z2-1091 flies either trans-heterozygous to the small deficiency Df(2L)Exel6039 (D) or to the bln¹ allele (E) also displayed no CM1 staining. In contrast, the vast majority of male-sterile mutants with spermatid individualization defects display strong CM1 positive cysts (e.g. Z2-2468; F). To visualize all the spermatids, the testes were counter-stained with phalloidin that binds F-actin (red). (G) Caspase-3-like (DEVDase) activity is detected in wild-type testes, and is blocked either after treatment with the caspase-3 inhibitor Z-VAD.fmk or in cyt-c-d^Z2-1091-/- mutant testes. DEVDase activity, presented as relative luminescence units (RLU), was determined on Ac-DEVD-pNA substrate in 62 wild-type (yw) or cyt-c-d^Z2-1091-/- mutant testes treated with Z-VAD or left untreated (DMSO). Readings were obtained every 2 min, and each time interval represents an average (means.e.m.) of five readings (for more details also see the Supplementary data). Note that the levels of DEVDase activity in cyt-c-d^Z2-1091-/- mutant testes are highly similar to the corresponding levels in wild-type testes that were treated with Z-VAD. (H) Alignment of the predicted protein sequences of cytochrome C-d (c-d) and cytochrome C-p (c-p). Identical residues are indicated in the consensus (cons.) line. Cytochrome C-d and cytochrome C-p share 72% identity and 82% similarity. The tryptophan (W; red) at position 62 of cytochrome C-d is mutated to a stop codon in the Z2-1091 allele. (I) RT–PCR analyses of cyt-c-d and cyt-c-p expression. After reverse transcription with adult flies RNA, PCR was performed using two sets of specific primers spanning the unique 5' (upper panel) and 3' (lower panel) UTRs of both cyt-c-d and cyt-c-p. Whereas cyt-c-d and cyt-c-p are expressed in wild-type flies (YW), only cyt-c-p is expressed in the bln¹ flies, confirming that bln¹ is a null allele of cyt-c-d.

View full figure (376 KB)

Effector caspases, such as drICE, can display DEVD cleaving activity (Fraser et al, 1997). Therefore, we asked whether wild-type adult testes also contain DEVDase activity, and whether this activity is affected in cyt-c-d mutant testes. Lysates of wild-type testes indeed display detectable levels of DEVDase activity, which were significantly reduced upon treatment with the potent DEVDase inhibitor Z-VAD.fmk (Figure 1G). Importantly, this activity was highly reduced in cyt-c-d^Z2-1091 mutant testes (Figure 1G). These results provide independent evidence for effector caspase activity in wild-type sperm, and they support a role of cytochrome C-d in caspase activation in this system.

Because of the cytological proximity between cyt-c-d and cyt-c-p (241 bp maximum between the end of the 3' UTR of cyt-c-d and the beginning of the 5' UTR of cyt-c-p) there is a possibility that the bln¹P-element insertion in cyt-c-d might also interfere with the expression of cyt-c-p (Huh et al, 2004). In order to determine whether cyt-c-p expression was altered in cyt-c-d^bln1, we performed RT–PCR analyses with RNA from wild-type (yw) and cyt-c-d^bln1 adult flies using two sets of primers for each gene specific for either the 5' UTRs (upper panel of Figure 1I) or 3' UTRs (lower panel of Figure 1I) of cyt-c-d and cyt-c-p. In agreement with our previous Northern results, no cyt-c-d RNA was detected in cyt-c-d^bln1 flies, confirming that bln¹ is a null allele of cyt-c-d. In contrast, cyt-c-p is expressed in both wild-type and cyt-c-d^bln1 flies.

Both cyt-c-d and cyt-c-p can rescue caspase activation, spermatid individualization, and the sterility of bln¹ and Z2–1091 adult males

Although the sequence of cyt-c-d and cyt-c-p proteins is highly conserved, they are not identical (Figure 1H). In addition, mutations in each gene display distinct phenotypes (Arama et al, 2003). This raises the possibility that both proteins may have distinct functions in respiration (cytochrome C-p) and caspase activation/apoptosis (cytochrome C-d). To test this hypothesis, we first asked whether expression of cyt-c-p in developing spermatids is able to substitute for the loss of cyt-c-d. In order to drive expression of transgenes in the male germ line, we constructed an expression vector composed of the hsp83 promoter followed by the 5' and 3' UTRs of cyt-c-d, which are important for the proper temporal regulation of cyt-c-d translation in spermatids (Figure 2A, I; see Supplementary data; Arama and Steller, unpublished), and next we inserted the coding regions of either cyt-c-d (Figure 2A, II) or cyt-c-p (Figure 2A, III) between both UTRs and generated transgenic flies with these constructs. At least three independent transgenic lines for each of these constructs were crossed to cyt-c-d^bln1 or cyt-c-d^Z2-1091 flies, and the presence of the appropriate transgene was confirmed by genomic PCR (Figure 2F and data not shown). To validate expression of the transgenes, we performed RT–PCR analysis with testes RNA in a cyt-c-d^bln1-/- background (Figure 2G and H). Finally, we examined the ability of these transgenes to rescue caspase activation, spermatid individualization, and male sterility in cyt-c-d^bln1 and cyt-c-d^Z2-1091 flies. As a control, transgenic flies containing 'empty vector' (including the hsp83-promotor with the 5' and 3' UTRs of cyt-c-d but without a coding region) were also generated (Figure 2A, I and G). As expected, no caspase activation was detected in testes of these control flies (Figure 2C, compare to the wild-type in Figure 2B). On the other hand, a transgene with the cyt-c-d open reading frame (ORF) fully rescued CM1-staining, spermatid individualization, and male fertility (Figure 2D, note the reappearance of cystic bulges (CBs) and waste bags (WBs), white and yellow arrows, respectively). This firmly establishes that both the caspase and sterility phenotypes seen in cyt-c-d^bln1 and cyt-c-d^Z2-1091 mutant flies are strictly due to the loss of cytochrome c function, with no detectable contribution from adjacent genes.

Figure 2.

Both cyt-c-d and cyt-c-p can rescue the male sterile phenotypes of cyt-c-d^-/- flies. (A) Schematic structure of the rescue constructs for cyt-c-d^-/- male sterile flies. The promoter region (dark blue) and a portion of the 5' UTR (light blue) of the hsp83 gene were fused to the 5' UTR followed by the 3' UTR sequences of cyt-c-d and served as a control (I). The precise coding region sequences of either cyt-c-d (II) or cyt-c-p (III) were subcloned in between the 5' and 3' UTRs. (B–E) Ectopic expression of either cyt-c-d or cyt-c-p rescues caspase activation, spermatid individualization, and sterility of cyt-c-d^bln1-/- male flies. Similar to WT (B), CM1-positive spermatids (green), CBs (white arrows), and WBs (yellow arrows) are readily detected in transgenic lines of the cyt-c-d^bln1-/- background expressing either cyt-c-d (D) or cyt-c-p (E) coding regions. In contrast, no CM1-positive cysts are found in cyt-c-d^bln1-/- flies that ectopically express the control construct of cyt-c-d 5'–3' UTRs alone (C). To visualize all the spermatids and the ICs, the testes were counter-stained with phalloidin that binds F-actin (spermatids are in weak red; ICs are in strong red or yellow and associated with CM1-positive spermatids; note that remnants of the testis sheath layer autofluoresce in strong red in B). Scale bars 200 m (B–E, upper panels), and 100 m (D, E, lower panels). (F) Integrations of the appropriate constructs into the genome were confirmed by genomic PCR analyses. The relative locations of the primers, which are indicated with forward black and reverse red (cyt-c-d; A, II) or reverse orange (cyt-c-p, A, III) arrows were used to amplify the fragments seen in the upper and middle panels in (F), respectively. For loading control, the dcp-1 gene was amplified (lower panel in F). (G, H) Transcriptional expression from the transgenes was confirmed by RT–PCR analyses on RNA from testes of the indicated genotypes. The relative locations of the primers are indicated with black arrows in (A). Representative figures demonstrating exogenous expression of cyt-c-d 5'-3' UTR sequences alone (G), and the exogenous expression of cyt-c-d coding region flanked by its UTR sequences (H). 'RT+Taq' and 'Taq' indicate reactions with reverse transcriptase or without it, respectively, to control for possible genomic DNA contamination. (H) Primers corresponding to the unique 5' and 3' UTRs of cyt-c-p and primers corresponding to the exogenous cyt-c-d sequences (see Materials and methods and black arrows in A) were used in the same reaction.

View full figure (294 KB)

We next tested the ability of cyt-c-p to functionally substitute for the loss of cyt-c-d. To our surprise, transgenic expression of cyt-c-p was equally effective in rescuing all defects in cyt-c-d^bln1 or and cyt-c-d^Z2-1091 males (Figure 2E). We conclude that both proteins have similar biochemical properties to promote caspase activation and spermatid individualization.

cyt-c-p is mainly somatic, whereas cyt-c-d is almost exclusively restricted to the male germ line

Our rescue results raise the question of why cyt-c-d^-/- males are sterile if both cytochrome c genes are functionally equivalent. One possible explanation is distinct expression of the two genes, namely that cyt-c-d is testis-specific, whereas cyt-c-p may be restricted to the soma. To examine this possibility, we investigated the distribution of transcripts from both cytochrome c genes in the testis and the soma. For this purpose, comparative RT–PCR experiments were performed using specific primers in the unique 5' and 3' UTR sequences of cyt-c-d and cyt-c-p (Figure 3A). While cyt-c-p was highly expressed in the soma, cyt-c-d was only weakly expressed there (represented by adult females that lack testes). On the other hand, cyt-c-d expression was much higher in testes than cyt-c-p (Figure 3B). We attribute the low levels of cyt-c-p in testes to the somatic cells present in this tissue (see below). Furthermore, although the expression of cyt-c-d in the soma of both males and females is much lower than the levels of cyt-c-p, cyt-c-d levels are much higher in adult males than in females, suggesting that the male germ cells provide the main contribution of cyt-c-d in the adult (Figure 3C). Our results suggest that the distinct phenotypes of cyt-c-d and cyt-c-p are mainly due to their restricted differential expression in the testis and the soma, respectively.

Figure 3.

cyt-c-d is mainly expressed in the testis, while in contrast cyt-c-p is mainly expressed in the soma. (A) Schematic structure of the Drosophila cytochrome c genes. cyt-c-d and cyt-c-p display similar genomic organization of two exons (thick black and gray bars, respectively) separated by a relatively large intron (thin bar). In both of them, the coding region is restricted to the second exon (between the ATG and the stop codons). The locations of the primers used in the comparative RT–PCR experiments in (B–E) are indicated by arrows. (B) Analysis of cyt-c-d versus cyt-c-p expression in the testis and the soma. The above primers (arrows in A) to amplify either a 543-bp cyt-c-d fragment or a 483-bp cyt-c-p fragment were added to one reaction master-mix. The reaction was stopped at different cycle points to identify the linear amplification phase (20, 25, and 30 cycles are indicated). Note that the relative expression levels of cyt-c-d (strong) and cyt-c-p (weak) in the testis are switched in the soma, which is represented by adult female flies. (C) In the soma of both males and females, the expression levels of cyt-c-d are much lower than the levels of cyt-c-p. However, cyt-c-d levels are higher in adult males than in females. Note the PCR cycle number at which a band first becomes visible. (D) The expression of cyt-c-d is restricted to the male germ cells. While the expression of cyt-c-p is not affected in sons of oskar agametic testes, no cyt-c-d expression was detected. (E) cyt-c-d is expressed in premeiotic cells comprising the larval testis but not in ovaries. (F) cyt-c-p is exclusively expressed in first instar WT larva and is almost completely absent from the cyt-c-p^k13905-/-.

View full figure (115 KB)

In addition to germ cells, the testis also contains somatic cells, such as the testicular wall, muscles cells, and cyst cells. To determine which testicular cell types express cyt-c-d, we first performed comparative RT–PCR analyses with RNA from reproductive tracts of oskar male mutants that are defective in germline development and lack germ cells in the adults. While both cytochrome c genes were expressed in wild type, only cyt-c-p was detected in the germ-cell-less reproductive tracts of sons of oskar^-/- (Figure 3D). This indicates that cyt-c-d expression is restricted to the germ cells of the adult male. Next, we investigated the developmental stage at which cyt-c-d is expressed in the male germ line. For this purpose, we took advantage of the fact that testes of adult flies and third instar larvae differ in their repertoire of germ cells. While adult testes contain germ cells in a variety of developmental stages, the most developmentally advanced germ cells present in third instar larval testes are premeiotic spermatocytes. Interestingly, the patterns of cyt-c-d expression in both adult and larval testes are identical (Figure 3E), demonstrating that cyt-c-d mRNA accumulates before the entry of spermatocytes into meiosis.

The activation of apoptotic effector caspases, as visualized by CM1-staining, is not restricted to the male germ cells but can also be detected in nurse cells during oogenesis (Peterson et al, 2003). We considered the possibility that caspase activation in this system is also influenced by cyt-c-d. However, no abnormalities during oogenesis were detected in cyt-c-d^-/- flies and the females are fertile (data not shown). Consistent with this idea, comparative RT–PCR analysis of adult ovaries revealed expression of cyt-c-p but not cyt-c-d (Figure 3E).

cyt-c-d expression is not detectable in early larva but can rescue the lethality of cyt-c-p^-/- mutant flies

l(2)k13905 flies contain a P-element insertion in the 5' UTR of cyt-c-p and die as late embryos or early first instar larva (Arama et al, 2003). Using RT–PCR, we found that only cyt-c-p expression was detected in early first instar wild-type larvae, while a dramatic reduction was observed in the cyt-c-p^k13905 mutants (Figure 3F). These results are consistent with the phenotypes of cyt-c-d (viable but male sterile) and cyt-c-p (early lethal) mutants.

Lethality of cyt-c-p^k13905 homozygotes as well as trans-heterozygotes to Df(2L)Exel6039, a deletion in the region that includes both cyt-c-p and cyt-c-d, is consistent with the idea that cyt-c-p encodes the major cytochrome C responsible for respiration (Inoue et al, 1986). We investigated whether cyt-c-d could also function in respiration and rescue the early lethality of cyt-c-p^-/- flies. Both cytochrome C proteins were ectopically expressed in cyt-c-p^k13905 mutants using the GAL4-UAS system (Brand and Perrimon, 1993). The Tub-Gal4 driver line was used to drive cyt-c-p and cyt-c-d expression throughout the lifespan of the fly. Notably, one copy of either the UAS-cyt-c-p or the UAS-cyt-c-d transgenes together with one copy of the driver completely rescued the lethality of cyt-c-p^k13905/Df(2L)Exel6039 flies (Figure 4). We conclude that both cytochrome C proteins of Drosophila can function in electron transfer/respiration. The complete absence of cyt-c-p from the rescued adult flies is consistent with the idea that cyt-c-p^k13905 is a null allele of cyt-c-p. We attribute the faint expression of cyt-c-p in cyt-c-p^k13905 homozygote and cyt-c-p^k13905/Df(2L)Exel6039 trans-heterozygote mutants detected in early first instar larvae only after 30 PCR cycles (Figure 3F and data not shown) to remnants of maternal contribution. This also explains how cyt-c-p^-/- mutant embryos can reach the early first instar larval stage without any zygotic contribution. Finally, we could not rescue the lethality of flies homozygous for the cyt-c-p^k13905 allele, suggesting that the k13905 chromosome carries an additional unrelated lethal mutation.

Figure 4.

Both cyt-c-p and cyt-c-d can completely rescue the lethality/respiration defect of cyt-c-p^-/- embryos. A premix of RT–PCR reaction was designed to amplify endogenous cyt-c-p and/or transgenic cyt-c-d from testes of wild-type (WT) or rescued cyt-c-p^-/- adult flies that express transgenic cyt-c-d under the control of the tubulin promoter (cyt-c-p^k13905/Df(2L)Exel6039; tub-Gal4/UAS-cyt-c-d). To confirm that the rescued flies are of the right genotypes, we performed RT–PCR analyses with wild-type and the rescued adult flies using specific primers for the endogenous cyt-c-p as well as the transgenic cyt-c-d. Note that the strong cytochrome c transcript expression in cyt-c-p^-/- adult flies originated from the cyt-c-d transgene.

View full figure (36 KB)

Immunoreactivity of the cytochrome C-d protein increases at the onset of spermatid individualization

To study the pattern of cytochrome C-d expression in the testis, polyclonal antibodies were raised against four peptides covering the entire length of the protein (see Supplementary data). Consistent with our findings that no cyt-c-d RNA is expressed in cyt-c-d^bln1 homozygote flies, almost no signal was detected after staining testes of this mutant with the anti-cytochrome C-d antibody (Figure 5B). Staining wild-type testes with this antibody revealed a grainy pattern of cytochrome C-d signal along the entire length of elongating spermatids and elongated spermatids (Figure 5A). Once an individualization complex (IC) was assembled in the vicinity of the nuclei, an increase in cytochrome C-d staining was detected with the highest intensity found next to the IC (arrowheads in Figure 5C). During the caudal translocation of the IC, a significant portion of cytochrome C-d is depleted from the newly individualized part of the spermatids (arrow in Figure 5C) into the CB (arrowhead in Figure 5D). Eventually, the newly formed WBs accumulate high levels of cytochrome C-d (Figure 5E).

Figure 5.

Expression of the testis-specific cytochrome C protein, cytochrome C-d, during spermatogenesis. Nuclei are stained blue (DAPI), and the ICs (which mark the sites of spermatid individualization) are either red or orange (phalloidin). (A) In wild-type testis, cytochrome C-d (green) accumulates along the length of elongating and elongated spermatids in a typical mitochondrial grainy pattern, (B) while this signal is almost abolished in cyt-c-d^bln1-/- mutant spermatids. (C) The expression of cytochrome C-d becomes more intense after the assembly of the IC with the highest expression detected in the preindividualized region of the spermatids just adjacent to the IC (arrowheads). After the caudal translocation of the IC, the remaining cytochrome C-d is highly reduced in the postindividualized part of the spermatids (white arrow). (D) As the IC progresses, the CB (arrowhead) collects the spermatids' bulk cytoplasm and much of the cytochrome C-d from the postindividualized parts of the spermatids. (E) Eventually, strong cytochrome C-d signal was detected in the WBs (arrowheads), which contain the discarded cytoplasm. (F, G) Staining cyt-c-d depleted testes (cyt-c-d^bln -/-), which ectopically express the cyt-c-p rescue construct, revealed that the antibodies raised against cytochrome C-d (polyclonal anti-cyt-C-d) can also react with cytochrome C-p. Similar to cytochrome C-d staining in wild type (A), cytochrome C-p expression (green) was detected along the entire length of elongated spermatids (F) and in the WBs (arrowheads in G). (H) The ectopically expressed cytochrome C-d is also detected in the rescued cyt-c-d^bln1-/- mutant testes (arrowhead pointing to a CB). Scale bars 20 m.

View full figure (285 KB)

To test whether this antibody could also crossreact with cytochrome C-p, we stained testes of cyt-c-d mutant lines that were rescued by transgenic cyt-c-p expression in germ cells (described in Figure 2E). Similar to the cytochrome C-d expression in wild type (Figure 5A) or after ectopic expression in mutant testes (Figures 2D and 5H), ectopic cytochrome-C-p expression was also detectable as grainy staining along the entire length of elongated spermatids (Figure 5F) as well as in CBs and WBs (arrowheads in Figure 5G). These results demonstrate that the antibody can detect both forms of the Drosophila cytochrome C molecules. The lack of staining found in cyt-c-d^bln1 elongating spermatids (Figure 5B) is consistent with the idea that only cyt-c-d and not cyt-c-p is expressed in mature spermatids.

Mutations in the Drosophila orthologues of the apoptosome components ark and dronc display severe spermatid individualization defects

In vertebrates, mitochondria play an important role in the control of apoptosis by activating the apoptosome, a multiprotein complex that includes caspase-9, Apaf-1, and cytochrome C (Rodriguez and Lazebnik, 1999; Adams and Cory, 2002; Cain et al, 2002; Salvesen and Renatus, 2002). Drosophila possesses one Apaf-1 orthologue known either as Hac-1 (Zhou et al, 1999), Dark (Rodriguez et al, 1999), or Dapaf-1 (Kanuka et al, 1999) which, like its mammalian counterpart, is important in multiple apoptotic pathways (White, 2000). In addition, Drosophila also has a caspase-9 orthologue, Dronc, which, similar to the vertebrate caspase-9, contains a caspase recruitment domain (CARD), and functions in a variety of cell death pathways (Dorstyn et al, 1999; Meier et al, 2000b; Chew et al, 2004; Daish et al, 2004; Waldhuber et al, 2005; Xu et al, 2005). We investigated whether Ark and Dronc are required for spermatid individualization. For this purpose, we examined several EMS-derived loss-of-function alleles of both ark and dronc (see Materials and methods for more details on the molecular nature of these alleles; M Srivastava and A Bergmann, manuscript in preparation; Xu et al, 2005). ark and dronc mutant flies display highly similar phenotypes and most mutant animals die during pupariation. However, some adult 'escapers' emerge that are both male and female sterile. Both ark and dronc mutants displayed severe defects during the spermatid individualization process (Figure 6). In particular, ark and dronc mutant spermatids failed to extrude much of their cytoplasm into a CB, leaving trails of the cytoplasm in what should have been the postindividualized region of the spermatids (white and yellow arrows pointing to 'cytoplasmic trails' in Figure 6B, C, H, and I). Consequently, ark^-/- and dronc^-/- CBs and WBs are highly reduced in size or appear flat (yellow arrowheads in Figure 6B and H), and frequently a large portion of the spermatids' cytoplasm is retained behind in a 'mini' CB structure (white arrowhead in Figure 6B), which often contains part of the IC (white arrowhead in Figure 6H). The size of the CBs and WBs in ark and dronc mutants is on average only half the size of their wild-type counterparts (compare Figure 6D and J with Figure 6E, F, K, and L). These phenotypes are reminiscent of testes that ectopically express the caspase inhibitor gene p35 (Arama et al, 2003). These results suggest that ark and dronc are required for normal caspase activation and the initiation of an apoptosis-like process essential for spermatid individualization. However, whereas no caspase-3-like activity was detected in cyt-c-d^-/- mutants, we could still detect some activation of caspase-3 in ark and dronc mutant testes (Figure 6B, C, H, and I). This suggests that some of the cytochrome-C-mediated caspase-3 activation is independent of apoptosome components. Alternatively, it is possible that the ark and dronc alleles used in this study are not complete nulls and therefore retain some residual function that allows a small amount of cytochrome C-induced caspase activation.

Figure 6.

Mutations in Drosophila homologues of the apoptosome complex, ark and dronc, cause spermatid individualization defects. CM1 is in green and the IC appears in red in all the panels. The direction of the caudal individualization movement is from top to bottom (A, B, C, E, F, J, K), or from left to right (D, G, H, I, L). (G, H, and I) A whole testis view. (A, G) WT CB. The extruded cytoplasm is contained within the oval-shaped CB, which is marked by CM1 staining in green (yellow arrowheads pointing at the ICs within the CBs). Importantly, CM1 staining is absent from the post-individualized portion of the spermatids (above the CB), while it is still apparent in the preindividualized portion (white arrowhead). (B, C) In ark and (H, I) dronc mutants, the CBs are frequently reduced in size or appear flat (yellow arrowhead in B and H, respectively) due to a failure in the appropriate collection of the cytoplasm of the spermatids. The retained cytoplasm is clearly visualized as a 'trail' of residual cytoplasm (marked by the green CM1 staining) along the entire length of what was supposed to have been the postindividualized portion of the spermatids (B, C and H, I; white or yellow arrows following the 'cytoplasmic trails'). Frequently, a large portion of the spermatids' cytoplasm is retained behind in 'mini' CB structures, which often contain part of the IC (white arrowheads in B, and H). Note that in wild-type testes, 'cytoplasmic trails' do not exist in the post-individualized portion of the spermatids (left to the CBs, which are indicated by yellow arrowheads in G). The surface area of the flattened advanced CBs and WBs in ark (E, and F) and dronc (K, and L) mutants were measured and compared to the wild-type counterparts (D, and J, respectively). The CBs and WBs in (F) corresponds to the ones in (C), and the WB in (E) corresponds to the WB in (B), which is marked by a yellow arrowhead, asterisks in (K and L) correspond to the asterisks in (H and I), respectively. The actual surface area appears in square micrometer next to the CBs and WBs. Note that the surface area of ark and dronc mutant WBs vary from cyst to cyst but are always highly reduced compared to wild type. Scale bars 50 m. (A, B, and C) and (G, H, and I) are displayed in the same magnification.

View full figure (351 KB)

Cytochrome C is required for caspase activation

In mammals, mitochondria are important for the regulation of apoptosis, and it has been shown that they can release several proapoptotic proteins into the cytosol in response to apoptotic stimuli (Liu et al, 1996; Green and Reed, 1998; Larisch et al, 2000; Meier et al, 2000a; Ravagnan et al, 2002; van Loo et al, 2002; Kuwana and Newmeyer, 2003). The best-studied case is the release of cytochrome C, an essential component of the respiratory chain. Cytosolic cytochrome C can bind to and activate Apaf-1, which in turn leads to the activation of caspase-9 (Wang, 2001). However, no comparable role of mitochondrial factors for caspase activation has yet been established in invertebrates. We previously reported that the elimination of cytoplasm during terminal differentiation of spermatids in Drosophila involves an apoptosis-like process that requires caspase activity, and that a P-element insertion (bln¹) in one of the two Drosophila cytochrome c genes, cyt-c-d, is associated with male-sterility and loss of effector caspase activation during spermatid individualization (Arama et al, 2003). Similar results were subsequently obtained by another group, but this study suggested that additional genes in the region may contribute to the observed phenotypes (Huh et al, 2004). Here, we demonstrate that the defects in caspase activation and spermatid individualization of bln¹ mutant males can be rescued by transgenic expression of the ORF of cyt-c-d. Furthermore, from screening more than a thousand male-sterile lines with defects in sperm individualization for defects in active-caspase (CM1) staining, we identified a nonsense point mutation in cyt-c-d, which recapitulates all the phenotypes observed for bln¹. Taken together, these results unequivocally demonstrate that cyt-c-d is necessary for effector caspase activation and sperm terminal differentiation in Drosophila.

cyt-c-p is mostly somatic and cyt-c-d is mainly restricted to the male germ cells

Two decades ago, Limbach and Wu (1985) used the mouse cytochrome c gene as a probe for screening a Drosophila genomic library and isolated a fragment that carried two distinct cytochrome c genes. Northern blot analyses indicated high levels of cyt-c-p expression, while cyt-c-d was reported to be expressed at much lower levels in all stages of development. However, neither the exon/intron organization nor the boundaries of the 5' and 3' UTRs of these genes were determined at the time (for an updated map of the genomic organization, see Arama et al, 2003). As a result, the original Northern analyses were performed with a probe corresponding to the untranscribed genomic region between the two cytochrome c genes that was not suitable to properly assess the size and distribution of cytochrome c transcripts. Unfortunately, this has caused considerable confusion in the field from the start, as even the original report noted that the size of the observed cyt-c-d transcript differed more than two-fold from the predicted size (Limbach and Wu, 1985). More recently, relying on the incorrect assumption that cyt-c-d is ubiquitously expressed in the fly, Dorstyn et al (2004) suggested that a loss-of-function mutation in cyt-c-d should lead to severe developmental defects and lethality rather than merely male sterility. However, using a specific cyt-c-d 3' UTR probe reveals a transcript of the predicted size which is absent in cyt-c-d^bln1 mutants (Arama et al, 2003). Furthermore, the RT–PCR and immunofluorescence analyses presented here indicate that cyt-c-d is mainly expressed in the male germ line and is completely absent during embryonic and larval development, while cyt-c-p is expressed in the soma during all stages of development. In light of these findings, it is not surprising that loss-of-function mutations in cyt-c-d cause male sterility, whereas cyt-c-p mutations lead to embryonic lethality. Our RT–PCR results suggest that cyt-c-p is also expressed in the testis, although to a much lower extent than cyt-c-d. We attribute this expression primarily to the somatic cells of the testis, since no cytochrome C protein was detected in cyt-c-d^bln1 elongating spermatids, while cyt-c-p RNA was shown to be expressed in cyt-c-d^bln1 mutant flies. However, the very low cyt-c-d expression detected in the soma of adult females leaves room for the possibility that cyt-c-d might function in caspase activation in some somatic cells as well.

A possible conformational change of cytochrome C-d occurs at sites of individualizing spermatids

In mammalian cells, release of cytochrome C into the cytosol in response to proapoptotic stimuli can be readily demonstrated (Von Ahsen et al, 2000; Jiang and Wang, 2004). However, previous attempts to detect a similar phenomenon in Drosophila have been unsuccessful (Zimmermann et al, 2002; Dorstyn et al, 2004). On the other hand, apoptotic stimuli can lead to increased cytochrome C immuno-reactivity (Varkey et al, 1999). A possible limitation is that all these studies were conducted using mammalian antibodies with questionable specificity and sensitivity, and only in a small number of cell types and paradigms. Using an antibody that was raised against Drosophila cytochrome C-d, we detected an increase in a 'grainy signal' upon the onset of individualization, with the highest staining observed in the vicinity of the IC. Since it is highly unlikely that additional cytochrome C-d is being transcribed and imported to the mitochondria at this late stage, we favor the explanation that a conformational change or an exposure of a hidden epitope causes the increase in the intensity of the signal. The activation of Dronc, the Drosophila caspase-9 orthologue, also occurs in association with the IC and depends on the presence of the Drosophila Apaf-1 orthologue, Ark (Huh et al, 2004). Moreover, the proapoptotic Hid protein is localized in a similar fashion (Huh et al, 2004). What are these structures then, which accumulate apoptotic factors in the vicinity of the IC? One plausible suggestion from the literature is that these structures correspond to 'mitochondrial whorls', which result from the extrusion of material from the minor mitochondrial derivative and constitute the leading component of the IC (Tokuyasu et al, 1972). These 'whorls' can be labeled using a testes-specific mitochondrial-expressed GFP line (Bazinet and Rollins, 2003; Bazinet, 2004). Using this GFP marker, we found that cytochrome C-d is indeed closely associated with mitochondrial whorls (Supplementary Figure 2). Therefore, it is possible that an active apoptosome forms in the vicinity of the IC in response to dramatic changes in the mitochondrial architecture that occur at this stage of spermatid differentiation. Similarly, studying the response of Drosophila flight muscle cells to oxygen stress, Walker and Benzer (2004) have recently reported that the cristae within individual mitochondria become locally rearranged in a pattern that they termed a 'swirl'. This process was associated with widespread apoptotic cell death in the flight muscle, which was correlated with a conformational change of cytochrome C manifested by the display of an otherwise hidden epitope. Collectively, these observations suggest that apoptosome-like complexes composed of cytochrome C-d, Ark, and Dronc might be associated with unique mitochondrial swirl-like structures. Consistent with this idea, we found that the long isoform of Ark that contains theWD40 repeats, the target for cytochrome C binding to mammalian Apaf-1, is the major form detectably expressed in testes (Supplementary Figure 3).

The fact that cytochrome C-d immunoreacitivity increases in the vicinity of the IC suggests that the extensive mitochondrial organizations preceding individualization may be partially required for caspase activation. Consistent with this idea, we isolated several mutants, such as pln^Z2-0516, which display defects in Nebenkern differentiation and caspase activation (Supplementary Figure 1). However, not all mitochondrial differentiation events are required for caspase activation. For example, CM1 staining is seen in fuzzy onions, a mutant defective in the mitochondrial fusion event that generates the Nebenkern (Arama et al, 2003). In contrast, analysis of the pln mutant indicates that proper elongation of the Nebenkern is essential for caspase activation. Therefore, characterization of other mitochondrial mutants may shed light on the connection between mitochondrial organization and caspase activation during sperm differentiation.

The Drosophila Apaf-1 and caspase-9 orthologues are required for the proper removal of the spermatid cytoplasm during the individualization process

What are the mechanisms by which cytochrome C-d activates caspases during late spermatogenesis? In vertebrate cells, following its release into the cytosol, cytochrome C binds to the WD40 domain of the adaptor molecule Apaf-1, which in turn multimerizes and recruits the initiator caspase, caspase-9 via interaction of their CARD domains. This complex, known as the apoptosome, further cleaves and activates effector caspases like caspase-3 (Shi, 2002). Although this model has become the prevailing dogma in the field, the phenotype of mice mutant for a Cyt c with drastically reduced apoptogenic function ('KA allele') suggests that the mechanisms for caspase activation may be more complex than what was previously thought (Hao et al, 2005). In particular, this study suggests that cytochrome C-independent mechanisms for the activation of Apaf-1 and caspase-9 exist, as well as cytochrome C-dependent but Apaf-1-independent mechanisms for apoptosis (Green, 2005; Hao et al, 2005). Our analyses of ark (Apaf-1) and dronc (caspase-9) loss-of-function mutants demonstrate that both genes are required for spermatid individualization, and that their phenotypes, in particular their failure to properly remove the spermatid cytoplasm into the WB, resemble cyt-c-d mutant spermatids and expression of the caspase inhibitor p35 in the testes. However, we could still detect some caspase-3-like activity in these mutant testes. This may suggest that either the ark and dronc alleles are not null, or that cytochrome C-d also functions in an apoptosome-independent pathway to promote caspase-3 activation. Therefore, the regulation of caspase activation and apoptosis may be more similar between insects and mammals than has been previously appreciated. Further genetic analysis of this pathway in Drosophila may provide general insights into diverse mechanisms of apoptosis activation.

The roles of cytochrome C-d for caspase activation and cytochrome C-p for respiration are interchangeable

Previous observations raised the possibility that the two distinct cytochrome c genes may have evolved to serve distinct functions in respiration and caspase regulation (Limbach and Wu, 1985; Inoue et al, 1986, Arama et al, 2003). In order to address this hypothesis, we asked whether expression of one protein might rescue mutations in the other cytochrome c gene. To our surprise, we found that transgenic expression of the cyt-c-p ORF in germ cells rescued caspase activation, spermatid individualization, and sterility of cyt-c-d^-/- flies. Therefore, the ability to activate caspases is not restricted to the cytochrome C-d protein, and it is possible that cytochrome C-p functions in apoptosis in at least some somatic cells.

Although cyt-c-d is almost exclusively expressed in the male germ cells, ectopic expression of this protein in the soma can rescue the respiration defect and lethality of cyt-c-p^-/- mutant flies, demonstrating that cytochrome C-d can function in energy metabolism. This raises the question whether the lack of caspase activation could be due to reduced ATP-levels. Although this is a formal possibility, we consider this explanation very unlikely since mutant spermatids complete many other energy-intensive cellular processes. These include the extensive transformation from round spermatids to 1.8 mm long elongated spermatids, a process that involves extensive remodeling and movement of actin filaments, generation of the axonemal tail, mitochondrial reorganization, plasma/axonemal membranes reorganization, and nuclear condensation and elongation. Since all of these processes can occur in the absence of cytochrome C-d, there is no overt shortage of ATP in cyt-c-d mutants. We therefore consider it very unlikely that ATP has become limiting in these mutant cells. Since earlier stage spermatids express cytochrome C-p (data not shown), sufficient ATP seems to persist to late developmental stages. In mammalian cells, cellular ATP concentration is sufficiently high (around 2 mM) to keep cultured cell alive for several days upon ATP synthase inhibition (Waterhouse et al, 2001). Furthermore, cells in which cytochrome c expression was decreased by RNAi still underwent apoptosis in response to various stimuli (Zimmermann et al, 2002). Likewise, it appears that cytochrome C is not essential for the function of mature murine sperm, since mice deficient for the testis specific form of cytochrome C, Cyt c_T, are fertile (Narisawa et al, 2002). Taken together, all these observations argue strongly against the possibility that ATP levels in cyt-c-d^-/- mutant spermatids would be insufficient for caspase activation.

In conclusion, the results presented here definitively demonstrate that cytochrome C-d is essential for caspase activation and spermatid individualization. Both cytochrome C proteins of Drosophila are, at least to some extent, functionally interchangeable. Our results also indicate that cytochrome C can promote caspase activation in the absence of a functional apoptosome. Given the powerful genetic techniques available, late spermatogenesis of Drosophila promises to be a powerful system to identify novel pathways for mitochondrial regulation of caspase activation.

Fly strains

yw flies were used as wild-type controls. The Zuker mutants Z2-1091, Z2-2468, Z2-0706, and Z2-0516 were obtained from CS Zuker (University of California at San Diego), the osk³⁰¹/TM3 and osk^CE4/TM3 lines from R Lehmann (NYU School of Medicine, NY), dj-GFP line 8B from C Bazinet (St. John's University, NY), bln¹ (blanks) and l(2)k13905 lines from the Bloomington Stock Center, and the DF(2L)Exel6039 line from Exelixis. Both dronc and ark alleles were isolated from an EMS mutagenesis screen for mutants that recessively suppressed the eye ablation phenotype caused by eye-specific overexpression of hid (Xu et al, 2005 and M Srivastava and A Bergmann, paper in preparation). ark^L46 harbors a change of a cysteine to a threonine at position 346 and a premature stop codon at position 950. ark^N28 contains a premature stop codon at position 308. The entire coding region of ark^P46 was sequenced, but no lesions were identified suggesting that it may harbor a mutation in a regulatory element (M Srivastava and A Bergmann, paper in preparation). dronc^I24 and dronc^I29 contain premature stop codons at positions 28 and 53, respectively, and dronc^L32 bears a change of a conserved leucine at position 25 in the CARD domain to glutamic acid (Xu et al, 2005).

RNA isolation and RT–PCR

Total RNA was extracted by using the Micro-to-Midi Total RNA Purification System (Invitrogen) according to the manufacturer's recommendations. The amounts of animals or organs used to obtain enough RNA for 5–10 RT–PCR reactions were 20–40 young adult testes or reproductive tracts, 40 larval testes, 10 adult females, 30 young adult ovaries, and 15 first instar larvae. The samples were collected into 1.5 ml Eppendorf tubes, standing on ice and containing 300 l of the Invitrogen kit's lysis buffer and 3 l of 2-mercapto-ethanol, homogenized using a Pellet Pestle Motor (Kontes), and subsequently purified using the same kit. In the cases when the genomic DNA had to be removed, the 30 l of the RNA was incubated with 4 l of RQ1 DNase and 3.8 l of appropriate buffer (Promega) for 1.5 h at 37°C, and subsequently purified again with the Invitrogen kit. The RNA was stored in -80°C or immediately utilized for RT–PCR reactions using the SuperScript™ III One-Step RT–PCR System with Platinum^®Taq DNA polymerase (Invitrogen). The Mastercycler Gradient PCR machine (Eppendorf) was programmed as follows: 50^°C for 30 min for the RT step followed by 94°C for 2 min, and the amplification steps of 94°C for 30 s, 60°C for 30 s, 68°C for 1 min. A master-mix was prepared and aliquoted to five tubes, each of which was amplified for 17, 20, 25, 30, or 35 cycles. Absence of genomic DNA in RNA preparations was verified by replacing the RT/Taq mix with only Taq DNA polymerase (Invitrogen). The comparative RT–PCR reactions in Figure 3 were performed using two pairs of primers in a same reaction mix: For cyt-c-d the forward primer GAACAGAATCGGCAGCGGGA and the reverse primer TCTGGATAGCATGGTGGCCG amplified a 543 bp fragment, while for cyt-c-p the forward primer GTGAAAAATCGGCGACGCTC and the reverse primer GCGTGCCGGACTGTGACTGA amplified a 483 bp fragment. For amplification of the 625 bp fragment of the transgenic UAS-cyt-c-d, the forward primer AGCAAATAAACAAGCGCAGC corresponding to a sequence from the pUASt vector, and the reverse primer CCACGACCCCGCCAAGATTT corresponding to a unique sequence in the ORF of cyt-c-d were used. For the RT–PCRs in Figure 1H, we used the following primers: GAACAGAATCGGCAGCGGGA and CCACGACCCCGCCAAGATTT for the 300 bp cyt-c-d5', and CGGTCACTCTGGTCACACTA and GACCGATCAGACCATGCAGA for the 257 bp cyt-c-p5'. For the 263 bp cyt-c-d3' the primers used were AAATCTTGGCGGGGTCGTGG and TCTGGATAGCATGGTGGCCG, and for the 323 bp cyt-c-p3' the primers TCTGCATGGTCTGATCGGTC and GTAGTTGTTGCTGCTGCTGC. For the RT–PCRs of the transgenics in Figures 2G and H, we used the forward primer GGGAGCCAACGAGAGAGCGA corresponding to a sequence from the pHSP83(5'–3'UTRs) vector and a reverse primer TCTGGATAGCATGGTGGCCG corresponding to a sequence in the cyt-c-d 3' UTR.

Antibody staining

CM1 antibody staining of young adult testes was carried out essentially as described in Arama et al (2003).

Also see online Supplementary_4 for additional Materials and methods.

We are deeply indebted to Charles Zuker for sending us their mutant collection, to Barbara Wakimoto for providing us with the annotated list of mutants, and to Maureen Cahill for collecting and shipping the stocks. We are grateful to R Lehmann, E Kurant, C Bazinet, JE Rollins, Exelixis, and the Bloomington stock center for providing additional stocks. We greatly appreciate R Cisse for her technical support in generating the transgenic lines and H Shio for technical assistance with the EM. We thank the Steller lab members for encouragement and advice, and B Mollereau, G Rieckhof, J Rodriguez, S Shaham, and A Tang for critically reading the manuscript. We acknowledge G Rieckhof and A Persaud for assisting with the screen. EA was a fellow of the Charles H Revson Foundation and HS is an investigator with the Howard Hughes Medical Institute. Part of this work was supported by NIH grant RO1 GM60124. AB receives grant support from the NIH (GM068016) and the Robert A Welch Foundation (G1496).

Abraham MC, Shaham S (2004) Death without caspases, caspases without death. Trends Cell Biol 14: 184–193 | Article | PubMed | ISI | ChemPort |

Adams JM, Cory S (2002) Apoptosomes: engines for caspase activation. Curr Opin Cell Biol 14: 715–720 | Article | PubMed | ISI | ChemPort |

Arama E, Agapite J, Steller H (2003) Caspase activity and a specific cytochrome C are required for sperm differentiation in Drosophila. Dev Cell 4: 687–697 | Article | PubMed | ISI | ChemPort |

Baehrecke EH (2002) How death shapes life during development. Nat Rev Mol Cell Biol 3: 779–787 | Article | PubMed | ISI | ChemPort |

Baker NE, Yu SY (2001) The EGF receptor defines domains of cell cycle progression and survival to regulate cell number in the developing Drosophila eye. Cell 104: 699–708 | Article | PubMed | ISI | ChemPort |

Bazinet C (2004) Endosymbiotic origins of sex. Bioessays 26: 558–566 | Article | PubMed | ISI

Bazinet C, Rollins JE (2003) Rickettsia-like mitochondrial motility in Drosophila spermiogenesis. Evol Dev 5: 379–385 | Article | PubMed | ISI

Benedict MA, Hu Y, Inohara N, Nunez G (2000) Expression and functional analysis of Apaf-1 isoforms. Extra Wd-40 repeat is required for cytochrome c binding and regulated activation of procaspase-9. J Biol Chem 275: 8461–8468 | Article | PubMed | ISI | ChemPort |

Brand AH, Perrimon N (1993) Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118: 401–415 | PubMed | ISI | ChemPort |

Cain K, Bratton SB, Cohen GM (2002) The Apaf-1 apoptosome: a large caspase-activating complex. Biochimie 84: 203–214 | Article | PubMed | ISI | ChemPort |

Chew SK, Akdemir F, Chen P, Lu WJ, Mills K, Daish T, Kumar S, Rodriguez A, Abrams JM (2004) The apical caspase dronc governs programmed and unprogrammed cell death in Drosophila. Dev Cell 7: 897–907 | Article | PubMed | ISI | ChemPort |

Daish TJ, Mills K, Kumar S (2004) Drosophila caspase DRONC is required for specific developmental cell death pathways and stress-induced apoptosis. Dev Cell 7: 909–915 | Article | PubMed | ISI | ChemPort |

Degterev A, Boyce M, Yuan J (2003) A decade of caspases. Oncogene 22: 8543–8567 | Article | PubMed | ISI | ChemPort |

Dorstyn L, Colussi PA, Quinn LM, Richardson H, Kumar S (1999) DRONC, an ecdysone-inducible Drosophila caspase. Proc Natl Acad Sci USA 96: 4307–4312 | Article | PubMed | ChemPort |

Dorstyn L, Mills K, Lazebnik Y, Kumar S (2004) The two cytochrome c species, DC3 and DC4, are not required for caspase activation and apoptosis in Drosophila cells. J Cell Biol 167: 405–410 | Article | PubMed | ISI | ChemPort |

Dorstyn L, Read S, Cakouros D, Huh JR, Hay BA, Kumar S (2002) The role of cytochrome c in caspase activation in Drosophilamelanogaster cells. J Cell Biol 156: 1089–1098 | Article | PubMed | ISI | ChemPort |

Fraser AG, McCarthy NJ, Evan GI (1997) drICE is an essential caspase required for apoptotic activity in Drosophila cells. EMBO J 16: 6192–6199 | Article | PubMed | ISI | ChemPort |

Green DR (2005) Apoptotic pathways: ten minutes to dead. Cell 121: 671–674 | Article | PubMed | ISI | ChemPort |

Green DR, Reed JC (1998) Mitochondria and apoptosis. Science 281: 1309–1312 | Article | PubMed | ISI | ChemPort |

Hao Z, Duncan GS, Chang CC, Elia A, Fang M, Wakeham A, Okada H, Calzascia T, Jang Y, You-Ten A, Yeh WC, Ohashi P, Wang X, Mak TW (2005) Specific ablation of the apoptotic functions of cytochrome c reveals a differential requirement for cytochrome c and Apaf-1 in apoptosis. Cell 121: 579–591 | Article | PubMed | ISI | ChemPort |

Hengartner MO (2000) The biochemistry of apoptosis. Nature 407: 770–776 | Article | PubMed | ISI | ChemPort |

Huh JR, Vernooy SY, Yu H, Yan N, Shi Y, Guo M, Hay BA (2004) Multiple apoptotic caspase cascades are required in nonapoptotic roles for Drosophila spermatid individualization. PLoS Biol 2: E15 | Article | PubMed | ChemPort |

Inoue S, Inoue H, Hiroyoshi T, Matsubara H, Yamanaka T (1986) Developmental variation and amino acid sequences of cytochromes c of the fruit fly Drosophilamelanogaster and the flesh fly Boettcherisca peregrina. J Biochem (Tokyo) 100: 955–965 | PubMed | ChemPort |

Jacobson MD, Weil M, Raff MC (1997) Programmed cell death in animal development. Cell 88: 347–354 | Article | PubMed | ISI | ChemPort |

Jiang X, Wang X (2004) Cytochrome C-mediated apoptosis. Annu Rev Biochem 73: 87–106 | Article | PubMed | ISI | ChemPort |

Kanuka H, Sawamoto K, Inohara N, Matsuno K, Okano H, Miura M (1999) Control of the cell death pathway by Dapaf-1, a Drosophila Apaf-1/CED-4-related caspase activator. Mol Cell 4: 757–769 | Article | PubMed | ISI | ChemPort |

Kornbluth S, White K (2005) Apoptosis in Drosophila: neither fish nor fowl (nor man, nor worm). J Cell Sci 118: 1779–1787 | Article | PubMed | ISI | ChemPort |

Koundakjian EJ, Cowan DM, Hardy RW, Becker AH (2004) The Zuker collection: a resource for the analysis of autosomal gene function in Drosophilamelanogaster. Genetics 167: 203–206 | Article | PubMed | ISI | ChemPort |

Kuwana T, Newmeyer DD (2003) Bcl-2-family proteins and the role of mitochondria in apoptosis. Curr Opin Cell Biol 15: 691–699 | Article | PubMed | ISI | ChemPort |

Larisch S, Yi Y, Lotan R, Kerner H, Eimerl S, Tony PW, Gottfried Y, Birkey RS, de Caestecker MP, Danielpour D, Book-Melamed N, Timberg R, Duckett CS, Lechleider RJ, Steller H, Orly J, Kim SJ, Roberts AB (2000) A novel mitochondrial septin-like protein, ARTS, mediates apoptosis dependent on its P-loop motif. Nat Cell Biol 2: 915–921 | Article | PubMed | ISI | ChemPort |

Limbach KJ, Wu R (1985) Characterization of two Drosophilamelanogaster cytochrome c genes and their transcripts. Nucleic Acids Res 13: 631–644 | PubMed | ISI | ChemPort |

Liu X, Kim CN, Yang J, Jemmerson R, Wang X (1996) Induction of apoptotic program in cell-free extracts: requirement for dATP and cytochrome c. Cell 86: 147–157 | Article | PubMed | ISI | ChemPort |

Meier P, Finch A, Evan G (2000a) Apoptosis in development. Nature 407: 796–801 | Article | PubMed | ISI | ChemPort |

Meier P, Silke J, Leevers SJ, Evan GI (2000b) The Drosophila caspase DRONC is regulated by DIAP1. EMBO J 19: 598–611 | Article | PubMed | ISI | ChemPort |

Narisawa S, Hecht NB, Goldberg E, Boatright KM, Reed JC, Millan JL (2002) Testis-specific cytochrome c-null mice produce functional sperm but undergo early testicular atrophy. Mol Cell Biol 22: 5554–5562 | Article | PubMed | ISI | ChemPort |

Nelson DA, White E (2004) Exploiting different ways to die. Genes Dev 18: 1223–1226 | Article | PubMed | ISI | ChemPort |

Peterson JS, Barkett M, McCall K (2003) Stage-specific regulation of caspase activity in Drosophila oogenesis. Dev Biol 260: 113–123 | Article | PubMed | ISI | ChemPort |

Ravagnan L, Roumier T, Kroemer G (2002) Mitochondria, the killer organelles and their weapons. J Cell Physiol 192: 131–137 | Article | PubMed | ISI | ChemPort |

Riedl SJ, Shi Y (2004) Molecular mechanisms of caspase regulation during apoptosis. Nat Rev Mol Cell Biol 5: 897–907 | Article | PubMed | ISI | ChemPort |

Rodriguez A, Oliver H, Zou H, Chen P, Wang X, Abrams JM (1999) Dark is a Drosophila homologue of Apaf-1/CED-4 and functions in an evolutionarily conserved death pathway. Nat Cell Biol 1: 272–279 | Article | PubMed | ISI | ChemPort |

Rodriguez J, Lazebnik Y (1999) Caspase-9 and APAF-1 form an active holoenzyme. Genes Dev 13: 3179–3184 | Article | PubMed | ISI | ChemPort |

Salvesen GS (2002) Caspases and apoptosis. Essays Biochem 38: 9–19 | PubMed | ISI | ChemPort |

Salvesen GS, Abrams JM (2004) Caspase activation—stepping on the gas or releasing the brakes? Lessons from humans and flies. Oncogene 23: 2774–2784 | Article | PubMed | ISI | ChemPort |

Salvesen GS, Renatus M (2002) Apoptosome: the seven-spoked death machine. Dev Cell 2: 256–257 | Article | PubMed | ISI | ChemPort |

Shi Y (2002) Mechanisms of caspase activation and inhibition during apoptosis. Mol Cell 9: 459–470 | Article | PubMed | ISI | ChemPort |

Slee EA, Harte MT, Kluck RM, Wolf BB, Casiano CA, Newmeyer DD, Wang HG, Reed JC, Nicholson DW, Alnemri ES, Green DR, Martin SJ (1999) Ordering the cytochrome c-initiated caspase cascade: hierarchical activation of caspases-2, -3, -6, -7, -8, and -10 in a caspase-9-dependent manner. J Cell Biol 144: 281–292 | Article | PubMed | ISI | ChemPort |

Song Z, Steller H (1999) Death by design: mechanism and control of apoptosis. Trends Cell Biol 9: M49–M52 | Article | PubMed | ISI | ChemPort |

Thompson CB (1995) Apoptosis in the pathogenesis and treatment of disease. Science 267: 1456–1462 | Article | PubMed | ISI | ChemPort |

Tokuyasu KT, Peacock WJ, Hardy RW (1972) Dynamics of spermiogenesis in Drosophila melanogaster. I. Individualization process. Z Zellforsch Mikrosk Anat 124: 479–506 | Article | PubMed | ISI | ChemPort |

van Loo G, Saelens X, van Gurp M, MacFarlane M, Martin SJ, Vandenabeele P (2002) The role of mitochondrial factors in apoptosis: a Russian roulette with more than one bullet. Cell Death Differ 9: 1031–1042 | Article | PubMed | ISI | ChemPort |

Varkey J, Chen P, Jemmerson R, Abrams JM (1999) Altered cytochrome c display precedes apoptotic cell death in Drosophila. J Cell Biol 144: 701–710 | Article | PubMed | ISI | ChemPort |

Von Ahsen O, Waterhouse NJ, Kuwana T, Newmeyer DD, Green DR (2000) The 'harmless' release of cytochrome c. Cell Death Differ 7: 1192–1199 | Article | PubMed | ISI | ChemPort |

Wakimoto BT, Lindsley DL, Herrera C (2004) Toward a comprehensive genetic analysis of male fertility in Drosophilamelanogaster. Genetics 167: 207–216 | Article | PubMed | ISI | ChemPort |

Waldhuber M, Emoto K, Petritsch C (2005) The Drosophila caspase DRONC is required for metamorphosis and cell death in response to irradiation and developmental signals. Mech Dev 122: 914–927 | Article | PubMed | ISI | ChemPort |

Walker DW, Benzer S (2004) Mitochondrial 'swirls' induced by oxygen stress and in the Drosophila mutant hyperswirl. Proc Natl Acad Sci USA 101: 10290–10295 | Article | PubMed | ChemPort |

Wang X (2001) The expanding role of mitochondria in apoptosis. Genes Dev 15: 2922–2933 | PubMed | ISI | ChemPort |

Waterhouse NJ, Goldstein JC, von AO, Schuler M, Newmeyer DD, Green DR (2001) Cytochrome c maintains mitochondrial transmembrane potential and ATP generation after outer mitochondrial membrane permeabilization during the apoptotic process. J Cell Biol 153: 319–328 | Article | PubMed | ISI | ChemPort |

White K (2000) Cell death: Drosophila Apaf-1—no longer in the (d)Ark. Curr Biol 10: R167–R169 | Article | PubMed | ISI | ChemPort |

Xu D, Li Y, Arcaro M, Lackey M, Bergmann A (2005) The CARD-carrying caspase Dronc is essential for most, but not all, developmental cell death in Drosophila. Development 132: 2125–2134 | Article | PubMed | ISI | ChemPort |

Zhou L, Song Z, Tittel J, Steller H (1999) HAC-1, a Drosophila homolog of APAF-1 and CED-4 functions in developmental and radiation-induced apoptosis. Mol Cell 4: 745–755 | Article | PubMed | ISI | ChemPort |

Zimmermann KC, Ricci JE, Droin NM, Green DR (2002) The role of ARK in stress-induced apoptosis in Drosophila cells. J Cell Biol 156: 1077–1087 | Article | PubMed | ISI | ChemPort |

Zou H, Henzel WJ, Liu X, Lutschg A, Wang X (1997) Apaf-1, a human protein homologous to C. elegans CED-4, participates in cytochrome c-dependent activation of caspase-3. Cell 90: 405–413 | Article | PubMed | ISI | ChemPort |

Main navigation

• Search EMBO Journal

  Search

• Advanced search

• The EMBO Journal

  • Home
  • Aims and scope
  • Current issue
  • Advance online publication
  • Web focuses
  • Archive:
  • Browse by issue
  • Browse by subject
  • Browse by category
  • Free online sample issue
  • Press releases

• Authors and Referees

  • Editorial process
  • Guide for authors
  • Submit an article
  • Guide for referees
  • Editors and Editorial Board
  • Contact editorial office

• Customer Service

  • Subscribe
  • Order sample copy
  • Purchase articles
  • Reprints and permissions
  • Contact NPG
  • Advertising