|
Introduction Stress-activated MAP kinase (MAPK), including p38 and JNK, regulate a variety of intracellular processes in response to environmental stresses, growth factors, cytokines, and other stimuli. p38 and JNK are activated via signaling cascades involving a MAPK kinase (MAPKK) that is responsible for phosphorylation of the appropriate MAPK, and a MAPK kinase kinase (MAPKKK or MAP3K) that phosphorylates and activates MAPKK (Davis, 2000; Kyriakis and Avruch, 2001). Recent studies have suggested a new mode of p38/JNK activation, which involves an interaction between GADD45 proteins and a MAP3K, MEKK4 (MTK1 in human) (Takekawa et al, 1997; Takekawa and Saito, 1998). GADD45 proteins include three closely related members ( , , and ) that are transcriptionally induced by environmental stress. These proteins bind MEKK4 and augment its activity. Overexpression of each individual GADD45 protein by transient transfection activates p38/JNK and causes apoptosis, which can be partially suppressed by coexpression of a dominant inhibitory MEKK4 protein. These studies suggest that GADD45 may mediate activation of the p38/JNK pathway, through MEKK4, in response to environmental stress (Takekawa and Saito, 1998).
The function of GADD45 proteins in regulating stress-activated MAPK is starting to be explored in the immune system, with the use of T helper type 1 (Th1) cells as a model system. Th1 cells produce a signature cytokine, IFN , in response to antigen receptor challenge or combined stimulation by IL12 and IL18 (Yang et al, 1999). IL12/IL18 stimulation induces high-level expression of GADD45 and GADD45 . Retroviral overexpression of GADD45 leads to sustained p38 activation and enhanced IFN production in IL12/IL18-stimulated Th1 cells (Yang et al, 2001). A study from our group has found that GADD45 is strongly induced during Th1 cell differentiation (Lu et al, 2001). Th1 effector cells deficient in GADD45 show reduced IFN production and p38/JNK activation in response to T cell receptor (TCR) stimulation. In vivo, GADD45 -/- mice exhibit suppressed contact hypersensitivity, indicative of the significance of this protein in regulating immune function (Lu et al, 2001). Recently, we have generated GADD45 -/- mice and demonstrated that GADD45 is required for MAPK activation and signaling of both antigen receptor and inflammatory cytokines in T cells (Lu et al, 2004). GADD45 proteins also appear to regulate p38/JNK outside the immune system. GADD45 function was shown to be critical for the maintenance of sustained p38/JNK activities in UV-irradiated keratinocytes, and thus represents a key component protecting the skin against UV-induced tumors (Hildesheim et al, 2002).
However, results from several other studies conflict with the notion that GADD45 proteins activate p38/JNK through MEKK4. Notably, JNK and p38 activation by genotoxic stress occurs significantly earlier than the transcriptional induction of all three GADD45 members, arguing against a role for GADD45 in activating p38/JNK (Shaulian and Karin, 1999; Wang et al, 1999). Transient overexpression of GADD45 does not cause JNK or p38 activation in several cell lines, including HeLa, NIH3T3, and COS-7 (Wang et al, 1999). In contrast, overexpression of GADD45 in 3DO T cells effectively inhibits JNK activation induced by TNF and hydrogen peroxide, whereas antisense GADD45 enhances it (De Smaele et al, 2001). Furthermore, a recent study has found that GADD45 binds p38 directly, and is capable of mediating H-Ras-induced activation of p38, but not JNK or ERK, in a pathway apparently independent of MEKK4 (Bulavin et al, 2003). The reason for the discrepancy between these studies is not clear, but is likely to reflect the multiple functions of GADD45 proteins in regulating intracellular processes. GADD45 proteins are known to interact with a number of nuclear proteins such as proliferating cell nuclear antigen (PCNA), p21, cdc2, and core histone protein (Smith et al, 1994; Kearsey et al, 1995; Carrier et al, 1999; Zhan et al, 1999), in addition to activating MEKK4 (Takekawa and Saito, 1998). Conceivably, in different cell types and/or stimulation conditions, GADD45 proteins could preferentially interact with one or several particular pathways, leading to the differential regulation of p38/JNK activities and other downstream events through distinct mechanisms.
Despite recent advances in our understanding of GADD45 and MEKK4, a critical issue to be addressed is whether GADD45 and MEKK4 are in the same genetic pathway in vivo and whether this pathway is physiologically important. Previous work using dominant-negative MEKK4 is suggestive but has obvious limitations inherent with the use of the dominative-negative approach (Takekawa et al, 1997; Takekawa and Saito, 1998; Yang et al, 2001); for example, the overexpressed MEKK4 could interfere with other pathways nonspecifically by interacting with upstream adaptors or downstream kinases not physiologically involved with MEKK4, thus making the interpretation of the results difficult. To elucidate the relationship between GADD45 and MEKK4 and the functional significance of the MEKK4-dependent pathway, we created MEKK4-deficient mice. We present here the first genetic evidence that GADD45 proteins and MEKK4 are in the same pathway in CD4 T cells. Furthermore, our study has provided new insights into the regulation and function of this important pathway during Th1 cell differentiation. Our results suggest that this pathway integrates signals from TCR and IL12/STAT4 in developing Th1 cells and promotes STAT4-independent production of IFN .
Results Generation of MEKK4-deficient mice
We created MEKK4-deficient mice by homologous recombination in embryonic stem (ES) cells. We designed a targeting vector in which a lox recombination site was inserted upstream of exon 3 in the MEKK4 gene, and a neomycin cassette (flanked by two lox sites) downstream of exon 3 (Figure 1A). Correctly targeted ES cells were screened and verified by Southern blotting, and then used for blastocyst injection. Offspring from germline chimeras were crossed with splicer female mice expressing a transgene pTet-Cre (Koni et al, 2001), which caused complete deletion of the neomycin cassette and exon 3 (Figure 1B). This exon encodes 452 aa (out of 1597) of MEKK4 protein sequence and contains the entire GADD45 binding domain. Furthermore, we anticipated that this targeting strategy would result in a frame shift and premature termination of the coding sequence downstream of exon 3 in the MEKK4 protein, including the kinase domain. Western blotting using two antibodies against the N-and C-termini of MEKK4 could not detect the expression of MEKK4 protein in MEKK4-/- T cells (Figure 1C), confirming the null mutation of MEKK4 in MEKK4-/- mice.
|
|
Discussion Previous studies have produced conflicting results concerning the relationship between GADD45 proteins and the MEKK4-mediated MAPK pathway. Using Th1 cells as a model system, we have provided the first definitive evidence that GADD45 /GADD45 and MEKK4 are in the same genetic pathway. Our conclusion is based on the following observations. First, MEKK4-/- mice had phenotypes similar to those in the GADD45 -/- and GADD45 -/- mice (Lu et al, 2001, 2004). CD4 T cells from these genetically modified mice expressed reduced levels of effector cytokine IFN accompanied by compromised activation of p38 MAPK. Second, by retroviral transduction, we demonstrated that while GADD45 and GADD45 can drive the expression of IFN in MEKK4+/+ cells, this ability is completely lost in MEKK4-/- cells, indicating that MEKK4 is downstream of GADD45 and GADD45 . Furthermore, a specific p38 inhibitor can block the IFN -promoting effect of GADD45 and GADD45 . Thus, the defective p38 activation in MEKK4-/- cells likely accounts for the inability of these cells to support GADD45 protein-induced IFN production.
It is important to note that MEKK4-/- T cells still had significant levels of p38 activity immediately after acute stimulation, suggesting the presence of an alternative pathway(s) for activating p38 in CD4 T cells. This correlates with partial inhibition of IFN in MEKK4-/- cells, as p38 inhibitor further reduced IL12-induced IFN production in MEKK4-/- cells (data not shown). MEKK4-/- T cells showed a more dramatic reduction of p38 activity at delayed time points, indicating that the major function of MEKK4 is in the maintenance of sustained p38 activation. This most likely reflects the fact that the upstream regulators of MEKK4, GADD45 and GADD45 , require transcriptional induction. Such phenomena have been observed in other systems. For example, TGF treatment of pancreatic cells and hepatocytes leads to delayed activation of p38, which is mediated by Smad-dependent expression of GADD45 (Takekawa et al, 2002; Yoo et al, 2003). Similarly, GADD45 is induced in keratinocytes exposed to UV radiation and plays an indispensable role in the late but not early phases of p38/JNK MAPK activation (Hildesheim et al, 2002). An alternative explanation is that GADD45/MEKK4 may inhibit the expression of p38 phosphatases. We have analyzed the mRNA levels by RT-PCR of three prominent p38 phosphatases, MKP1 (DUSP1), MKP5 (DUSP10), and M3/6 (DUSP8) (Camps et al, 2000; Theodosiou and Ashworth, 2002), in the MEKK4+/+ and -/- T cells. M3/6 was undetectable in either cell type, while MKP1 and MKP5 were expressed at similar levels between MEKK4+/+ and -/- cells (data not shown). Therefore, it seems unlikely that MEKK4 regulates the expression of these phosphatases.
Interestingly, MEKK4-/- T cells show a different phenotype than GADD45 -/- and GADD45 -/- cells with regard to JNK activation. While GADD45 -/- or GADD45 -/- Th1 cells display reduced activation of JNK (Lu et al, 2001, 2004), JNK activity is apparently normal in MEKK4-/- T cells. The simplest explanation is that GADD45 may regulate JNK through another related MAP3K, or more likely, an indirect mechanism. As GADD45 proteins can affect chromatin structure and interact with multiple nuclear proteins and transcription factors (Smith et al, 1994; Kearsey et al, 1995; Carrier et al, 1999; Zhan et al, 1999; Yi et al, 2000), they play an important role in affecting cell cycle progression and possibly gene expression, which in turn could lead to altered JNK activity (and other biochemical and physiological changes). Such an activity of GADD45 is unlikely to be mediated by MEKK4. The MEKK4-independent function of GADD45 offers a potential mechanism for the effect of GADD45 in inhibiting JNK activity (De Smaele et al, 2001).
Another new conclusion to arise from this study is that the MEKK4 pathway plays an important role in inducing STAT4-independent production of IFN . We have found that serine and tyrosine phosphorylation of STAT4 is unaffected by MEKK4 deficiency, and that overexpression of GADD45 induces IFN production in STAT4-/- cells. Thus, GADD45/MEKK4 represents a new pathway that may mediate STAT4-independent development of Th1 cells (Kaplan et al, 1998). Future work to identify the downstream molecules targeted by this pathway will provide novel insights into our understanding of how Th1 cells develop in a STAT4-independent manner. Candidate downstream targets of p38 regulation in T cells include transcription factors of the ATF and NFAT families (Zhang and Kaplan, 2000; Wu et al, 2003). Recently, p38-dependent phosphorylation of histone H3 has been shown to promote the recruitment of NF- B, leading to the activation of certain cytokine genes (Saccani et al, 2002). As Th1 cell development is associated with remodeling of the chromatin structure of the IFN locus (Avni et al, 2002; Fields et al, 2002), p38 may also play a significant role in this epigenetic process.
We have noted that our conclusion is in apparent conflict with earlier work indicating that serine 721 phosphorylation of STAT4 mediated by p38 is critical for IFN production and Th1 cell development (Visconti et al, 2000; Morinobu et al, 2002). However, as there is residual p38 activity in MEKK4-/- T cells, it is possible that a GADD45/MEKK4-independent pathway(s) is sufficient serine phosphorylation of STAT4. One potential candidate is Rac2, a small G protein specifically expressed in Th1 cells that has the capacity to activate p38 and induce IFN production (Li et al, 2000). It will be interesting to examine whether the function of Rac2 in this process requires the phosphorylation of STAT4.
In light of the STAT4-independent IFN production by GADD45/MEKK4, it becomes all the more intriguing to find that the expression of GADD45 and GADD45 is differentially regulated by STAT4. The GADD45 level is rapidly increased upon TCR stimulation (Lu et al, 2004), and this induction is largely independent of IL12/STAT4 signaling. In contrast, IL12/STAT4 signaling plays an essential role in the induction of GADD45 expression. Thus, despite the fact that upon overexpression, both GADD45 and GADD45 can augment IFN expression, their function in vivo may be distinct. It is likely that GADD45 mediates an early phase of IFN production induced by TCR, while GADD45 plays a role in the late stage of IFN synthesis downstream of IL12/STAT4. This proposal is consistent with a two-step T cell differentiation model (Avni and Rao, 2000; Avni et al, 2002; Fields et al, 2002): First, TCR stimulation of naive T cells initiates chromatin remodeling and transcription of IFN (and Th2 cytokine IL4), independent of the cytokine milieu. Second, IL12/STAT4 signals drive the expansion of uncommitted cells and lead to the development of Th1 effector cells. As MEKK4 is downstream of both GADD45 and GADD45 , it appears to play an important role in integrating these signals during Th1 cell differentiation (Figure 7B).
In the current study, we found that Th1 effector cells from MEKK4-/- mice exhibit a defective response to both TCR and cytokine (IL12/IL18) stimulation. This finding differs from the results reported by Yang et al (2001), which suggests that GADD45 and MEKK4 mediate only IL12/IL18-induced, but not TCR-induced IFN production. Indeed, we also found that GADD45 overexpression had no strong effect on IFN levels in effector cells restimulated with anti-CD3, which could lead to the conclusion that GADD45 proteins play no role in the TCR signaling. However, under such conditions endogenous GADD45 proteins are strongly upregulated (Lu et al, 2004) and could obscure the effect of exogenously expressed GADD45 proteins. Consistent with this notion, retroviral expression of GADD45 proteins in STAT4-/- T cells, in which expression of endogenous GADD45 proteins is reduced, resulted in significantly increased IFN production after TCR stimulation. Importantly, when the endogenous components of the GADD45/MEKK4 pathway are disrupted, as in GADD45 -/-, GADD45 -/-, and MEKK4-/- mice (Lu et al, 2001, 2004), Th1 effector cells have impaired responses to both TCR stimulation and IL12/IL18, supporting that this pathway is downstream of both TCR and IL12/IL18 in mediating effector cytokine expression.
Materials and methods Generation of MEKK4-/- mice
The mouse MEKK4 gene was isolated from a 129/SvE mouse genomic library arrayed in high-density membranes (Research Genetics), using a human MEKK4/MTK1 cDNA probe. The targeting vector contained, in order, a 4.6-kb HindIII–XbaI fragment 5' to MEKK4 exon 3, a lox recombination site, a 2.4-kb XbaI–XmnI fragment containing MEKK4 exon 3, a neomycin cassette flanked by two lox sites, and a 5.5-kb XmnI–NotI fragment 3' to exon 3 (Figure 1A). The Easy-Flox vector (a gift from Dr K Rajewsky) was used as the backbone to construct the targeting vector. The targeting vector was electroporated into TC1 ES cells, and drug-resistant clones were initially screened with Southern blot analysis of XbaI-digested DNA using a probe that is 5' to the MEKK4 genomic sequence contained in the targeting vector (data not shown). The candidate ES cell clones were expanded and verified by Southern blot analysis of NcoI-digested DNA using a probe that is 3' to the genomic sequence contained in the targeting vector (Figure 1B). Two independent targeted ES cell clones were injected into C57BL/6 blastocysts. Chimeras were bred with splicer female mice on a C57BL/6 background (Koni et al, 2001) for germline transmission and the Cre-mediated in vivo deletion of MEKK4 exon 3 and the neomycin cassette. Age- and sex-matched MEKK4+/+ and -/- mice on a mixed C57BL/6 129SvE background were used in this study.
Mouse strains
C57BL/6 and BALB/C mice were purchased from the National Cancer Institute, and STAT4-/- mice from The Jackson Laboratory.
T cell culture
CD4 T cells were isolated from spleens and lymph nodes of 6–10-week-old mice. Briefly, the CD4 T cells were first enriched by immunomagnetic negative selection using antibodies against CD8, MHC class II, and NK1.1, and magnetic beads conjugated with goat anti-mouse and anti-rat Ig (Polysciences, Inc.). Naive CD62LhighCD44lowCD4+ T cells were further purified by FACS sorting. For Th1 cell differentiation, the purified CD4 T cells were stimulated with 5 g/ml anti-CD3 (145-2C11), 2 g/ml anti-CD28 (37.5.1), 30 U/ml human IL2, 2 ng/ml IL12 (a gift from Wyeth Research), and 10 g/ml anti-IL4 (11B11) in the presence of irradiated splenocytes. After 5–6 days of T cell differentiation, live effector cells were obtained by Ficoll centrifugation and restimulated with plate-bound anti-CD3 or combined IL12 (2 ng/ml) and IL18 (20 ng/ml). CFSE labeling was performed as described elsewhere (Lyons, 2000).
Retroviral constructs and transduction
The original retroviral vector (GFP-RV) was kindly provided by Dr K Murphy (Washington University, St Louis, MO). GADD45 and GADD45 were amplified by RT–PCR and subcloned as described in Yang et al (2001). Phoenix-Eco packaging cell line was transfected using Lipofectamine 2000 (Invitrogen), and the resulting retrovirus was harvested 48 and 72 h later. Primary T cells were stimulated under Th1 conditions for 20 h before being infected with retroviral supernatants. At day 4–5, GFP-positive populations were sorted and restimulated.
Intracellular staining
Monensin (GolgiStop from Pharmingen) was added in the final 4 h of T cell activation. Cells were surface stained, fixed in 4% paraformaldehyde for 10 min, and permeablized by 0.1% saponin. The staining was performed with anti-IFN antibody (PE or APC conjugated, Pharmingen) in 0.1% saponin. Cells were washed and subjected to FACS analysis.
ELISA
Cytokine levels in tissue culture supernatants were assayed by ELISA using the antibody pair for IFN (Pharmingen) according to the manufacturer's recommendations.
Production of anti-MTK1/MEKK4 antibodies
Rabbit polyclonal anti-MTK1/MEKK4 antibodies (anti-MTK1-N and -C) were raised against GST-MTK1 fusion protein corresponding to aa 58–415 mapping at the amino terminus of human MTK1 and a synthetic peptide derived from the carboxy-terminus of MTK1 (aa 1580–1595), respectively. These regions are highly conserved between human MTK1 and mouse MEKK4 sequences. Anti-MTK1-C antibody was purified by protein A and peptide affinity chromatography.
Western blot
Aliquots of 20 g of protein extracts from T cells were separated on a SDS–PAGE gel, transferred to a polyvinylidene difluoride membrane (Millipore), and probed with anti-phospho-p38, anti-p38, anti-phospho-JNK, anti-JNK (all from Cell Signaling Technology), anti-phosphoserine-STAT4 (Santa Cruz Biotechnology), anti-phosphotyrosine-STAT4 (Zymed), anti-STAT4 (Santa Cruz Biotechnology), anti-actin (Santa Cruz Biotechnology), and anti-MTK1-N and C- antibodies.
Northern blot
RNA was isolated using the RNAeasy kit (Qiagen). RNA (2 g) was resolved on a formaldehyde gel and blotted. The probes for GADD45 and GADD45 were RT–PCR products.
Real-time PCR analysis
RNA (2 g) was reverse-transcribed by Superscript II enzyme (Invitrogen). The PCR amplification was performed in an ICycler machine (Biorad Laboratories). The primers used in the real-time PCR of IFN mRNA were GGATGCATTCATGAGTATTGC (forward) and CCTTTTCCGCTTCCTGAGG (reverse) and the probe sequence is TTTGAGGTCAACAACCCACAGGTCCA (Biosearch Technologies). The level of IFN mRNA was normalized by the amount of HPRT, which was detected with the primers CTGGTGAAAAGGACCTCTCG (forward), TGAAGTACTCATTATAGTCAAGGGCA (reverse) and probe TGTTGGATACAGGCCAGACTTTGTTGGAT.
Acknowledgements
We thank L Evangelisti and C Hughes for the technical assistance with the creation of MEKK4-/- mice, Drs E Eynon, P Fields, E Jones, M Sarkisian, and E Tran for critical reading of the paper, and R Chenell and F Manzo for secretarial assistance. This work was supported by the National Institutes of Health grant (1 P01 AI36529) and the Howard Hughes Medical Institute, and also supported in part by grants from the Ministry of Education, Culture, Sports, Science, and Technology of the Japan government (to MT and Haruo Saito, University of Tokyo). RJD and RAF are Investigators of the Howard Hughes Medical Institute. HC is supported by a postdoctoral fellowship from the Arthritis Foundation.
References
Afkarian M, Sedy JR, Yang J, Jacobson NG, Cereb N, Yang SY, Murphy TL, Murphy KM (2002) T-bet is a STAT1-induced regulator of IL-12R expression in naive CD4+ T cells. Nat Immunol 3: 549557 | Article | PubMed | ISI | ChemPort |
Avni O, Lee D, Macian F, Szabo SJ, Glimcher LH, Rao A (2002) T(H) cell differentiation is accompanied by dynamic changes in histone acetylation of cytokine genes. Nat Immunol 3: 643651 | Article | PubMed | ISI | ChemPort |
Avni O, Rao A (2000) T cell differentiation: a mechanistic view. Curr Opin Immunol 12: 654659 | Article | PubMed | ISI | ChemPort |
Bulavin DV, Kovalsky O, Hollander MC, Fornace Jr AJ (2003) Loss of oncogenic H-ras-induced cell cycle arrest and p38 mitogen-activated protein kinase activation by disruption of Gadd45a. Mol Cell Biol 23: 38593871 | Article | PubMed | ISI | ChemPort |
Camps M, Nichols A, Arkinstall S (2000) Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB J 14: 616 | PubMed | ISI | ChemPort |
Carrier F, Georgel PT, Pourquier P, Blake M, Kontny HU, Antinore MJ, Gariboldi M, Myers TG, Weinstein JN, Pommier Y, Fornace Jr AJ (1999) Gadd45, a p53-responsive stress protein, modifies DNA accessibility on damaged chromatin. Mol Cell Biol 19: 16731685 | PubMed | ISI | ChemPort |
Davis RJ (2000) Signal transduction by the JNK group of MAP kinases. Cell 103: 239252 | PubMed | ISI | ChemPort |
De Smaele E, Zazzeroni F, Papa S, Nguyen DU, Jin R, Jones J, Cong R, Franzoso G (2001) Induction of gadd45beta by NF-kappaB downregulates pro-apoptotic JNK signalling. Nature 414: 308313 | Article | PubMed | ISI | ChemPort |
Fields PE, Kim ST, Flavell RA (2002) Cutting edge: changes in histone acetylation at the IL-4 and IFN-gamma loci accompany Th1/Th2 differentiation. J Immunol 169: 647650 | PubMed | ISI | ChemPort |
Hildesheim J, Bulavin DV, Anver MR, Alvord WG, Hollander MC, Vardanian L, Fornace Jr AJ (2002) Gadd45a protects against UV irradiation-induced skin tumors, and promotes apoptosis and stress signaling via MAPK and p53. Cancer Res 62: 73057315 | PubMed | ISI | ChemPort |
Kaplan MH, Sun YL, Hoey T, Grusby MJ (1996) Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382: 174177 | Article | PubMed | ISI | ChemPort |
Kaplan MH, Wurster AL, Grusby MJ (1998) A signal transducer and activator of transcription (Stat)4-independent pathway for the development of T helper type 1 cells. J Exp Med 188: 11911196 | Article | PubMed | ISI | ChemPort |
Kearsey JM, Coates PJ, Prescott AR, Warbrick E, Hall PA (1995) Gadd45 is a nuclear cell cycle regulated protein which interacts with p21Cip1. Oncogene 11: 16751683 | PubMed | ISI | ChemPort |
Koni PA, Joshi SK, Temann UA, Olson D, Burkly L, Flavell RA (2001) Conditional vascular cell adhesion molecule 1 deletion in mice: impaired lymphocyte migration to bone marrow. J Exp Med 193: 741754 | Article | PubMed | ISI | ChemPort |
Kyriakis JM, Avruch J (2001) Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev 81: 807869 | PubMed | ISI | ChemPort |
Li B, Yu H, Zheng W, Voll R, Na S, Roberts AW, Williams DA, Davis RJ, Ghosh S, Flavell RA (2000) Role of the guanosine triphosphatase Rac2 in T helper 1 cell differentiation. Science 288: 22192222 | Article | PubMed | ISI | ChemPort |
Lu B, Ferrandino AF, Flavell RA (2004) Gadd45beta is important for perpetuating cognate and inflammatory signals in T cells. Nat Immunol 5: 3844, Epub 2003 Dec 2014.AQ | Article | PubMed | ISI | ChemPort |
Lu B, Yu H, Chow C, Li B, Zheng W, Davis RJ, Flavell RA (2001) GADD45gamma mediates the activation of the p38 and JNK MAP kinase pathways and cytokine production in effector TH1 cells. Immunity 14: 583590 | Article | PubMed | ISI | ChemPort |
Lu HT, Yang DD, Wysk M, Gatti E, Mellman I, Davis RJ, Flavell RA (1999) Defective IL-12 production in mitogen-activated protein (MAP) kinase kinase 3 (Mkk3)-deficient mice. EMBO J 18: 18451857 | Article | PubMed | ISI | ChemPort |
Lyons AB (2000) Analysing cell division in vivo and in vitro using flow cytometric measurement of CFSE dye dilution. J Immunol Methods 243: 147154 | Article | PubMed | ISI | ChemPort |
Morinobu A, Gadina M, Strober W, Visconti R, Fornace A, Montagna C, Feldman GM, Nishikomori R, O'Shea JJ (2002) STAT4 serine phosphorylation is critical for IL-12-induced IFN-gamma production but not for cell proliferation. Proc Natl Acad Sci USA 99: 1228112286 | Article | PubMed | ChemPort |
Rincon M, Enslen H, Raingeaud J, Recht M, Zapton T, Su MS, Penix LA, Davis RJ, Flavell RA (1998) Interferon-gamma expression by Th1 effector T cells mediated by the p38 MAP kinase signaling pathway. EMBO J 17: 28172829 | Article | PubMed | ISI | ChemPort |
Saccani S, Pantano S, Natoli G (2002) p38-Dependent marking of inflammatory genes for increased NF-kappa B recruitment. Nat Immunol 3: 6975 | Article | PubMed | ISI | ChemPort |
Shaulian E, Karin M (1999) Stress-induced JNK activation is independent of Gadd45 induction. J Biol Chem 274: 2959529598 | Article | PubMed | ISI | ChemPort |
Smith ML, Chen IT, Zhan Q, Bae I, Chen CY, Gilmer TM, Kastan MB, O'Connor PM, Fornace Jr AJ (1994) Interaction of the p53-regulated protein Gadd45 with proliferating cell nuclear antigen. Science 266: 13761380 | PubMed | ISI | ChemPort |
Takekawa M, Posas F, Saito H (1997) A human homolog of the yeast Ssk2/Ssk22 MAP kinase kinase kinases, MTK1, mediates stress-induced activation of the p38 and JNK pathways. EMBO J 16: 49734982 | Article | PubMed | ISI | ChemPort |
Takekawa M, Saito H (1998) A family of stress-inducible GADD45-like proteins mediate activation of the stress-responsive MTK1/MEKK4 MAPKKK. Cell 95: 521530 | PubMed | ISI | ChemPort |
Takekawa M, Tatebayashi K, Itoh F, Adachi M, Imai K, Saito H (2002) Smad-dependent GADD45beta expression mediates delayed activation of p38 MAP kinase by TGF-beta. EMBO J 21: 64736482 | Article | PubMed | ISI | ChemPort |
Theodosiou A, Ashworth A (2002) MAP kinase phosphatases. Genome Biol 3, REVIEWS3009. Epub 2002 Jun 3026AQ | Article | PubMed | ChemPort |
Thierfelder WE, van Deursen JM, Yamamoto K, Tripp RA, Sarawar SR, Carson RT, Sangster MY, Vignali DA, Doherty PC, Grosveld GC, Ihle JN (1996) Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382: 171174 | Article | PubMed | ISI | ChemPort |
Trinchieri G (1995) Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu Rev Immunol 13: 251276 | Article | PubMed | ISI | ChemPort |
Usui T, Nishikomori R, Kitani A, Strober W (2003) GATA-3 suppresses Th1 development by downregulation of Stat4 and not through effects on IL-12Rbeta2 chain or T-bet. Immunity 18: 415428 | PubMed | ISI | ChemPort |
Visconti R, Gadina M, Chiariello M, Chen EH, Stancato LF, Gutkind JS, O'Shea JJ (2000) Importance of the MKK6/p38 pathway for interleukin-12-induced STAT4 serine phosphorylation and transcriptional activity. Blood 96: 18441852 | PubMed | ISI | ChemPort |
Wang X, Gorospe M, Holbrook NJ (1999) gadd45 is not required for activation of c-Jun N-terminal kinase or p38 during acute stress. J Biol Chem 274: 2959929602 | Article | PubMed | ISI | ChemPort |
Wu CC, Hsu SC, Shih HM, Lai MZ (2003) Nuclear factor of activated T cells c is a target of p38 mitogen-activated protein kinase in T cells. Mol Cell Biol 23: 64426454 | Article | PubMed | ISI | ChemPort |
Yang J, Murphy TL, Ouyang W, Murphy KM (1999) Induction of interferon-gamma production in Th1 CD4+ T cells: evidence for two distinct pathways for promoter activation. Eur J Immunol 29: 548555 | Article | PubMed | ISI | ChemPort |
Yang J, Zhu H, Murphy TL, Ouyang W, Murphy KM (2001) IL-18-stimulated GADD45 beta required in cytokine-induced, but not TCR-induced, IFN-gamma production. Nat Immunol 2: 157164 | Article | PubMed | ISI | ChemPort |
Yi YW, Kim D, Jung N, Hong SS, Lee HS, Bae I (2000) Gadd45 family proteins are coactivators of nuclear hormone receptors. Biochem Biophys Res Commun 272: 193198 | Article | PubMed | ISI | ChemPort |
Yoo J, Ghiassi M, Jirmanova L, Balliet AG, Hoffman B, Fornace Jr AJ, Liebermann DA, Bottinger EP, Roberts AB (2003) Transforming growth factor-beta-induced apoptosis is mediated by Smad-dependent expression of GADD45b through p38 activation. J Biol Chem 278: 4300143007 | Article | PubMed | ISI | ChemPort |
Zhan Q, Antinore MJ, Wang XW, Carrier F, Smith ML, Harris CC, Fornace Jr AJ (1999) Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene 18: 28922900 | Article | PubMed | ISI | ChemPort |
Zhang S, Kaplan MH (2000) The p38 mitogen-activated protein kinase is required for IL-12-induced IFN-gamma expression. J Immunol 165: 13741380 | PubMed | ISI | ChemPort |
|