The EMBO Journal
 
Advanced search
Journal home
Current issue
Advance Online Publication
Web Focuses
Archive
Browse by subject
Free online sample issue
Aims and scope
Press releases
ToC by email
Authors & Referees
Guide for authors
Submit an Article
Guide for referees
Editorial Team, Senior Advisors and Advisory Editorial Board
Contact Editorial office
Customer services
Subscribe
Order sample copy
Purchase articles
Reprints and permissions
Contact NPG
Advertising
EMBO
www.embo.org
Article
Subject Categories: Chromatin & Transcription | Immunology
The EMBO Journal (2002) 21, 2220–2230, doi: 10.1093/emboj/21.9.2220
Spi-B can functionally replace PU.1 in myeloid but not lymphoid development
Richard Dahl1, 2, 4, Diana L. Ramirez-Bergeron1, 2, 4, Sridhar Rao3 and M.Celeste Simon1, 2
1 Abramson Family Cancer Research Institute, Philadelphia, PA 19104, USA
2 Howard Hughes Medical Institute, University of Pennsylvania, School of Medicine, Philadelphia, PA 19104, USA
3 Department of Pathology, University of Chicago, Chicago, IL 60637, USA
4 R.Dahl and D.L.Ramirez-Bergeron contributed equally to this work

To whom correspondence should be addressed
M.Celeste Simon, celeste2@mail.med.upenn.edu

Received 25 June 2001; Revised 1 February 2002; Accepted 5 March 2002.
Abstract
Mature macrophages, neutrophils and lymphoid cells do not develop in PU.1-/- mice. In contrast, mice lacking the highly related protein Spi-B generate all hematopoietic lineages but display a B-cell receptor signaling defect. These distinct phenotypes could result from functional differences between PU.1 and Spi-B or their unique temporal and tissue-specific expression (PU.1: myeloid and B cells; Spi-B: B cells only). To address this question, we introduced the Spi-B cDNA into the murine PU.1 locus by homologous recombination. In the absence of PU.1, Spi-B rescued macrophage and granulocyte development when assayed by in vitro differentiation of embryonic stem cells. Adherent, CD11b+/F4/80+ cells capable of phagocytosis were detected in PU.1Spi-B/Spi-B embryoid bodies, and myeloid colonies were present in hematopoietic progenitor assays. Despite its ability to rescue myeloid differentiation, Spi-B did not rescue lymphoid development in a RAG-2-/- complementation assay. These results demonstrate an important difference between PU.1 and Spi-B. Careful comparison of these Ets factors will delineate important functional domains of PU.1 involved in lymphocyte lineage commitment and/or maturation.
Keywords: hematopoiesis, PU.1, Spi-B

Introduction

The Ets family of DNA-binding proteins is a highly conserved group of transcriptional regulators with important developmental functions in all metazoans examined (Graves and Petersen, 1998). All family members share sequence conservation in their DNA-binding domains (the Ets domain). The Spi transcription factors, PU.1 (Spi-1), Spi-B, Spi-C and Spi-D, represent a divergent subfamily of Ets transcription factors only identified in vertebrates thus far. Their expression appears to be restricted to the hematopoietic lineages. PU.1 is expressed predominantly in granulocytes, macrophages and B cells, with low levels detected in early T cells and erythrocytes (Klemsz et al., 1990; Galson et al., 1993; Hromas et al., 1993; Chen et al., 1995). Spi-B is detected in early thymocytes and B cells (Su et al., 1996; Anderson et al., 1999). Spi-C is expressed predominantly in B cells, with some expression in myeloid cells (Bemark et al., 1999; Hashimoto et al., 1999). Lastly, Spi-D has been identified recently in Xenopus laevis and Raja eglanteria (skate), but tissue-specific expression has not yet been characterized (Shintani et al., 2000; Anderson et al., 2001). Within the subfamily, PU.1, Spi-B and Spi-D are more related to each other than to Spi-C. Along with sequence conservation in the Ets DNA-binding domain, PU.1, Spi-B and Spi-D share a conserved PEST domain which contains a critical phosphorylation site required for interaction with IRF family members PIP and ICSBP (Eisenbeis et al., 1995; Brass et al., 1996). PU.1 differs from Spi-B and Spi-D at the N-terminus, exhibiting a divergent transactivation domain (Rao et al., 1999b) that includes a glutamine-rich region essential for the generation of myeloid cells (Fisher et al., 1998).

We have engineered targeted deletions of PU.1 and Spi-B genes in mice that yield surprisingly different phenotypes. Two independent lines of PU.1-/- mice have been generated and each exhibits severe hematopoietic defects (Scott et al., 1994; McKercher et al., 1996). Neither mutant develops fetal macrophages, granulocytes or B lymphocytes. PU.1-/- mice generated by Scott et al. die at day 18.5 of gestation precluding an examination of postnatal hematopoiesis. In contrast, the PU.1-/- mice generated by McKercher et al. survive to birth and live up to 3 weeks if maintained on antibiotics. T lymphocytes and immature, non-functional granulocytic cells are detected in such mice. However, there was no evidence of definitive macrophage and B-lymphocyte development.

Deletion of Spi-B results in a milder defect (Su et al., 1997). Spi-B-/- mice are viable and although all hematopoietic lineages are present, B lymphocytes are functionally compromised. Cross-linking of the B-cell antigen receptor (BCR) results in reduced B-lymphocyte proliferation, increased apoptosis and reduced phosphorylation of downstream substrates (Garrett-Sinha et al., 1999). When challenged with a T-dependent antigen, antibody production is diminished and splenic germinal centers develop poorly. Since Spi-B and PU.1 are co-expressed in B lymphocytes, these two mutant strains were crossed to look for potential redundancy. The PU.1 mutation used in this study is lethal, so PU.1+/-Spi-B-/- mice were examined. Compound mutant mice are more defective in BCR-mediated signaling and germinal center formation than the Spi-B-/- animals. These results demonstrate functional overlap and/or a genetic interaction between PU.1 and Spi-B (Garrett-Sinha et al., 1999). Similar crosses with non-Spi subfamily members, Ets-1 and Elf-1, did not reveal any redundancy or genetic interactions with PU.1 or Spi-B (Garrett-Sinha et al., 2001).

To address directly the question of functional redundancy between Ets family members, we introduced Spi-B or Ets-1 cDNAs into the PU.1 locus via gene targeting. This approach allows a stringent determination of whether either factor can functionally replace PU.1. We report here that Spi-B, but not Ets-1, can rescue myelopoiesis (granulocyte and macrophage development). Interestingly, Spi-B could not replace PU.1 during lymphopoiesis. The inability of Spi-B to rescue lymphocyte development supports the conclusion that PU.1 has unique functional abilities that cannot be performed by Spi-B.

Results

Generation of homozygous knock-in clones

To investigate further the redundancy of PU.1 and Spi-B, we directly tested the ability of Spi-B to carry out the activities of PU.1 in hematopoiesis. The domain structure of these two factors is very similar (see Figure 1), sharing conserved Ets DNA-binding and PEST domains. The PEST region is involved in protein−protein interactions. We also tested the ability of the highly divergent Ets-1 protein to substitute for PU.1, in case hematopoietic development requires an Ets family member and not specifically a Spi factor. Embryonic stem (ES) cell clones expressing Spi-B or Ets-1 in place of PU.1 were generated using a targeting vector that deletes approx1 kb of genomic sequence from the SacI site of exon 1 to a downstream intronic BamHI site (Figure 2A). The non-coding sequence of exon 1 is retained up to the initiating methionine. Murine PU.1, human Spi-B or human Ets-1 cDNA was inserted into the SacI site 6 bp upstream of the endogenous PU.1 initiating methionine. These constructs along with a 'knock-out' construct (no cDNA included) were introduced into RW4 ES cells. Either PU.1, Spi-B or Ets-1 cDNA and/or a PGK-Neo expression cassette replace the deleted genomic sequence. LoxP sites surround the PGK::Neo cassette to allow for Cre-mediated excision. Heterozygous cells were detected by Southern blot assay and were recloned in increasing concentrations of G418 to select for homozygous mutant clones.

Figure 1
Figure 1
Comparison of functional domains between PU.1, Spi-B and Ets-1.
Figure 2
Figure 2
Generation of homozygous knock-in ES cell clones. (A) Schematic representation of the targeting strategy. (B) RT−PCR of RNA isolated from in vitro differentiated heterozygous knock-in clones. Primers correspond to the 5' prime epitope tag and the 3' prime polyadenylation sequences. Forty cycles of PCR were used to amplify target cDNAs. (C) Western blot of protein isolated from clone 13, U937 and splenic PU.1+/Spi-B cells. A total of 500 000 cell equivalents were loaded per lane. The blot was first probed with anti-human Spi-B antibody (Su et al., 1996) and subsequently reprobed with anti-PU.1 antibody (Santa Cruz Biotechnology). (D) RT−PCR of RNA isolated from splenic B cells. The B-cell preparation was >95% CD19+/B200+ as determined by FACS analysis. Amplification of cDNA was performed as previously stated. (E) Western blot of lysates prepared from splenic B cells. Approximately 150 mug of total cellular protein was loaded per well. The human Spi-B (h-Spi-B) antibody does not recognize murine Spi-B. The blot was first probed with anti-hSpiB and subsequently reprobed with anti-PU.1 and anti-CREB. CREB expression is shown to demonstrate approximately equivalent loading of cell lysate. The asterisk denotes a non-specific immunoreactive band.

To determine if the inserted cDNAs were being expressed, heterozygous ES cell clones were differentiated in vitro under conditions that promote hematopoietic development. After 11 days of culture, embryoid body (EB) RNA was assayed for cDNA expression by RT−PCR. Appropriate size PCR fragments were detected in EB RNA prepared from the three knock-in clones, but no product was amplified in wild-type EBs (Figure 2B) or control PCRs of RNA samples not reverse transcribed (data not shown). To confirm further that the targeting strategy results in expression of the inserted cDNA, PU.1+/Spi-B mice generated from targeted ES cells were examined for Spi-B expression by western blot. A Spi-B immunoreactive band detected in PU.1+/Spi-B splenic cell extract co-migrated with human Spi-B (hSpi-B) in clone 13 human B cells (Figure 2C). As expected, no Spi-B immunoreactivity was detected in U937 myeloid cells. Importantly, this antibody is specific for hSpi-B (Su et al., 1996) and exclusively binds Spi-B expressed from the murine PU.1 locus. Since both the EBs and the spleen predominantly contain myeloid cells, we also isolated splenic B cells from PU.1+/Spi-B mice to assay Spi-B expression. The isolated cells were approx95% CD19+/B220+ (data not shown). RT−PCR using the same primers from Figure 2B detected expression of the knocked-in hSpi-B allele (Figure 2D), and hSpi-B protein was detected from PU.1+/Spi-B, but not PU.1+/- B cells (Figure 2E). These results (Figure 2B−E) demonstrate that our targeting strategy results in expression of the inserted cDNA. Lastly, no PU.1 protein was detected in EBs derived from PU.1-/-, PU.1Ets-1/Ets-1 or PU.1Spi-B/Spi-B ES cells (data not shown). In all assays, the new knock-out allele behaves identically to our previous null allele (Scott et al., 1994; Olson et al., 1995). Therefore, phenotypes resulting from the knocked-in alleles are due to each expressed cDNA and not to residual PU.1 protein expression.

Spi-B, but not Ets-1, can replace PU.1 function to generate macrophages in vitro

PU.1+/+, PU.1-/-, PU.1PU.1/PU.1, PU.1Ets-1/Ets-1 and PU.1Spi-B/Spi-B ES cells were differentiated in vitro in methylcellulose containing hematopoietic cytokines [stem cell factor (SCF), interleukin (IL)-1, IL-3, granulocyte−macrophage colony-stimulating factor (GM-CSF) and erythropoietin]. After 11−16 days of incubation, cultures were assayed for the presence of macrophages. EBs were evaluated by cell morphology and immunohistochemical detection of the myeloid markers F4/80 and CD11b. Figure 3A, D, G, J and M depicts cytospin preparations of in vitro differentiated EBs. Only PU.1PU.1/PU.1 and PU.1Spi-B/Spi-B EBs produced cells morphologically similar to macrophages derived from PU.1+/+ EBs.

Figure 3
Figure 3
Identification of macrophages by histological and immunocytochemical staining. (A, D, G, J and M) May−Grunwald−Giemsa staining of cytocentrifuged day 11−16 EBs. (B, E, H, K and N) Adherent cells harvested from day 11−16 trypsinized EBs and stained with antibody to F4/80. (C, F, I, L and O) Adherent cells stained with antibody to CD11b. Blue staining indicates the presence of antigen. Magnification = 400times.

To confirm that macrophages were produced, cells derived from 11- to 16-day EBs were plated overnight and adherent cells stained with antibodies to the myeloid-specific markers F4/80 and CD11b. Consistent with the morphological evaluation, only the PU.1 knock-in (Figure 3H) and Spi-B knock-in (Figure 3N) cultures contained adherent cells positive for F4/80, denoted by cell-associated blue staining. These same cultures were also CD11b+ (Figure 3I and O). No F4/80 or CD11b staining was detected in cultures derived from the PU.1-/- or PU.1Ets-1/Ets-1 ES cells (Figure 3E, F, K and L). Furthermore, these results were consistent amongst multiple independent PU.1-/-, PU.1PU.1P/PU.1, PU.1Ets-1/Ets-1 and PU.1Spi-B/Spi-B clones analyzed. In addition, removal of the neoR cassette by Cre-mediated excision did not change the observed phenotypes (data not shown).

Along with immunohistochemical analysis, EB-derived adherent cells were examined for their ability to phagocytose fluorescent zymosan particles. NIH 3T3 cells were plated as a negative control. Cells were incubated with opsonized fluorescein isothiocyanate (FITC)−zymosan particles for 30 min at 37°C. After incubation, cells were washed several times to remove non-phagocytosed particles. No cell-associated fluorescence was observed with NIH 3T3 cells (Figure 4A and B) and very little fluorescence was associated with PU.1-/- cells (Figure 4E and F). Fluorescent particles were highly associated with cells from PU.1+/+, PU.1PU.1/PU.1 and PU.1Spi-B/Spi-B cultures, indicating that these cells were capable of phagocytosis (Figure 4C, D, G, H, I and J). From the EB analysis, we conclude that Spi-B can replace PU.1 in generating macrophages and that these cells are functionally competent for both adherence and phagocytosis.

Figure 4
Figure 4
Phagocytosis of opsonized zymosan. Adherent cells harvested from day 11−16 trypsinized EBs were incubated with opsonized fluorescein-labeled zymosan particles for 30 min at 37°C. Cells were washed in PBS and fixed in 3.7% formaldehyde. Photographs show differential interference contrast (DIC) and corresponding fluorescent images.

PU.1Spi-B/Spi-B ES cells partially rescue granulocytic development in vitro

Primary differentiation of ES cells into EBs demonstrated that Spi-B, but not Ets-1, rescued macrophage development but did not address whether Ets-1 or Spi-B generated granulocytic cells. To assess granulocytic differentiation, primary EB cultures were replated into hematopoietic cytokine-rich media (SCF, IL-3, IL-6 and erythropoietin) and cultured for an additional 5−7 days in standard colony-forming assays that allow quantitative assessment of hematopoietic progenitors. Along with analysis of granulocytic development, the increased sensitivity of progenitor assays also potentially could reveal the ability of Ets-1 to generate macrophages.

Unexpectedly, myeloid (macrophage and granulocyte) colonies were detected in all cultures (Figure 5). However, the number of CFU-M and the cells per colony in PU.1-/- and PU.1Ets-1/Ets-1 cultures were greatly reduced compared with PU.1+/+ and PU.1Spi-B/Spi-B cultures. Furthermore, only wild-type and Spi-B knock-in colonies contained mature macrophages when examined by cytocentrifugation and histochemical staining. A representative cell from each genotype is shown in Figure 6A. Although the cells from PU.1-/- and PU.1Ets-1/Ets-1 cultures may be of myeloid origin, they clearly do not resemble mature macrophages and do not express macrophage-specific genes. RT−PCR analysis performed on RNA derived from the clonogenic cultures revealed that all genotypes expressed CD18, consistent with previous results with PU.1-/- ES cells (Olson et al., 1995). However, only PU.1+/+ and PU.1Spi-B/Spi-B clones expressed high levels of CD11b and macrophage colony-stimulating factor (M-CSF) receptor transcripts (Figure 6B).

Figure 5
Figure 5
Hematopoietic colony formation. Single-cell suspensions from day 9−11 EBs were plated into a hematopoietic cytokine-rich methylcellulose medium (Methocult 3434, Stem Cell Technologies) and allowed to differentiate. Hematopoietic colonies were scored after 5−7 days of differentiation. A 'delta' denotes that these colonies after further examination are not mature myeloid colonies. Each genotype was assayed in triplicate and the error bars represent standard deviation from the mean percentage of colonies.
Figure 6
Figure 6
Examination of macrophage colonies. (A) Macrophage colonies from each genotype were isolated from methylcellulose cultures, cytocentrifuged onto glass slides and stained with May−Grunwald−Giemsa. Magnification = 1000times. (B) RNA was isolated from hematopoietic cultures and subjected to RT−PCR analysis. Cultures derived from two independent clones of PU.1Ets-1/Ets-1 and PU.1Spi-B/Spi-B ES cells were used. Primer pairs specific for M-CSFR, CD11b or CD18 did not generate appropriate size fragments when genomic DNA was used as the template (data not shown).

Although the morphology of PU.1-/- and PU.1Ets-1/Ets-1 granulocyte colonies (CFU-G) appeared grossly normal, histological staining of cytospin preparations revealed differences between colonies derived from these genotypes and PU.1+/+ CFU-G. Furthermore, PU.1Ets-1/Ets-1 granulocytic cells were identical to those from PU.1-/- cultures (Figure 7A). Phenotypically, PU.1Ets-1/Ets-1 and PU.1-/- CFU-G appeared to be immature granulocytes: the cytoplasm retained a dark purple color indicating a basic pH, and the majority of nuclei were not segmented. This result differs from our previous studies of PU.1-/- yolk sac and fetal liver hematopoiesis in which no myeloid colonies were detected (Scott et al., 1994; Olson et al., 1995). However, the morphology appears to be similar to that of neutrophils isolated from PU.1-/- animals generated by McKercher et al. (Anderson et al., 1998) and to granulocytic cells produced by a hematopoietic cell line derived from our PU.1-/- mice (DeKoter et al., 1998). In contrast, PU.1Spi-B/Spi-B granulocytes more closely resembled those isolated from wild-type and PU.1 knock-in cultures: the nuclei were clearly segmented and the cytoplasm was less basic (Figure 7A). The morphologies of PU.1+/+ and PU.1Spi-B/Spi-B cells were not identical, but clearly Spi-B had an effect on the differentiation of granulocytic cells.

Figure 7
Figure 7
Examination of granulocyte colonies. (A) Granulocyte colonies from each genotype were isolated from methylcellulose cultures, cytocentrifuged onto glass slides and stained with May−Grunwald−Giemsa. Magnification = 1000times. (B) Cytospin preparations were stained for MPO activity using a diagnostic kit (Sigma). Dark brown staining indicates the presence of MPO activity. Magnification = 200times. (C) RNA isolated from entire hematopoietic cultures was subjected to RT−PCR analysis. Cultures derived from two independent clones of PU.1+/-, PU.1Et-1/Ets-1 and PU.1Spi-B/Spi-B ES cells were used. For the upper two panels (MPO and HPRT), RNA prepared from one PU.1+/+ culture was used instead of two PU.1+/- cultures. Primer pairs specific for MPO, lysozyme, lactoferrin, C/EBPepsilon and HPRT did not generate the predicted fragment when genomic DNA and/or mock reverse-transcribed RNA was used as the template (data not shown).

In addition to cellular morphology, we examined the hematopoietic colony assays for expression of granulocyte-specific genes using RT−PCR. RNA was prepared from an entire 30 mm plate containing colonies of several hematopoietic lineages. Granulocytic cells from PU.1-/- mice were shown previously to express myeloperoxidase (MPO), but not lysozyme and secondary granule genes such as lactoferrin (Anderson et al., 1998). We assayed our cultures for the expression of MPO, lysozyme, lactoferrin, gelatinase B and CCAAT/enhancer-binding protein epsilon (C/EBPepsilon). C/EBPepsilon is expressed late in granulocytic differentiation, and the phenotype of C/EBPepsilon-/- neutrophils is similar to that of PU.1-/- (Morosetti et al., 1997; Yamanaka et al., 1997a,b); however, its expression had not been assayed previously in PU.1 null cells. As expected, MPO expression was detected in cultures of all genotypes (Figure 7C). Some variability in expression was seen which may be due to different numbers of granulocytes present in each culture and not necessarily due to decreased expression in individual granulocytic cells. We also examined MPO protein activity using an enzymatic assay. MPO activity mirrored gene expression data as PU.1-/- cells were marginally positive but much more MPO activity was detected in the PU.1+/+ cells, as indicated by the increase in dark brown staining (Figure 7B). An intermediate level of MPO activity was detected in PU.1Spi-B/Spi-B cells. To our surprise, C/EBPepsilon transcripts could be detected in cells of all genotypes, including PU.1-/- (Figure 7C). In contrast, it was difficult to amplify gelatinase B even in PU.1+/- cultures (data not shown). Therefore, C/EBPepsilon and gelatinase B expression could not be used as an indicator of rescue. Conversely, lysozyme expression was seen consistently in PU.1+/- cultures (Figure 7C) but not PU.1-/- cultures as reported by Anderson et al. (1998). Importantly, lysozyme was detected in both PU.1Spi-B/Spi-B clones examined, but not in either PU.1Ets-1/Ets-1 clone (Figure 7C). This result is striking since more CFU-G colonies are produced by PU.1-/- and PU.1Ets-1/Ets-1 cultures (see Figure 5). Lastly, we examined the expression of lactoferrin. Lactoferrin mRNA was clearly detected in PU.1+/- cultures, but only very faint PCR products were amplified in RNA prepared from the other genotypes (Figure 7C). Therefore, based on morphology, MPO activity and lysozyme expression data, we conclude that Spi-B partially rescues the PU.1-/- defect in granulocytic development. However, the lack of lactoferrin expression in PU.1Spi-B/Spi-B neutrophils suggests that this rescue of phenotype is incomplete.

Spi-B cannot replace PU.1 in the generation of lymphocytes

PU.1 is essential for the development of both the myeloid and lymphoid lineages (Scott et al., 1994; McKercher et al., 1996). Since Spi-B could substitute for PU.1 in the generation of myeloid lineages, we wanted to test whether Spi-B could also replace PU.1 in the production of lymphocytes. We assessed the ability of PU.1Spi-B/Spi-B cells to differentiate into lymphoid cells using the RAG-2-/- blastocyst complementation assay (Chen et al., 1993). PU.1Spi-B/Spi-B, PU.1-/- and PU.1+/- ES cells were injected into blastocysts obtained from RAG-2-/- mice. The resultant chimeras were then assayed for the presence of B and T lymphocytes. The RAG-2 mutation blocks lymphoid development at the pro-B- and pro-T-cell stage; therefore, any mature lymphocytes detected in chimeric mice must be of donor ES cell origin.

PU.1+/- but not PU.1-/- cells were able to generate IgM+/B220+ cells in the spleen. As shown previously by flow cytometry in C57BL/6 chimeric mice (Scott et al., 1997), PU.1-/- cells were unable to contribute to either T- or B-cell populations in RAG-2-/- chimeras. However, PU.1+/- ES cells rescued both B- and T-cell development in RAG-2-/- mice (Figure 8). B220+/IgM+ cells were detected in the bone marrow of PU.1+/- chimeras. Furthermore, B cells exited to the periphery and engrafted the spleen as both B220+/IgM+ and IgM+/IgD+ cells. T cells engrafted the thymus as CD4+/CD8+ double-positive (DP) cells and CD4+ or CD8+ single-positive (SP) cells. Furthermore, SP T cells were detected in the spleen of chimeric mice.

Figure 8
Figure 8
Analysis of potential lymphoid rescue of RAG-2-/- mice. (A and B) PU.1Spi-B/Spi-B, PU.1+/-or PU.1-/- ES cells were injected into RAG-2-/- blastocysts to produce control and experimental chimeras. Flow cytometric analysis of blood cell lineages within various tissues of chimeric mice was performed. This figure represents chimeric mice analyzed at 8 weeks of age. (A) Analysis of B220/IgM and IgM/IgD staining revealed no contribution to B-cell populations by PU.1Spi-B/Spi-B or PU.1-/- ES cells, while PU.1+/- contributed significantly to both bone marrow and splenic B cells. (B) Analysis of CD4/CD8 staining showed no contribution to either immature DP or mature SP T cells in the thymus or spleen of PU.1Spi-B/Spi-B or PU.1-/- chimeras, while PU.1+/- contributed to all populations.

In direct contrast, no B220+/IgM+, CD4+ or CD8+ cells were detected in the various hematopoietic organs of any PU.1Spi-B/Spi-B chimera (n = 17; Figure 8). Two independent ES cell clones, one with the neo cassette removed, were tested, and chimerism ranged from 5 to 60% as judged by coat color (Table I). Surprisingly, significant lethality was observed in chimeric mice, with ES cell contributions ranging from 15 to 60% by both clones. Because various chimeric offspring appeared sickly at an early age, some mice were analyzed for lymphoid production at 2 or 4 weeks after birth. No chimeras analyzed at either 2, 4 or 8 weeks of age exhibited differentiated lymphoid cells. It is also noteworthy that multiple hematopoietic organs (e.g. bone marrow and spleen) exhibited a strong PU.1Spi-B/Spi-B ES cell contribution based on Southern blot assay (data not shown), but no mature lymphocytes were detected.

Table 1
Table 1
RAG-2-/- chimerism

Regulation of lymphoid genes by Spi-B

We hypothesize that Spi-B cannot replace PU.1 in B-cell development due to an inability to regulate PU.1-dependent B-cell genes. We have shown previously that Spi-B binds poorly to PU.1 sites in the Ig J chain promoter, Igkappa 3' enhancer and Iglambda2-4 enhancer compared with PU.1 by gel shift analysis (Su et al., 1996; Rao et al., 1999b). We chose to examine the ability of Spi-B to transactivate reporter constructs containing the Igkappa 3' enhancer. The kappa light chain is expressed in approx80% of murine B cells. PU.1 has been shown to cooperate with AP-1 and PIP to regulate the core Igkappa 3' enhancer in NIH-3T3 cells where the enhancer normally is silent (Pongubala and Atchison, 1997). We showed that PU.1 augments enhancer activity 6- to 7-fold over that induced by AP-1 and PIP alone (Figure 9). In direct contrast, Spi-B stimulated the Igkappa enhancer by only 2- to 3-fold. Furthermore, other PU.1-regulated B-cell genes, such as P2Y10 and c-rel, are transactivated weakly by Spi-B compared with PU.1 (Rao et al., 1999a; Hu et al., 2001). These results suggest that Spi-B is incapable of replacing PU.1 in B-cell development because it is does not have sufficient activity to regulate properly the critical lymphoid genes required for B-cell maturation.

Figure 9
Figure 9
Spi-B weakly transactivates the 3' kappa light chain enhancer. NIH 3T3 cells were transfected with the CoreLBKCAT and pGL2 control reporter plasmids along with plasmids expressing c-Jun, c-Fos and PIP. PU.1 and Spi-B expression plasmids were included in the transfections as indicated in the figure. Fold induction of CAT activity is relative to the transfection without PU.1 or Spi-B and is normalized to relative luciferase activity. Values obtained are an average of three independent transfections. Error bars represent standard deviations from the mean.

Discussion

The Spi subfamily of Ets transcription factors is essential for normal hematopoiesis (Fisher and Scott, 1998; Simon, 1998). To elucidate further the function of individual family members, we have investigated the redundancy of these proteins. We previously demonstrated a genetic interaction between Spi-B and PU.1. PU.1+/- Spi-B-/- mice exhibit a more severe B-cell receptor signaling defect than either the Spi-B-/- or PU.1+/- mutations alone. Presumably these defects are due to deregulation of target genes, and we have identified several genes underexpressed in the PU.1+/- Spi-B-/- mice (Rao et al., 1999a; Hu et al., 2001). However, our previous studies failed to distinguish if deregulation was due to a threshold effect for Spi family member activity or whether some target genes require the unique activities of each factor.

Other transcription factor families, including MyoD, GATA, Pax and Fos proteins, contain functionally redundant members based on gene knock-in approaches (Wang et al., 1996; Tsai et al., 1998; Bouchard et al., 2000; Fleischmann et al., 2000). In our study, gene targeting was used to introduce Spi-B and Ets-1 individually into the murine PU.1 locus so that they would be expressed in place of PU.1. Spi-B is expressed predominantly in B lymphocytes, where it is co-expressed with PU.1 throughout most of B-cell development. Spi-B has never been detected in myeloid cells (Chen et al., 1995; Su et al., 1996). Ets-1 is broadly expressed and detected in most hematopoietic lineages, with high levels observed in adult lymphoid cells (Kola et al., 1993; Maroulakou et al., 1994). The present study allowed us to determine if these factors have evolved simply to provide Spi and/or Ets activity at the appropriate developmental time and place or if they have also evolved unique functional capabilities.

Our results demonstrate a requirement for Spi subfamily members in myeloid development, since Spi-B could rescue myeloid development but Ets-1 could not. In both primary EB differentiation and more sensitive hematopoietic progenitor assays, Spi-B, but not Ets-1, generated normal macrophages based on morphology and histological staining. Although we did observe a few PU.1-/- and PU.1Ets-1/Ets-1 CFU-M colonies in methylcellulose cultures, histochemical analysis of these colonies did not reveal mature macrophages. Cells from such colonies are potentially immature monocytes, in agreement with previous observations that PU.1 is not required for monocytic commitment but instead for maturation (Olson et al., 1995; DeKoter et al., 1998; Henkel et al., 1999). Along with inducing proper macrophage morphology, Spi-B activates myeloid-specific genes (CD11b and M-CSF receptor), which are poorly expressed in PU.1-/- cells. Spi-B-rescued cells were also able to phagocytose opsonized zymosan particles. The granulocytic lineage was also examined. From morphological analysis of CFU-G cells from hematopoietic colony assays, it appeared that Spi-B granulocytes were more mature than PU.1-/- cells, but not as mature as wild-type cells. This conclusion was corroborated by gene expression data that showed that Spi-B could rescue lysozyme, but not lactoferrin, expression.

Although Spi-B replaced PU.1 in myeloid development, it did not rescue B or T lymphopoiesis. Two independent ES cell clones shown to have myeloid activity failed to rescue lymphoid development in RAG-2-/- mice. B220+/IgM+, CD4+ SP, CD8+ SP and CD4+/CD8+ DP cells were detected in chimeric mice generated with PU.1+/- ES cells, but not with PU.1-/- or PU.1Spi-B/Spi-B cells. Unfortunately, PU.1PU.1/PU.1 ES cells could not be assayed since, to our surprise, they did not contribute significantly to any tissues in chimeric animals. Importantly, PU.1Spi-B/Spi-B cells contributed to the hematopoietic compartment as we detected the knock-in allele in splenic and bone marrow cells by Southern blot (data not shown). Since there was clear evidence of hematopoietic contribution, the lack of lymphoid development was not due to an inability to rescue the PU.1-/- bone marrow homing defect (Fisher et al., 1999).

It was surprising that Spi-B could rescue myeloid but not lymphoid development. Spi-B normally is expressed in B cells. Therefore, when expressed under the control of the PU.1 locus, hSpi-B is in an environment that contains necessary co-factors for its normal function as a transcriptional regulator. One potential explanation for our results is that Spi-B protein or transcriptional activity is increased compared with endogenous PU.1. Levels of PU.1 activity have been shown to control cell fate decisions (DeKoter and Singh, 2000). Although this observation has yet to be demonstrated in vivo, it is possible that Spi-B protein levels and/or activity may be too high to direct the B-cell fate. We do not favor this interpretation. In vitro transcriptional assays so far have not detected a significantly increased transactivation ability of Spi-B compared with PU.1 (Ray et al., 1992; Ray-Gallet et al., 1995; Rao et al., 1999b). In addition, we show here that Spi-B transactivation of the Igkappa 3' enhancer is reduced compared with PU.1. We cannot directly compare levels of PU.1 and Spi-B due to different affinities of the respective antibodies. However, RT−PCR and western blot analysis of primary PU.1+/Spi-B B-cell RNA and protein do not indicate that the knocked-in Spi-B is overexpressed dramatically relative to endogenous PU.1 (Figure 2 and data not shown). Additionally, PU.1+/Spi−B mice produce normal numbers of B lymphocytes, indicating that the knocked-in Spi-B is not detrimental to lymphoid development (data not shown). Unfortunately, PU.1Spi-B/Spi-B mice die prior to embryonic day 11.5, precluding analysis of lymphopoiesis.

Our results show that Spi-B can replace PU.1 in myelopoiesis, but not lymphopoiesis. However, we cannot conclude that Spi-B replaces PU.1 in all aspects of myeloid cell function, and granulocytic rescue was shown to be incomplete. The functional differences we observe between PU.1 and Spi-B have important implications for the evolution of the Spi subfamily of Ets transcription factors. We previously described a threshold effect for PU.1 in B-cell function. Deleting one allele of PU.1 in Spi-B-/- mice increases the severity of the BCR signaling defect. Genes critical for B-cell function are clearly dependent on Spi family members for proper expression. Expression of such genes is dependent either on the unique functional abilities of both factors or on a certain level of Spi activity. Our results suggest that genes involved in lymphoid lineage commitment and/or maturation are strictly dependent on PU.1 for their expression. We propose that B-cell lineage commitment exclusively requires PU.1, but proper B-cell function is dependent on both PU.1 and Spi-B.

Materials and methods

Generation of knock-in ES cells

To create a knock-in vector for targeting the murine PU.1 locus, two genomic DNA fragments were isolated: a 2.3 kb SacI fragment for 5' homology and a 4.6 kb BamHI fragment for 3' homology. The 4.6 kb BamHI fragment is downstream of PU.1 exon 1, upstream of exon 3 and includes all of exon 2. The 4.6 kb fragment was inserted into the BamHI site of targeting vector pLNT (pPNT with LoxP sites flanking the PGK::neo cassette). The 2.3 kb SacI fragment is 6 bp upstream of the PU.1 initiator codon within exon 1. This fragment was blunt ended and subcloned into pBluescript KS which had been digested with SacII and blunt ended with T4 polymerase, creating the 5' homology vector. hSpi-B, hEts-1 and mPU.1 cDNAs were amplified by PCR using primers, which engineered a 5' flag epitope sequence with a SacI site, and a 3' primer with a SalI site. These cDNAs were then subcloned into the 5'-homology vector. A 150 bp SalI−XhoI fragment containing the SV40 poly(A) sequence was then inserted downstream of each cDNA. The 5'-homology arm, cDNA and poly(A) sequence were removed by NotI, XhoI digestion and ligated into the pLNT 3'-homology vector to generate the final targeting construct.

RW4 ES cells were electroporated with the targeting constructs and homologous recombinants were selected as previously described (Maltepe et al., 1997). The targeting results in a deletion of approx1 kb of genomic sequence from the SacI site of exon 1 to a downstream intronic BamHI site. Correctly targeted clones were identified by Southern blot analysis using a 350 bp AvaI−SacI fragment from the PU.1 genomic locus. To generate homozygous targeted cells, heterozygous clones were subjected to further selection in 2−4 mg/ml G418 (Mortensen et al., 1992).

Embryoid body generation and analysis

ES clones were in vitro differentiated into EBs for 11−16 days as previously described (Olson et al., 1995). EBs were harvested for cytocentrifugation onto glass microscope slides or disaggregated with trypsin and plated onto chamber slides (Nunc). Cytospin preparations were stained with May−Grunwald−Giemsa stain. Cultured EB-derived cell suspension was allowed to adhere for 24 h and then was washed to remove non-adherent cells. Adherent cells were then fixed and stained with rat anti-mouse F4/80 (Caltag) or anti-CD11b (Pharmingen), using a Vectastain ABC-alkaline phosphatase kit (Vector Laboratories Inc.).

Phagocytosis was examined by incubating adherent cells with opsonized FITC-labeled zymosan particles (Molecular Probes). Zymosan particles were opsonized by mixing equal volume of opsonizing reagent (Molecular Probes) with equal volume of zymosan particles and incubating at 37°C for 1 h. Zymosan particles were washed three times with phosphate-buffered saline (PBS) and resuspended in PBS/10% fetal calf serum/5 mM glucose. Approximately 1 times 106 particles were added to each well of cells and incubated for 30 min at 37°C. Cell cultures were washed extensively with PBS to remove unattached particles. Cells were fixed in 3.7% formaldehyde and visualized with a Nikon Eclipse E800 microscope.

In vitro differentiation and replating of ES cells

ES cells were removed from leukemia-inhibiting factor (LIF)-containing media and plated in methylcellulose (Methocult 4100, Stem Cell Technologies) containing 10% serum, 500 U/ml rhIL-1, 5 ng/ml rmIL-3, 10 mug/ml insulin, 200 mug/ml transferrin and 10-4 M alpha-monothioglycerol, and allowed to differentiate at 37°C. After 9 days, EBs were harvested and disaggregated with trypsin and mechanical shearing with a 21 gauge needle. Cells were then replated into Methocult GF 3434 methylcellulose media (Stem Cell Technologies). The number of cells plated was equal to the number of cells in 50 EBs derived from wild-type ES cells. Hematopoietic colonies were scored and cytocentrifuged 5−7 days later.

RT−PCR analysis

RNA was isolated from hematopoietic progenitor cultures 7−9 days after replating primary EBs or from EB cultures differentiated for 11 days. Total cellular RNA was isolated using TRIzol (Gibco-BRL) according to the manufacturer's instructions. A 1 mug aliquot of total cellular RNA was used in a 20 mul reverse transcriptase reaction (Superscript II, Stratagene). A 2 mul aliquot of the reverse transcriptase reaction was used in a PCR with gene-specific primers. The primers used for amplification of knock-in cDNA were (1) GGATGGACTACAAGGACGACG and (2) GCTGCA ATAAACAAGTTGG. Primers for M-CSFR, CD11b, HPRT, MPO, lactoferrin and lysozyme were described previously (Olson et al., 1995; Anderson et al., 1998). C/EBPepsilon was amplified as previously described using primers RY48 and RY50 (Yamanaka et al., 1997a). Primer pairs did not generate appropriate size fragments from genomic DNA and/or from mock reverse-transcribed RNA preparations.

Enrichment of murine B lymphocytes

Spleens were isolated from PU.1+/- and PU.1+/Spi-B mice. Single-cell suspensions were generated and subjected to ACK lysis. The cell suspension was enriched for murine B lymphocytes using StemSep murine B-cell enrichment cocktail and StemSep magnetic columns according to the manufacturer's instructions (Stem Cell Technologies). Cells were analyzed by fluorescence-activated cell sorting (FACS) for expression of CD19 and B220 (Pharmingen).

Western blotting

EBs were isolated from methylcellulose, washed with PBS and directly lysed in SDS−PAGE sample buffer. U937 and clone 13 cells were also lysed in SDS−PAGE sample buffer; 500 000 cell equivalents were loaded per lane. Murine splenic B cells were lysed in RIPA buffer and total protein was precipitated with trichloroacetic acid. Approximately 150 mug of protein was loaded per lane. SDS−PAGE and western transfer were done using standard methods. Western blots were incubated with anti-PU.1 (Santa Cruz Biotechnology), anti-CREB (Cell Signaling Technology) or anti-hSpiB (Su et al., 1996).

RAG-2-/- complementation assay and FACS analysis

Chimeric mice were generated by injection of PU.1+/-, PU.1-/- or PU.1Spi-B/Spi-B RW4 ES cells into RAG-2-/- blastocysts (Chen et al., 1993). The RAG-2-/- strain used had been bred for black coat color. The percentage chimerism was estimated by appearance of agouti coat color, which would be contributed by cells derived from the donor ES cells. Single-cell suspensions were prepared from bone marrow, spleens and thymi of chimeric animals. Cells were stained with FITC- or phycoerythrin (PE)-conjugated primary antibodies or with biotinylated primary antibodies, followed by streptavidin-labeled FITC, PE or cychrome. Stained cells were analyzed on a dual laser cell sorter (FACScan, Becton Dickinson). Cell preparations were pre-incubated with antibody to FcgammaRIII/II to reduce non-specific antibody binding and were subjected to propridium iodide uptake to exclude dead cells from the analysis. Monoclonal antibodies to B220, IgM, IgD, CD4 and CD8 were used according to the manufacturer's instructions (Pharmingen). FACS data were analyzed using FloJo software (Tree-Star).

Transient transfections

NIH 3T3 cells were transfected with the appropriate DNA using Superfect reagent according to the manufacturer's instructions (Qiagen). A 2 mug aliquot of reporter plasmid, CoreLBKCAT and 500 ng of one or more of the following plasmids was used per transfection: pCMV-jun, pCMV-fos, pCMV-PIP, pcDNA3-PU.1 and pcDNA3-Spi-B. A 500 ng aliquot of pGL2 control luciferase plasmid was used to normalize transfections. Total DNA content per transfection was brought up to 5 mug with pcDNA3.1. At 48 h post-transfection, cell extracts were prepared using Promega reporter lysis buffer. Chloramphenicol acetyl transferase (CAT) activity was measured using the Quan-T-CAT system (Amersham Life Science) and luciferase was measured using the Promega luciferase system.

Supplementary data

Supplementary data for this paper are available at The EMBO Journal Online.

Note added in proof

While this work was under review, a paper entitled 'PU.1 regulates expression of the interleukin-7 receptor in lymphoid progenitors' by D.P.DeKoter, H.J.Lee and H.Singh (Immunity, 16, 297−309, 2002) was published. These authors demonstrate that retroviruses producing high levels of Spi-B generate CD19+ B cells in PU.1-/- progenitor cultures. However, it should be noted that this in vitro system does not assess the production of B220+IgM+ B cells in vivo in bone marrow, or their transit and homing to secondary lymphoid organs, such as the spleen. Therefore, we conclude that Spi-B is unable to regulate IgM+ B cell development in the absence of PU.1.

Acknowledgements

The authors are grateful to C.Clendenin, C.Culpepper and P.Thayer for generating chimeric mice. Michael Atchison generously provided us with the CoreLBKCAT plasmid. We would also like to acknowledge members of our laboratory for critically reading the manuscript. The NIH (grant 52094), the Abramson Family Cancer Research Institute and the Howard Hughes Medical Institute supported this work.

References

Anderson KL, Smith KA, Pio F, Torbett BE and Maki RA (1998) Neutrophils deficient in PU.1 do not terminally differentiate or become functionally competent. Blood, 92, 1576–1585. | PubMed | ISI | ChemPort |

Anderson MK, Hernandez-Hoyos G, Diamond RA and Rothenberg EV (1999) Precise developmental regulation of Ets family transcription factors during specification and commitment to the T cell lineage. Development, 126, 3131–3148. | PubMed | ISI | ChemPort |

Anderson MK, Sun X, Miracle AL, Litman GW and Rothenberg EV (2001) Evolution of hematopoiesis: three members of the PU.1 transcription factor family in a cartilaginous fish, Raja eglanteria. Proc Natl Acad Sci USA, 98, 553–558. | Article | PubMed | ChemPort |

Bemark M, Martensson A, Liberg D and Leanderson T (1999) Spi-C, a novel Ets protein that is temporally regulated during B lymphocyte development. J Biol Chem, 274, 10259–10267. | Article | PubMed | ISI | ChemPort |

Bouchard M, Pfeffer P and Busslinger M (2000) Functional equivalence of the transcription factors Pax2 and Pax5 in mouse development. Development, 127, 3703–3713. | PubMed | ISI | ChemPort |

Brass AL, Kehrli E, Eisenbeis CF, Storb U and Singh H (1996) Pip, a lymphoid-restricted IRF, contains a regulatory domain that is important for autoinhibition and ternary complex formation with the Ets factor PU.1. Genes Dev, 10, 2335–2347. | PubMed | ISI | ChemPort |

Chen HM, Zhang P, Voso MT, Hohaus S, Gonzalez DA, Glass CK, Zhang DE and Tenen DG (1995) Neutrophils and monocytes express high levels of PU.1 (Spi-1) but not Spi-B. Blood, 85, 2918–2928. | PubMed | ISI | ChemPort |

Chen J, Lansford R, Stewart V, Young F and Alt FW (1993) RAG-2-deficient blastocyst complementation: an assay of gene function in lymphocyte development. Proc Natl Acad Sci USA, 90, 4528–4532. | Article | PubMed | ChemPort |

DeKoter RP and Singh H (2000) Regulation of B lymphocyte and macrophage development by graded expression of PU.1. Science, 288, 1439–1441. | Article | PubMed | ISI | ChemPort |

DeKoter RP, Walsh JC and Singh H (1998) PU.1 regulates both cytokine-dependent proliferation and differentiation of granulocyte/macrophage progenitors. EMBO J, 17, 4456–4468. | Article | PubMed | ISI | ChemPort |

Eisenbeis CF, Singh H and Storb U (1995) Pip, a novel IRF family member, is a lymphoid-specific, PU.1-dependent transcriptional activator. Genes Dev, 9, 1377–1387. | PubMed | ISI | ChemPort |

Fisher RC and Scott EW (1998) Role of PU.1 in hematopoiesis. Stem Cells, 16, 25–37. | PubMed | ISI | ChemPort |

Fisher RC, Olson MC, Pongubala JM, Perkel JM, Atchison ML, Scott EW and Simon MC (1998) Normal myeloid development requires both the glutamine-rich transactivation domain and the PEST region of transcription factor PU.1 but not the potent acidic transactivation domain. Mol Cell Biol, 18, 4347–4357. | PubMed | ISI | ChemPort |

Fisher RC, Lovelock JD and Scott EW (1999) A critical role for PU.1 in homing and long-term engraftment by hematopoietic stem cells in the bone marrow. Blood, 94, 1283–1290. | PubMed | ISI | ChemPort |

Fleischmann A, Hafezi F, Elliott C, Reme CE, Ruther U and Wagner EF (2000) Fra-1 replaces c-Fos-dependent functions in mice. Genes Dev, 14, 2695–2700. | Article | PubMed | ISI | ChemPort |

Galson DL, Hensold JO, Bishop TR, Schalling M, D'Andrea AD, Jones C, Auron PE and Housman DE (1993) Mouse beta-globin DNA-binding protein B1 is identical to a proto-oncogene, the transcription factor Spi-1/PU.1 and is restricted in expression to hematopoietic cells and the testis. Mol Cell Biol, 13, 2929–2941. | PubMed | ISI | ChemPort |

Garrett-Sinha LA, Su GH, Rao S, Kabak S, Hao Z, Clark MR and Simon MC (1999) PU.1 and Spi-B are required for normal B cell receptor-mediated signal transduction. Immunity, 10, 399–408. | Article | PubMed | ISI | ChemPort |

Garrett-Sinha LA, Dahl R, Rao S, Barton KP and Simon MC (2001) PU.1 exhibits partial functional redundancy with Spi-B, but not with Ets-1 and Elf-1. Blood, 97, 2908–2912. | Article | PubMed | ISI | ChemPort |

Graves BJ and Petersen JM (1998) Specificity within the ets family of transcription factors. Adv Cancer Res, 75, 1–55. | PubMed | ISI | ChemPort |

Hashimoto S, Nishizumi H, Hayashi R, Tsuboi A, Nagawa F, Takemori T and Sakano H (1999) Prf, a novel Ets family protein that binds to the PU.1 binding motif, is specifically expressed in restricted stages of B cell development. Int Immunol, 11, 1423–1429. | Article | PubMed | ISI | ChemPort |

Henkel GW, McKercher SR, Leenen PJ and Maki RA (1999) Commitment to the monocytic lineage occurs in the absence of the transcription factor PU.1. Blood, 93, 2849–2858. | PubMed | ISI | ChemPort |

Hromas R, Orazi A, Neiman RS, Maki R, Van Beveran C, Moore J and Klemsz M (1993) Hematopoietic lineage- and stage-restricted expression of the ETS oncogene family member PU.1. Blood, 82, 2998–3004. | PubMed | ISI | ChemPort |

Hu C, Rao S, Ramirez-Bergeron DL, Gerondakis S and Simon MC (2001) PU.1/Spi-B regulation of c-rel is essential for mature B cell survival. Immunity, 15, 545–555. | Article | PubMed | ISI | ChemPort |

Klemsz MJ, McKercher SR, Celada A, Van Beveren C and Maki RA (1990) The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene. Cell, 61, 113–124. | Article | PubMed | ISI | ChemPort |

Kola I, Brookes S, Green AR, Garber R, Tymms M, Papas TS and Seth A (1993) The Ets1 transcription factor is widely expressed during murine embryo development and is associated with mesodermal cells involved in morphogenetic processes such as organ formation. Proc Natl Acad Sci USA, 90, 7588–7592. | Article | PubMed | ChemPort |

Maltepe E, Schmidt JV, Baunoch D, Bradfield CA and Simon MC (1997) Abnormal angiogenesis and responses to glucose and oxygen deprivation in mice lacking the protein ARNT. Nature, 386, 403–407. | Article | PubMed | ISI | ChemPort |

Maroulakou IG, Papas TS and Green JE (1994) Differential expression of ets-1 and ets-2 proto-oncogenes during murine embryogenesis. Oncogene, 9, 1551–1565. | PubMed | ISI | ChemPort |

McKercher SR et al. (1996) Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities. EMBO J, 15, 5647–5658. | PubMed | ISI | ChemPort |

Morosetti R, Park DJ, Chumakov AM, Grillier I, Shiohara M, Gombart AF, Nakamaki T, Weinberg K and Koeffler HP (1997) A novel, myeloid transcription factor, C/EBPepsilon, is upregulated during granulocytic, but not monocytic, differentiation. Blood, 90, 2591–2600. | PubMed | ISI | ChemPort |

Mortensen RM, Conner DA, Chao S, Geisterfer-Lowrance AA and Seidman JG (1992) Production of homozygous mutant ES cells with a single targeting construct. Mol Cell Biol, 12, 2391–2395. | PubMed | ISI | ChemPort |

Olson MC, Scott EW, Hack AA, Su GH, Tenen DG, Singh H and Simon MC (1995) PU.1 is not essential for early myeloid gene expression but is required for terminal myeloid differentiation. Immunity, 3, 703–714. | Article | PubMed | ISI | ChemPort |

Pongubala JM and Atchison ML (1997) PU.1 can participate in an active enhancer complex without its transcriptional activation domain. Proc Natl Acad Sci USA, 94, 127–132. | Article | PubMed | ChemPort |

Rao S, Garrett-Sinha LA, Yoon J and Simon MC (1999a) The Ets factors PU.1 and Spi-B regulate the transcription in vivo of P2Y10, a lymphoid restricted heptahelical receptor. J Biol Chem, 274, 34245–34252. | Article | PubMed | ISI | ChemPort |

Rao S, Matsumura A, Yoon J and Simon MC (1999b) SPI-B activates transcription via a unique proline, serine and threonine domain and exhibits DNA binding affinity differences from PU.1. J Biol Chem, 274, 11115–11124. | Article | PubMed | ISI | ChemPort |

Ray D, Bosselut R, Ghysdael J, Mattei MG, Tavitian A and Moreau-Gachelin F (1992) Characterization of Spi-B, a transcription factor related to the putative oncoprotein Spi-1/PU.1. Mol Cell Biol, 12, 4297–4304. | PubMed | ISI | ChemPort |

Ray-Gallet D, Mao C, Tavitian A and Moreau-Gachelin F (1995) DNA binding specificities of Spi-1/PU.1 and Spi-B transcription factors and identification of a Spi-1/Spi-B binding site in the c-fes/ c-fp