Article

  • The EMBO Journal (1999) 18, 2149 - 2164
  • doi:10.1093/emboj/18.8.2149

Elevated expression of activated forms of Neu/ErbB-2 and ErbB-3 are involved in the induction of mammary tumors in transgenic mice: implications for human breast cancer

Peter M. Siegel1,2, Eamonn D. Ryan3, Robert D. Cardiff4 and William J. Muller1,2,3

  1. Institute for Molecular Biology and Biotechnology, McMaster University, Hamilton Ontario Canada L8S 4K1
  2. Department of Biology, McMaster University, Hamilton, Ontario, Canada L8S 4K1
  3. Department of Pathology, McMaster University, Hamilton Ontario Canada L8S 4K1
  4. Department of Pathology, School of Medicine, University of California at Davis, Davis, CA 95616, USA

Correspondence to:

William J. Muller, E-mail: mullerw@mcmail.cis.mcmaster.ca

Received 24 November 1998; Accepted 16 February 1999; Revised 16 February 1999


To assess the importance of Neu activation during mammary tumorigenesis, altered receptors harboring in-frame deletions within the extracellular domain were expressed in transgenic mice. Females from several independent lines develop multiple mammary tumors that frequently metastasize to the lung. Tumor progression in these strains was associated with elevated levels of tyrosine-phosphorylated Neu and ErbB-3. Consistent with these observations, a survey of primary human breast tumors revealed frequent co-expression of both erbB-2 and erbB-3 transcripts. The ability of altered Neu receptors to induce mammary tumorigenesis in transgenic mice prompted us to examine whether similar mutations occurred in ErbB-2 during human breast cancer progression. Interestingly, an alternatively spliced form of erbB-2, closely resembling spontaneous activated forms of neu, was detected in human breast tumors. The ErbB-2 receptor encoded by this novel transcript harbors an in-frame deletion of 16 amino acids in the extracellular domain and can transform Rat-1 fibroblasts. Together, these observations argue that co-expression of ErbB-2 and ErbB-3 may play a critical role in the induction of human breast tumors, and raise the possibility that activating mutations in the ErbB-2 receptor may also contribute to this process.


  • Keywords:

    • activating mutations,
    • ErbB receptors,
    • mammary tumorigenesis,
    • transgenic mice

Introduction

Top

The type I subclass of receptor tyrosine kinases has been associated with several types of human cancers, particularly those involving the breast (reviewed in Rajkumar and Gullick, 1994). Currently, this family of proteins consists of the epidermal growth factor receptor (EGFR/ErbB-1/HER), Neu (ErbB-2/HER2), ErbB-3 (HER3) and ErbB-4 (HER4) (Ullrich et al., 1984; Coussens et al., 1985; Bargmann et al., 1986a; Yamamoto et al., 1986; Kraus et al., 1989; Plowman et al., 1990, 1993). For the sake of clarity, the term neu is used when referring to the rat gene or cDNA, whereas the human and mouse homologs are designated erbB-2. The neu oncogene was first identified in transfection experiments using genomic DNA isolated from chemically induced rat neuroblastomas (Shih et al., 1981; Padhy et al., 1982). Oncogenic activation of Neu occurs as the result of a single point mutation in the transmembrane domain, converting a valine residue to glutamic acid (Bargmann et al., 1986a,b). The presence of this transmembrane mutation causes an increase in the tyrosine kinase activity of Neu (Bargmann and Weinberg, 1988; Stern et al., 1988; Weiner et al., 1989a) by inducing ligand-independent receptor oligomerization (Weiner et al., 1989b).

Numerous studies estimate that erbB-2 is amplified and overexpressed in 20–30% of primary breast cancers, which correlates with poor patient prognosis (Slamon et al., 1987, 1989; Gullick et al., 1991; Paterson et al., 1991; Press et al., 1993; Andrulis et al., 1998). Further support for the involvement of neu/erbB-2 in the initiation and progression of breast cancer comes from the generation and analysis of transgenic mice. In several of these transgenic strains, mammary gland-specific expression of an oncogenic form of neu (Bargmann et al., 1986b) results in the rapid induction of multifocal mammary tumors (Muller et al., 1988; Bouchard et al., 1989; Lucchini et al., 1992; Guy et al., 1996). While these transgenic studies demonstrate that expression of the neu oncogene induces mammary tumorigenesis in mice, the same activating mutation has not yet been identified in human breast tumors (Slamon et al., 1989; Lemoine et al., 1990; Zoll et al., 1992). Therefore, overexpression of the human erbB-2 proto-oncogene appears to be the primary mechanism by which erbB-2 induces breast cancers.

To test directly whether overexpression of wild-type neu is sufficient to induce mammary tumors, transgenic mice were engineered to overexpress the neu proto-oncogene under the control of the mouse mammary tumor virus (MMTV) long terminal repeat (LTR) (Guy et al., 1992a). In contrast to the rapid onset of multifocal mammary tumors observed in the majority of activated neu transgenic mice, these wild-type neu-expressing strains develop focal mammary tumors that arise next to hyperplastic mammary tissue after a long latency period. Although comparable levels of Neu protein were detected in both normal and tumor tissues from many of these animals, catalytically active Neu was detected solely in tumor tissue. Further characterization of MMTV/wild-type neu mice revealed that at least 65% of the mammary tumors that arose in these strains carried somatic mutations in the transgene (Siegel et al., 1994). These alterations, which are confined to a small region in the extracellular domain of Neu, promote the transforming activity of this protein via the formation of intermolecular disulfide bonds (Siegel et al., 1994; Siegel and Muller, 1996). Given that the majority of tumors possess such activating mutations, they are likely to represent a critical rate-limiting step during tumor formation in this model system.

To assess directly whether these activating mutations are responsible for inducing the mammary tumors observed in MMTV/wild-type neu animals, transgenic mice have been generated expressing two different neudeletion mutants (NDL) under the control of the MMTV-LTR. Two independent lines for each transgenic strain (NDL1 and NDL2) developed mammary tumors faster than observed in MMTV/wild-type neu mice. Biochemical characterization of these mammary tumors revealed the presence of Neu receptor dimers that were constitutively tyrosine phosphorylated. Tumor progression in these strains was also associated with a 10- to 15-fold increase in tyrosine-phosphorylated ErbB-3 protein. However, because similar levels of erbB-3 transcript could be detected in both tumor and adjacent mammary epithelium, the elevated levels of erbB-3 protein probably result from enhanced translation or prolonged receptor stability. Consistent with these transgenic results, a survey of human breast tumor RNA samples revealed frequent co-expression of both erbB-2 and erbB-3 transcripts. Given that expression of altered Neu receptors could induce mammary gland transformation in transgenic mice, we sought to identify comparable mutations in erbB-2. Interestingly, we have detected an alternatively spliced form of erbB-2 in human breast tumor samples which contains an in-frame deletion located in the same region previously identified in neu (Siegel et al., 1994) and encodes a receptor capable of transforming cells in vitro. Taken together, these observations raise the possibility that activated forms of erbB-2 may collaborate with erbB-3 to promote the development of breast cancer in humans.

Generation and characterization of MMTV/neu deletion mice

To examine the ability of altered Neu receptors to transform mammary epithelium in vivo, two neu cDNAs possessing activating mutations were placed under the transcriptional control of the MMTV-LTR (Figure 1). The NDL1 and NDL2 transgenes contain in-frame deletions previously designated as neu8142 and neu8342, respectively (Siegel et al., 1994). A total of four founder animals carrying the MMTV/NDL1 transgene, and six founder animals harboring the MMTV/NDL2 transgene were generated by pro-nuclear injection of fertilized one-cell mouse zygotes. To determine the tissue specificity of transgene expression, total RNA derived from various tissues was hybridized to an antisense riboprobe complementary to the SV40 polyadenylation signal of the transgene (SPA; Figure 1) and subjected to RNase protection analyses. To ensure equivalent amounts of RNA in each hybridization reaction, an internal control riboprobe specific for the phosphoglycerate kinase-1 gene (PGK-1) was also included. Quantitative phosphorimager analyses revealed that the major sites of transgene expression in female carriers of both strains included the mammary and salivary glands, while lower levels were also observed in the lungs and ovaries (Table I). In addition, high levels of lung-specific expression of the transgene were evident in those animals that developed metastatic lesions. In male carriers, transgene expression was detected in salivary gland and reproductive organs, such as the epididymis, seminal vesicles and testes. Variable transgene expression was also observed in the mammary gland and lungs. To confirm that the transcripts originating from each transgene possessed the expected deletions, selected samples were subjected to RNase protection analyses with a riboprobe directed to the region of neu harboring these mutations (Siegel et al., 1994). These analyses confirmed that the transgene transcripts possessed the expected deletions in the region encoding the extracellular domain of Neu (unpublished data). Based on these expression analyses, further detailed characterization of MMTV/neu deletion mice was restricted to two independent strains for each of the activated neu alleles (NDL1–2, NDL1–4, and NDL2-1, NDL2-5, respectively).

Figure 1.

Figure 1 :

Structure of neudeletion (NDL) transgenes. The unshaded region indicates vector sequences (pBluescript KS), the striped region represents the MMTV-LTR, filled regions correspond to the neu cDNA which harbors the deletion, and the gray portion indicates polyadenylation signals derived from the SV40 early transcription unit. The amino acid sequence of each deletion mutation encoded by the two transgenes is compared with the wild-type sequence and is outlined in single-letter code above the transgene schematic. The phenylalanine (F) residue at the end of the indicated sequence is directly adjacent to the start of the transmembrane domain (TM), which is denoted by the black box. The restriction sites used to isolate the injection fragment are indicated above the diagram, and the Spa (SV40 polyadenylation) riboprobe used for the RNase protection analyses is also shown.

View full figure (54 KB)

Consistent with previous studies examining mammary epithelial expression of neu in transgenic mice (Muller et al., 1988; Bouchard et al., 1989; Lucchini et al., 1992; Guy et al., 1992a, 1996), females from all four MMTV/NDL lines developed mammary adenocarcinomas (Table II). The penetrance of this phenotype was incomplete, with approx80% of transgene carriers developing mammary tumors prior to 1 year of age. Animals failing to develop tumors within this time frame were considered tumor free. Given that pregnancy and lactation are known to increase expression from the MMTV-LTR (Stewart et al., 1984; Kitsberg and Leder, 1996), both virgin and multiparous females were monitored for mammary tumor formation. Although not required, multiple pregnancies did accelerate tumor onset in each of the NDL lines examined when compared with MMTV/wild-type neu mice (N202) (Table II).

In addition to the accelerated rates of tumor development relative to those strains expressing the neu proto-oncogene, expression of these activated neu alleles resulted in a significant increase in the number of mammary tumors present within each fat pad (Figure 2). Histologically, these tumors are similar to those described for both activated (Muller et al., 1988; Cardiff et al., 1991; Guy et al., 1996) and wild-type neu-expressing mice (Guy et al., 1992a), appearing as nodular masses amongst hyperplastic and dysplastic tissue (Figure 3). Transplantation of tumor explants, derived from NDL1–2 and NDL1–4 females, into sub-cutaneous sites of syngeneic mice confirmed the neoplastic nature of these mammary tumors (unpublished data).

Figure 2.

Figure 2 :

Whole-mount preparations of hematoxylin-stained mammary glands comparing the morphology of non-transgenic FVB/N (A) with transgenic wild-type neu (B), NDL1–2 (C) and NDL2-5 (D) females at 6 months of age. Note that both NDL1–2 and NDL2-5 mammary glands (C and D) exhibit multifocal, solid proliferating tumors, whereas the mammary gland derived from the wild-type neu female displays only diffuse cystic hyperplasia, lacking focal proliferative lesions (B).

View full figure (26 KB)

Figure 3.

Figure 3 :

The characteristic subgross (A–D) and histological (E–H) patterns found at the terminal ends of 6-month-old nulliparous wild–type FVB/N (A and E) mammary glands as compared with animals carrying the cNeu (B and F) and NDL (C, D, G and H) transgenes. Note that the terminal ends of all three transgenic mice contain more fluid and cells than the FVB/N control. The cNeu termini are generally hollow cysts, filled with fluid (B and F), while the NDL termini have more cysts with cells (C and G) or entirely filled with cells displaying nuclear pleomorphism (D and H) and a high rate of DNA synthesis. Whole-mount (A–D) and histological (E–H) images were taken at times10 and times20 magnification, respectively.

View full figure (84 KB)

Another important phenotype displayed by these activated neu strains is the frequent occurrence of metastatic lesions. Inspection of the lungs from MMTV/NDL females revealed the presence of lung metastases in all four lines (Table II). Although the same phenotype was observed in mice expressing a wild-type neu transgene (Guy et al., 1992a), a direct comparison cannot readily be made with the transgenic lines derived in this study. Metastases were scored in MMTV/NDL mice after 30–60 days following first tumor palpation (Table II), whereas metastasis was assessed in wild-type neu-expressing animals that were tumor-bearing for at least 90 days (Guy et al., 1992a). RNase protection analysis, using beta-casein as a marker for mammary epithelium, confirmed that those tumor cells discovered in the lungs originated from the mammary gland (unpublished data). Taken together, these observations suggest that mammary epithelial-specific expression of these activated forms of neu results in the efficient induction of metastatic mammary adenocarcinomas.

To confirm that these altered transcripts encoded activated Neu receptors, immunoprecipitates from tumor lysates were subjected to parallel immunoblots using Neu- and phosphotyrosine-specific antibodies. The results showed that mammary tumors derived from virgin females expressed Neu protein that was constitutively tyrosine phosphorylated (Figure 4A and B). We have demonstrated previously that activation of these altered forms of Neu occurs through the formation of disulfide bond-stabilized dimers (Siegel and Muller, 1996). To examine whether the presence of tyrosine-phosphorylated Neu detected in these tumors was due to the same mechanism, immunoprecipitates were separated under non-reducing and reducing electrophoresis conditions and subjected to immunoblot analysis with Neu-specific antibodies. These results demonstrate that tyrosine phosphorylation of altered Neu receptors expressed in MMTV/NDL tumors reflects their ability to undergo intermolecular dimerization (Figure 4C and D).

Figure 4.

Figure 4 :

Altered Neu receptors encoded by both MMTV/neu deletion transgenes (NDL1 and NDL2) are constitutively tyrosine phosphorylated and form dimers in vivo. (A) Neu was immunoprecipitated (IP) from 1 mg of mammary tumor lysates (BT) derived from each of four different transgenic lines expressing Neu deletion mutants (lanes 2–9). Tumor tissue was collected from two separate transgenic strains (NDL1 and NDL2) and two independent lines were examined from each strain (NDL1-2, NDL1-4, and NDL2-1, NDL2-5). One-third of the immunoprecipitate was electrophoresed on an SDS–9.0% polyacrylamide gel, transferred to a PVDF membrane and subjected to immunoblot analysis (BLOT) with a Neu–specific antibody. The position of Neu is indicated by the arrow. (B) The remaining two-thirds of the immunoprecipitate was subjected to immunoblot analysis for anti-phosphotyrosine (P-Tyr) as described in (A). The position of tyrosine-phosphorylated Neu is indicated by the arrow. (C and D) Neu was immunoprecipitated, in duplicate, from 600 mug of mammary tumor lysates using one representative sample for each line (lanes 2–5). A non-transgenic mammary tissue lysate (FVB Mam. Gl.; lane 1) was included to control for endogenous Neu expression in this organ. The immunoprecipitates were then electrophoresed through 4–12% gradient SDS–polyacrylamide gels under non-reducing (C) and reducing (D) conditions. Neu dimers are indicated by the solid arrow, while the position of the monomers is marked by the open arrows (D and M, respectively).

View full figure (65 KB)

ErbB-3 is expressed at elevated levels during tumor progression in the activated neu strains

While our observations suggest that Neu homodimers are involved in the induction of these mammary tumors, it is conceivable that heterodimerization between the activated forms of Neu and other EGFR family members may also be involved in tumor progression. Indeed, it has been demonstrated previously that co-expression of Neu/erbB-2 with other EGFR family members can act synergistically to transform established fibroblast lines in vitro (Kokai et al., 1989; Alimandi et al., 1995; Wallasch et al., 1995; Cohen et al., 1996; Zhang et al., 1996). To explore this possibility, mammary tumor extracts from both neu deletion strains were subjected to immunoblot analyses with EGFR-, erbB-3- and ErbB–4-specific antisera. In contrast to low and variable levels of EGFR and ErbB–4, elevated levels of endogenous erbB-3 were detected consistently in every tumor lysate examined (n = 14) (Figure 5). The observed expression patterns did not reflect variations of total protein between samples since immunoblot analyses revealed comparable levels of Grb–2 in each lysate (Figure 5).

Figure 5.

Figure 5 :

The expression of endogenous erbB-3 receptors is significantly elevated in tumors derived from both NDL1 and NDL2 transgenic animals. (A) Equivalent amounts of total protein (50 mug) from mammary tumor lysates (BT) were electrophoresed on a 4–12% gradient SDS–polyacrylamide gel and transferred to a PVDF membrane (lanes 2–9). The membrane was cut, and the upper half of the blot was probed with EGFR-specific mouse monoclonal antibodies, while the lower portion of the membrane was blotted with Grb–2–specific rabbit polyclonal antisera. Similarly, immunoblots were performed for both erbB-3 (B) and ErbB–4 (C) using the same tumor lysates. As in (A), Grb–2 immunoblots were used to confirm that equivalent amounts of protein were present in each lane. Lysates from non-transgenic mammary tissue (FVB Mam. Gl.) were included in each panel to control for endogenous levels of each ErbB receptor expressed in the normal mammary gland (lane 1). The positions of EGFR, erbB-3, ErbB-4 and Grb-2 are indicated by arrows.

View full figure (65 KB)

To ensure that elevated erbB-3 levels in mammary tumors were not due to increased epithelial content, we also measured the levels of the epithelial marker cytokeratin-8 in these samples. To accomplish this, quantitative 125I immunoblots were performed on both tumor and adjacent tissue from NDL1-2 and NDL2-1 animals using either erbB-3- or cytokeratin-8-specific antisera (Figure 6A and B). Quantitative phosphorimager analysis of the erbB-3/cytokeratin-8 ratio revealed a 10- to 15-fold increase of erbB-3 protein in the tumor compared with adjacent mammary tissue in these activated Neu strains (Figure 6D). A similar analysis of an MMTV/wild-type neu transgenic line (N202) revealed an approx10-fold increase of endogenous erbB-3 in tumor versus adjacent tissue (Figure 6C and D). Because erbB-3 lacks intrinsic tyrosine kinase activity (Guy et al., 1994), activation of this receptor is dependent on transactivation by other members of the EGFR family.

Figure 6.

Figure 6 :

The levels of ErbB-3 protein are increased in tumor tissue versus adjacent mammary epithelium. Total protein (50 mug) was isolated from mammary tumor tissue (BT) and adjacent mammary epithelium (Adj. M. Gl.) of three transgenic mouse strains; NDL1-2 (A), NDL2-1 (B) and N202 (C). Protein lysates were separated through SDS–9.0% polyacrylamide gels, transferred to PVDF membranes and probed with antibodies specific to erbB-3 (B-3) or cytokeratin-8 (CK-8). 125I-conjugated secondary antibodies were used for quantitative immunoblot analysis. (D) The fold increase of erbB-3 protein in mammary tumors versus adjacent epithelium is indicated for each strain. Phosphorimager values for erbB-3 were first divided by those obtained for cytokeratin-8 in order to account for the epithelial content within each sample. These ratios were then used to determine the fold increase of erbB-3 protein in mammary tumors versus adjacent epithelium. The numbers of samples analyzed are indicated (n).

View full figure (89 KB)

To test whether erbB-3 is transphosphorylated in these Neu-induced mammary tumors, erbB-3 immunoprecipitates were subjected to immunoblot analysis using anti-phosphotyrosine-specific antibodies. The results showed that erbB-3 is constitutively tyrosine phosphorylated in mammary tumors arising in MMTV/neu deletion mice (Figure 7). The tyrosine-phosphorylated erbB-3 observed in these tumors does not result from stable complex formation between Neu and erbB-3 since repeated attempts to detect an association between the two receptors by reciprocal immunoprecipitation and immunoblot analysis have been unsuccessful (unpublished observations). However, such negative data do not disprove a transient physical association between these two receptors. Taken together, these observations argue that co-expression of activated Neu and wild-type erbB-3 may play an important role in tumor progression in these strains.

Figure 7.

Figure 7 :

Endogenously expressed erbB-3 is tyrosine phosphorylated. (A) erbB-3 was immunoprecipitated (IP) from 4 mg of mammary tumor lysates (BT) derived from NDL transgenic animals (NDL1 and NDL2) (lanes 2–9). A lysate from non-transgenic mammary tissue (FVB Mam. Gl.) was also included as a negative control (lane 1). One-half of each immunoprecipitate was electrophoresed on an SDS–9.0% polyacrylamide gel, transferred to a PVDF membrane and subjected to immunoblot (BLOT) analysis with an erbB-3-specific antibody. The position of erbB-3 is indicated by the arrow. (B) The remaining half of the immunoprecipitate was subjected to immunoblot analyses with anti-phosphotyrosine (P-Tyr)-specific antibodies, as described in (A). The position of tyrosine-phosphorylated erbB-3 is indicated by the arrow.

View full figure (41 KB)

One potential explanation for the elevated levels of erbB-3 protein in these tumors is that signaling by activated Neu receptors increases transcription of the erbB-3 gene. To address this possibility, we subjected RNA samples from both adjacent and tumor tissues to RNase protection analysis using a riboprobe specific for erbB-3. To control for variation in epithelial content, the same RNA samples were hybridized with a riboprobe specific to cytokeratin-8 (Figure 8A). A quantitative comparison of the levels of erbB-3 RNA from tumor tissue with that derived from adjacent mammary epithelium showed a <3-fold difference between these tissues (Figure 8B). This modest elevation in erbB-3 message cannot alone account for the 10- to 15-fold increase in the levels of erbB-3 protein. These data argue that the elevated erbB-3 levels observed during tumor progression in these strains result from either increased protein translation or prolonged stability of the receptor.

Figure 8.

Figure 8 :

The levels of erbB-3 transcript are not substantially increased in tumor versus adjacent mammary gland tissue. (A) Total RNA was isolated from mammary tumor tissue (BT) and adjacent mammary epithelium (Adj. M. Gl.) of three transgenic mouse strains (NDL1-2, NDL2-1 and N202). The 375 nucleotide protected fragment corresponding to the erbB-3 (B-3) message is indicated. An antisense control probe, directed towards cytokeratin-8, was included to account for epithelial content of the RNA sample. The 142 nucleotide protected fragment is indicated by CK-8. (B) The fold increase of erbB-3 transcript in mammary tumors versus adjacent epithelium is indicated for each strain. Phosphorimager values for the B-3 protected fragment were first divided by those obtained for the CK-8 protected fragment to account for the epithelial content within each sample. These ratios were then used to determine the fold increase of erbB-3 message in the mammary tumor versus adjacent epithelium. The numbers of samples analyzed are indicated (n).

View full figure (58 KB)

The accumulation of tyrosine-phosphorylated erbB-3 in the mammary tumors of several neu-expressing transgenic strains suggests a functional role for this receptor in Neu-mediated transformation. Indeed, wild-type erbB-2 and erbB-3 previously have been shown to cooperate in transformation of fibroblasts (Alimandi et al., 1995; Wallasch et al., 1995; Zhang et al., 1996). To determine whether erbB-3 and one of the altered Neu receptors used in this study could synergize to transform cells in culture, expression plasmids encoding erbB-3 and Neu8142 (NDL1) were co-transfected into Rat-1 fibroblasts and the number of foci scored. The results showed that co-expression of Neu8142 with erbB-3 consistently resulted in a 50% increase in the number of foci when compared with Neu8142 alone (Table III). These observations argue that activated neu alleles can cooperate with erbB-3 to promote oncogenic transformation.

An alternatively spliced erbB-2 isoform, closely resembling transforming neu alleles, is co-expressed with erbB-3 in primary human breast tumors

The transforming potential demonstrated by Neu and erbB-3 in cell culture systems suggests that this receptor combination may also be involved in the genesis of human breast cancer. Indeed, several studies have examined erbB-3 expression in human breast tumor samples (Lemoine et al., 1992; Bacus et al., 1994; Gasparini et al., 1994; Quinn et al., 1994; Bodey et al., 1997), and a subset of these noted co-expression of erbB-2 and erbB-3 in the same tumors (Quinn et al., 1994; Bodey et al., 1997). To extend further our observations with these transgenic strains to human breast cancers, a limited number of RNA samples from several erbB-2-expressing breast tumors were subjected to RNase protection analysis with an erbB-3-specific riboprobe. The results of this analysis revealed that the majority of erbB-2-expressing tumors also possessed erbB-3 message (Figure 9).

Figure 9.

Figure 9 :

Primary human breast tumors frequently express both erbB-2 and erbB-3 transcripts. (A) RNase protection analysis of total RNA (20 mug) from primary human breast tumors hybridized to an antisense erbB-2 riboprobe (lanes 3–11). The 473 nucleotide erbB-2 protected fragment is indicated. (B) The same RNA samples (20 mug) were hybridized to an antisense erbB-3 riboprobe. The 720 nucleotide erbB-3 protected fragment is indicated. An antisense riboprobe, directed against human beta-actin, was used to monitor the RNA integrity of each sample. The beta-actin probe protects a 212 nucleotide fragment as indicated. The migration pattern of each undigested riboprobe is indicated (A and B, lane 1). In addition to the tumor RNA, 20 mug of tRNA was included in both sets of hybridizations as a negative control (lane 2). Migration of labeled DNA markers (phiX174, Gibco-BRL) is indicated on the left in nucleotides.

View full figure (77 KB)

These observations suggest that mammary gland transformation in MMTV/neu deletion mice involves similar events that occur during human breast tumor progression. Given the frequent occurrence of activated neu alleles within mammary tumors of wild-type neu-expressing animals, and their ability to induce tumorigenesis when expressed in the mammary gland of transgenic mice, we sought to identify similar activating events in erbB-2. Recent studies have revealed that alternative splicing may provide a unique mechanism for the generation of novel transcripts encoding activated growth factor receptors. Indeed, several reports document the existence of splice variants which encode Met, Ron and fibroblast growth factor receptor 2 (FGFR2) receptor tyrosine kinases harboring deletions within their extracellular domains (Rodrigues et al., 1991; Li et al., 1995; Collesi et al., 1996; Meyers et al., 1996). In this regard, inspection of the intron–exon structure of the human erbB-2 gene revealed that removal of a coding exon immediately preceding the transmembrane domain could result in an alteration closely resembling the transgene mutations observed in both MMTV/wild-type neu and MMTV/NDL transgenic mice (Figure 10A and B). To determine whether this putative splice form could be detected in human breast tumors, total RNA derived from both normal human breast tissue and tumor samples was subjected to RT–PCR with oligonucleotide primers flanking the region of interest. These results revealed that, in addition to the expected wild-type erbB-2 message, both normal and tumor tissue expressed the spliced transcript (Figure 10C). Direct sequence analyses confirmed that the upper RT–PCR product represented wild-type erbB-2, whereas the lower fragment contained the sequence expected from the alternative splicing event (Figure 10B). Quantitative analyses of the PCR products by phosphorimager analysis revealed that the spliced form represented approx2–5% of the wild-type erbB-2 transcript present within each sample.

Figure 10.

Figure 10 :

Alternative mRNA splicing results in an erbB-2 transcript harboring an in-frame deletion. (A) Schematic representation of a small region of the human erbB-2 genomic locus indicating the exon–intron boundaries. The values indicated above the schematic represent nucleotide numbers corresponding to the cDNA. Upper case letters designate coding sequences, whereas nucleotides within the introns are in lower case letters. The aberrant splicing event leading to the deletion of an exon (gray) is indicated by the dashed lines. (B) An alignment of the wild-type and alternatively spliced erbB-2 messages indicating the sequences removed by the aberrant splicing event (gray box). (C) RT–PCR analysis of both normal breast and tumor tissue. The negative control represents an RT–PCR performed in the absence of RNA (distilled water). The PCR was conducted in the presence of [alpha-32P]dCTP and the products resolved on a 5% polyacrylamide gel, dried and exposed to film. The positions of the wild-type and spliced products are indicated.

View full figure (70 KB)

Given the resemblance of this spliced form of erbB-2 to the oncogenic neu alleles that arise during mammary tumorigenesis in MMTV/wild-type neu mice, the transforming activity of the protein encoded by the splice variant was compared with two previously characterized oncogenic erbB-2 receptors. To accomplish this, expression plasmids bearing the wild-type erbB-2 cDNA (WT), a transforming erbB-2 allele possessing a point mutation in the region encoding the transmembrane domain (VE), a previously characterized sporadic deletion discovered in the neu proto-oncogene (Siegel et al., 1994) that was engineered in erbB-2 (ECD DEL), or the spliced form of erbB-2 (SPLICE) were electroporated into Rat-1 cells and assessed for their capacity to induce foci (Figure 11A). Whereas expression of wild-type erbB-2 failed to transform Rat-1 fibroblasts, expression of the spliced form and of the two previously characterized transforming alleles resulted in the induction of foci (Figure 11B and Table IV). The spliced form of erbB-2 transformed at 26% the level observed with the transmembrane mutant of erbB-2 (VE) and possessed transforming activity similar to that of the previously characterized sporadic deletion (ECD DEL) (Table IV).

Figure 11.

Figure 11 :

Expression of altered erbB-2 receptors results in morphological transformation. (A) Partial amino acid sequence alignment of the wild-type and altered erbB-2 receptors tested in Rat-1 focus assays. erbB-2 (WT) represents the wild-type receptor, erbB-2 (VE) possesses a valine to glutamic acid point mutation in the transmembrane domain, erbB-2 (ECD DEL) harbors a deletion which mimics a previously characterized mutation in the Neu receptor (Neu8142; Siegel et al., 1994; Siegel and Muller, 1996), and ErbB-2 (SPLICE) contains the deletion encoded by the alternatively spliced erbB-2 message. A portion of the transmembrane domain is indicated by the open box and designated TM. The asterisk indicates the position of the valine to glutamic acid substitution in erbB-2 (VE). (B) Shown are representative plates from focus assay #1 (see Table IV) illustrating the relative transforming abilities of the various forms of erbB-2 indicated in (A).

View full figure (68 KB)

To determine whether the oncogenic potential of the spliced form of erbB-2 was related to activation of the receptor's catalytic activity, established Rat-1 cells expressing the various erbB-2 alleles were generated. To assess the tyrosine phosphorylation status of these receptors, protein extracts derived from the various cell lines were immunoprecipitated with erbB-2-specific antibodies and subjected to immunoblot analyses with anti-phosphotyrosine antibodies. As shown in Figure 12A, tyrosine-phosphorylated erbB-2 could be detected easily in transformed cells expressing the oncogenic alleles of erbB-2 but was barely detectable in morphologically normal cell lines expressing elevated levels of wild-type erbB-2. A parallel immunoblot for erbB-2 revealed that each established cell line expressed similar levels of the receptor (Figure 12B). To determine whether erbB-2 receptors encoded by the novel splice variant were activated by the formation of disulfide bond-stabilized dimers, erbB-2 immunoprecipitates were resolved under non-reducing and reducing electrophoresis conditions. erbB-2 immunoblot analyses revealed that the oncogenic potential and constitutive phosphorylation status of these activated erbB-2 receptors reflect their ability to undergo disulfide bond-stabilized dimerization (Figure 12C and D). These observations demonstrate that the alternatively spliced erbB-2 transcript encodes an oncogenic receptor that frequently is co-expressed with erbB-3 in primary human breast tumors.

Figure 12.

Figure 12 :

Altered erbB-2 receptors are constitutively tyrosine phosphorylated and undergo disulfide bond-stabilized dimerization when expressed in Rat-1 cells. (A) Lysates (600 mug) from stable cell lines expressing wild-type erbB-2 (WT) (lanes 2 and 3) or the three altered receptors (VE, ECD and SPLICE) (lanes 4–11) were immunoprecipitated for erbB-2 and the immunoprecipitates subjected to immunoblot analysis with phosphotyrosine-specific antibodies. (B) Lysates (600 mug) from stable cell lines expressing the various erbB-2 receptors were immunoprecipitated for erbB-2 and the immunoprecipitates subjected to immunoblot analysis with erbB-2/Neu-specific antibodies. In each panel, Rat-1 indicates the parental cell line which does not contain any erbB-2 expression plasmid (A and B, lane 1). The position of erbB-2 is indicated in each panel by the arrow. (C and D) erbB-2 was immunoprecipitated, in duplicate, from 500 mug of protein lysate derived from established Rat-1 cell lines expressing wild-type (WT, lane 2), an engineered mutant (ECD, lane 3) or the erbB-2 receptors encoded by the splice variant (SPLICE, lanes 4 and 5). The parental Rat-1 cell line lacking exogenous erbB-2 receptor expression was also included (Rat-1, lane 1). The immunoprecipitates were then electrophoresed under non-reducing (C) and reducing (D) conditions. erbB-2 dimers are indicated by the solid arrow, while the position of the monomers is marked by the open arrows (D and M, respectively).

View full figure (72 KB)

Discussion

Top

Oncogenic mutations within the extracellular domain of the Neu receptor previously have been associated with mammary tumorigenesis in transgenic mice (Siegel et al., 1994). In the present study, we directly demonstrate that mammary epithelial expression of these activated Neu receptors results in the rapid induction of metastatic mammary carcinomas (Table II). Although the transforming potential of these activated neu alleles in the mammary gland is clearly greater than that of the wild-type neu proto-oncogene, their expression is not sufficient to transform the entire mammary epithelium. Indeed, hyperplastic and dysplastic lesions are often detected in the mammary glands of these strains before overt mammary carcinomas appear (Figure 3). These results suggest that, while necessary, the altered Neu receptors utilized in this study are not sufficient for mammary tumor formation.

One possible explanation for these observations is that in addition to Neu activation, the expression of another EGFR family member is required for efficient tumor induction. In this regard, elevated levels of endogenous erbB-3 are observed consistently in Neu-induced mammary tumors (Figure 5B). Although the levels of erbB-3 protein were dramatically elevated in tumors (10- to 15-fold, Figure 6), a comparable increase in the levels of erbB-3 transcript was not observed between adjacent and tumor tissue (Figure 8). These observations argue that the elevated erbB-3 protein levels are due to increased protein translation or prolonged receptor half-life. Indeed, the phosphatidylinositol (PI) 3-kinase/Akt pathway recently has been implicated in the phosphorylation and inactivation of 4E-BP1, a member of a family of translational repressor proteins (Gingras et al., 1998). Given that erbB-3 can bind and activate PI 3-kinase directly (Fedi et al., 1994; Kim et al., 1994; Prigent and Gullick, 1994; Soltoff et al., 1994), inactivation of 4E-BP1 may, in part, account for the elevated protein levels of erbB-3 in these tumors. While such a pathway would sustain high levels of erbB-3 protein, the factor(s) resulting in its initial accumulation are unclear.

The results of these studies suggest that co-expression of activated Neu and wild-type erbB-3 may play a critical role in mammary tumor progression. The observation that erbB-3 is tyrosine phosphorylated in these tumors and enhances transformation induced by one of the altered Neu receptors utilized in this study suggests that erbB-3 expression is functionally involved in Neu-mediated transformation. Given that erbB-3 possesses impaired tyrosine kinase activity and fails to become phosphorylated in the absence of other ErbB receptors (Guy et al., 1994; Pinkas-Kramarski et al., 1996), it seems likely that the observed erbB-3 phosphorylation results from transmodulation by another family member. Indeed, the obvious candidate is Neu, since elevated levels of the activated receptor are present in these tumor tissues. However, stable dimers between these two receptors could not be detected in vivo (unpublished data). The inability to detect Neu–erbB-3 heterodimers may reflect the transient nature of this interaction, which may be affected further by conformational changes present within the extracellular domain of altered Neu receptors. In addition, previous data have demonstrated that interactions between members of the EGFR family are notoriously difficult to detect in vivo (Muller et al., 1996). Despite the lack of detectable Neu–erbB-3 heterodimers, elevated levels of tyrosine-phosphorylated erbB-3 may collaborate with Neu to transduce a strong proliferative signal, leading to tumor formation in neu-expressing transgenic mice. Consistent with these transgenic results, expression of erbB-3 has been shown both to enhance erbB-2-mediated transformation of NIH 3T3 cells in vitro (Alimandi et al., 1995; Wallasch et al., 1995; Zhang et al., 1996) and to promote the tumorigenic growth of these cells in soft agar and nude mice (Cohen et al., 1996). Moreover, of the possible interactions that occur between members of the ErbB family (Riese et al., 1995; Karunagaran et al., 1996; Pinkas-Kramarski et al., 1996; Tzahar et al., 1996), the erbB-2–erbB-3 heterodimer is the preferred receptor combination capable of delivering strong proliferative signals (Pinkas-Kramarski et al., 1996; Tzahar et al., 1996).

Another potential role for erbB-3 in mammary tumor progression in these transgenic strains is to provide an anti-apoptotic signal through its ability to couple preferentially with the PI 3-kinase pathway. Indeed, erbB-3 possesses seven consensus SH2 domain-binding sites for PI 3-kinase and is thought to recruit this signaling molecule to other members of the EGFR family through heterodimerization (Fedi et al., 1994; Kim et al., 1994; Prigent and Gullick, 1994; Soltoff et al., 1994). Activation of the PI 3-kinase pathway is known to protect numerous cell types from apoptosis induced by serum deprivation, removal of survival factors, detachment of cells from the extracellular matrix, UV radiation and c-myc expression under serum-free conditions (Yao and Cooper, 1995; Dudek et al., 1997; Kaufmann-Zeh et al., 1997; Kennedy et al., 1997; Khwaja et al., 1997; Kulik et al., 1997). More recently, the importance of PI 3-kinase in mammary tumorigenesis has been demonstrated in transgenic mice expressing a mutant polyomavirus (PyV) middle T (mT) antigen uncoupled from the PI 3-kinase signaling pathway. In contrast to the potent transforming activity of the wild-type PyVmT antigen, transgenic mice expressing the mutant PyVmT transgene develop highly apoptotic epithelial hyperplasias. Interestingly, in the focal mammary tumors that evolve from these hyperplasias, there is a dramatic elevation of both endogenous erbB-2 and erbB-3 protein levels (Webster et al., 1998). Taken together, these observations suggest that co-expression of erbB-2 and erbB-3 may be a common event in mammary tumor progression.

The importance of activated erbB-2 and erbB-3 receptors in mammary tumorigenesis is supported further by analyses of primary human breast cancers. We have demonstrated that, in a limited subset of human breast cancers, a majority co-express both erbB-2 and erbB-3 transcripts (Figure 9). Consistent with these observations, other studies have noted co-expression of both erbB-2 and erbB-3 in human breast tumor samples (Quinn et al., 1994; Bodey et al., 1997). Another important similarity between our transgenic models and human breast cancer is the discovery of an alternatively spliced form of erbB-2 which closely resembles activated neu alleles (Siegel et al., 1994). It is particularly striking that the majority of the tumors that arise in the MMTV/wild-type neu strains contain deletions in the same region of erbB-2 which undergoes this alternative splicing event. One potential explanation for the frequent occurrence of somatic mutations observed in this strain is the fact that the transgene harbors the neu cDNA which is incapable of splicing. Therefore, the only mechanism available to mimic the novel erbB-2 spliced isoform is the generation of somatic activating mutations. Given the strong biological selection for the occurrence of such oncogenic mutations in the mammary tumors of wild-type neu-expressing animals, the analogous spliced erbB-2 transcript described in this study may also be involved in breast cancer progression in humans.

Interestingly, two of the 16 amino acids removed by the proposed splicing event are cysteine residues. In this respect, the erbB-2 splice variant differs from the mutations identified in the neu proto-oncogene, which affected only one cysteine residue (Siegel et al., 1994). Based on the disulfide bond structure of the EGFR extracellular domain (Abe et al., 1998), the protein encoded by the novel erbB-2 splice variant would possess two unpaired cysteine residues that potentially could form an aberrant intramolecular disulfide bond rather than an intermolecular cysteine bridge. However, our results indicate that the enhanced oncogenic properties (Figure 11 and Table IV) and constitutive tyrosine phosphorylation of these altered erbB-2 receptors (Figure 12A and B) result from the formation of disulfide-stabilized dimers, which is reminiscent of the mechanism identified for activated Neu receptors (Figure 4; Siegel and Muller, 1996).

The levels of erbB-2 spliced message are 2–5% that observed for the wild-type erbB-2 transcript present in these mammary tissues. Although expressed in morphologically normal mammary epithelium, it is conceivable that the absolute levels of the spliced transcript are higher in tumor tissue. Once a critical threshold of this activated erbB-2 receptor has been reached, malignant transformation of the mammary epithelial cell would result. Future studies with this spliced erbB-2 isoform should allow this hypothesis to be tested.

The observation that alternative splicing can lead to activation of growth factor receptors is supported by several recent studies. For example, mutations in FGFR2 were identified in patients with Crouzon and Pfeiffer syndrome that result in the use of a novel splice donor site, causing a 51 bp (17 amino acid) deletion in the extracellular domain (Li et al., 1995; Meyers et al., 1996). A spliced form of Ron has also been described which encodes an activated receptor lacking 49 amino acids in the extracellular domain (Collesi et al., 1996). Like the erbB-2 spliced isoform, the deletion in Ron results from the removal of an entire exon, which leads to the loss of a cysteine residue in the resulting protein. Constitutive disulfide bond-stabilized dimers can be detected in cells expressing the activated Ron receptor, and these cells display an invasive phenotype in vitro (Collesi et al., 1996). Furthermore, activation of many receptor families can occur through mechanisms other than alternative splicing. Deletions in EGFR (Sugawa et al., 1990; Wong et al., 1992) and TrkA (Coulier et al., 1990), as well as point mutations in the erythropoietin receptor (Watowich et al., 1992), RET (Mulligan et al., 1993) and three of the four FGFRs (Webster and Donoghue, 1997) have been reported. In many instances, the observed mutations affect cysteine residues situated in the extracellular domain and serve to activate these receptors (Nishikawa et al., 1994; Asai et al., 1995; Santoro et al., 1995; Galvin et al., 1996; Robertson et al., 1998). Together, these observations suggest that activation of growth factor receptors through alternative splicing or mutation plays a critical role in the induction of both developmental disorders and human cancers.

Materials and methods

Top

DNA constructions

To generate the MMTV/NDL expression plasmids, cDNAs possessing two deletions that correspond to neu8142 and neu8342 (Siegel et al., 1994; Siegel and Muller, 1996) were excised from pJ4Omega (Morganstern and Land, 1990) as HindIII–EcoRI fragments and inserted into the corresponding sites of pMMTV-SV40 (p206) (Guy et al., 1992b). The erbB-3 expression plasmid contains the human cDNA inserted into pJ4Omega as a SalI fragment, whereas construction of pJ4Omega/neu8142 and pJ4Omega/neu8142 has been described previously (Siegel et al., 1994). Expression plasmids containing various human erbB-2 cDNAs were constructed by inserting each cDNA as a HindIII fragment into the corresponding site of pJ4Omega. The cDNAs encoding both wild-type and activated erbB-2 (valine to glutamic acid substitution in the transmembrane domain) were generous gifts of Nancy E.Hynes (Friedrich Miescher Institute, Basel, Switzerland). The erbB-2 (ECD DEL) mutant was generated by oligonucleotide-directed mutagenesis, and the erbB-2 (SPLICE) mutation was amplified from human breast tumor RNA. The PCR products were sequenced to ensure that only the desired mutations were present.

A plasmid containing the puromycin resistance gene under the transcriptional control of the PGK promoter was provided by Michael A.Rudnicki (McMaster University, Hamilton, Ontario, Canada). The plasmid used to generate the SV40 polyadenylation-specific riboprobe (SPA) has been described previously (pASV; Muller et al., 1988). The internal control riboprobe used to detect PGK-1 was obtained from Michael A.Rudnicki and has been described elsewhere (Siegel et al., 1994). The template plasmid used to produce the murine erbB-3 riboprobe was generated by inserting a 375 bp fragment, corresponding to nucleotides 2489–2864 of the human cDNA (Plowman et al., 1990), into the EcoRI–BamHI sites of pSL301 (Invitrogen). A pSL301 vector containing a 142 bp fragment of the murine cytokeratin-8 cDNA (nucleotides 552–694; Morita et al., 1988) was used to generate the antisense riboprobe. The erbB-2 riboprobe was constructed by inserting a 473 bp fragment, corresponding to nucleotides 2018–2491 of the human cDNA (Coussens et al., 1985), into the SphI–NdeI sites of pSL301. A 720 bp fragment of human erbB-3 (nucleotides 1661–2381; Plowman et al., 1990) was inserted into EagI–BamHI sites of pSL301 to construct the riboprobe template plasmid. An internal control plasmid (pGem-1) containing a 212 bp BamHI–SacI fragment of human beta-actin (nucleotides 1371–1583; Ng et al., 1985) was kindly provided by Ann-Marie Mes-Mason (University of Montreal, Montreal, Quebec, Canada).

Generation and identification of transgenic mice

DNA was prepared for microinjection by digestion of the MMTV/neu deletion plasmids with SalI and SpeI. The injection fragment was recovered by electroelution, subjected to sequential phenol–chloroform/chloroform extractions, ethanol precipitated and resuspended in distilled water. Six-week-old FVB/N female mice (Taconic Farms, Germantown, PA) were superovulated by an intraperitoneal (i.p.) injection with pregnant mare's serum [PMS; 5 IU in 0.1 ml of 1times phosphate-buffered saline (PBS)] followed 46–48 h later by an i.p. injection of human chorionic gonadotropin (hCG; 5 IU in 0.1 ml of distilled water). Superovulated FVB/N females were mated with FVB/N males the night before injection, and Swiss-Webster females (Taconic Farms), to be used as foster mothers, were mated with vasectomized Swiss-Webster males. The next day, FVB/N females possessing a copulation plug were sacrificed, and fertilized one-cell mouse embryos were isolated from the oviducts. The pronuclei of these zygotes were injected with 0.5–1.0 pl of the prepared injection fragment (5 mug/ml DNA solution). Following microinjection, viable eggs were transferred into the oviducts of pseudo-pregnant Swiss-Webster mice.

Transgenic progeny were identified as previously described (Webster et al., 1998). The filters were hybridized to a 794 bp fragment of the neu cDNA (nucleotides 1380–2174; Bargmann et al., 1986a) that was radiolabeled with [alpha-32P]dCTP by random priming. After identification of founder animals, routine colony maintenance was performed by PCR genotyping.

RNA analysis

RNA was isolated from mouse tissues by guanidinium thiocyanate extraction followed by cesium chloride sedimentation gradient centrifugation as previously described (Webster et al., 1998). The RNA pellet was resuspended in 100 mul of tissue resuspension buffer [5 mM EDTA (pH 8.0), 0.5% N-lauroylsarcosine, 0.7 M 2-mercaptoethanol] followed by 300 mul of sterile water that had been treated with diethyl pyrocarbonate. Following one phenol–chloroform extraction, the RNA was ethanol precipitated and the yield determined.

RNase protection assays were performed essentially as described by Webster et al. (1998) with minor modifications. Following overnight hybridization in a 40 mul volume, 300 mul of digestion buffer [300 mM NaCl, 10 mM Tris (pH 7.4), 5 mM EDTA (pH 8.0), 200 U of RNase T1, 30 mug/ml RNase A) was added to each sample and allowed to incubate at 37°C for 30 min. Upon addition of 20 mul of 10% SDS and 10 mul of proteinase K (10 mug/mul), the samples were again incubated at 37°C for 20 min. Following extraction with phenol–chloroform, the samples were ethanol precipitated in the presence of 20 mug of RNase-free tRNA and dried for 20 min in a heating block. The remaining steps were performed as outlined (Webster et al., 1998).

The reverse transcription reaction was performed as previously described (Siegel et al., 1994). After incubation at 37°C for 2 h, 1.0 mul of the reverse transcription mix was added to the following: 0.5 mul of each oligonucleotide primer (10 muM), 2.0 mul of 10times PCR buffer [200 mM Tris–HCl (pH 8.4), 500 mM KCl], 1.0 mul of 50 mM MgCl2, 1.0 mul of deoxynucleotide triphosphate (dNTP) mix (10 mM each dATP, dCTP, dGTP and dTTP), 1.0 mul of [alpha-32P]dCTP (10 muCi) and distilled water to bring the final volume to 20.0 mul. The reaction mixture was overlaid with 10.0 mul of paraffin oil and heated to 95°C for 5 min. The temperature was dropped to 80°C for 2 min and 5.0 mul of the following mixture was added to each sample: 0.1 mul of Taq DNA polymerase (Gibco-BRL), 0.5 mul of 10times PCR buffer and 4.4 mul of distilled water. PCR amplification was performed for 30 cycles of 1 min at 94°C, 30 s at 55°C and 1 min at 72°C. Both the wild-type and alternatively spliced form of erbB-2 were amplified with the following primers; AB12904 (TTTCCAGATGAGGAGGGC) and AB12903 (CGGAATTCCTGTCACCAGCTGCACCGT), which amplify the region corresponding to nucleotides 1996–2544 of the human erbB-2 cDNA (Coussens et al., 1985).

Cell culture and focus assays

Rat-1 fibroblasts were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), penicillin, streptomycin and fungizone (Gibco-BRL). Stable cell lines were derived by electroporation as described previously (Siegel et al., 1994). DNA was introduced into the Rat-1 cells at a 50:1 ratio of expression plasmid:puromycin resistance plasmid (PGK-puro), and resistant colonies were selected for 10 days in media containing puromycin (3.0 mug/ml) prior to deriving clonal cell lines.

The neu/erbB-3 focus assays were conducted by lipofectamine transfection (Gibco-BRL) following the manufacturer's instructions. One mug of each pJ4Omega expression plasmid was used for each co-transfection experiment. In those instances when only one plasmid was transfected, sheared salmon sperm DNA was included to ensure that the same amount of DNA (2 mug) was used for each condition. A total of 2times105 cells/well were seeded in 6-well plates the day prior to transfection. Once transfected, the cells were allowed to reach confluence and were then split into two 10 cm plates. The cells were maintained in culture for 12 days after reaching a monolayer. Medium (DMEM supplemented with 2% FBS, penicillin, streptomycin and fungizone) was changed every 3 days during the course of the experiment. The erbB-2 focus assays were performed essentially as described (Siegel et al., 1994), with the exception that monolayers were maintained for 12 days in DMEM supplemented with 2% FBS, penicillin, streptomycin and fungizone. Five micrograms of each pJ4Omega expression plasmid was electroporated per 1times106 cells.

Immunoprecipitation and immunoblotting

Tissue samples were ground to a powder under liquid nitrogen with a chilled mortar and pestle and lysed for 20 min on ice in TNE lysis buffer [50 mM Tris (pH 8.0), 150 mM NaCl, 1% NP-40, 2 mM EDTA (pH 8.0), 1 mM sodium orthovanadate, 10 mM sodium fluoride, 10 mug/ml aprotinin, 10 mug/ml leupeptin]. Lysates from established cell lines were prepared from 10 cm tissue culture plates once the cells had reached confluence. The cells were washed twice in ice-cold 1times PBS (140 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4) and lysed for 20 min on ice in TNE lysis buffer. Lysates were cleared by centrifugation for 10 min at 4°C and the protein concentration determined by Bradford assay (Bio-Rad).

Immunoprecipitations of lysates from mammary tissues and stable cell lines (see figure legends for the amount of total protein used in each experiment) were performed as described (Muthuswamy et al., 1994). The mouse monoclonal antibodies used to immunoprecipitate Neu (Ab–4) and erbB-2 (Ab-5) were purchased from Oncogene Research Products, Inc. erbB-3 was immunoprecipitated with a rabbit polyclonal antibody (C17) obtained from Santa Cruz Biotechnology, Inc.

Protocols for immunoblot analysis have been described in detail elsewhere (Muthuswamy et al., 1994). Total blots were performed using 50 mug of protein lysate. Neu was detected with a mouse monoclonal antibody (Ab-3) obtained from Oncogene Research Products, Inc. (1:1000). The EGFR was detected with a mouse monoclonal antibody (E12020) purchased from Transduction Laboratories (1:1000). Immunoblots for erbB-3 (C-17) and ErbB–4 (C-18) were performed with rabbit polyclonal antibodies sold by Santa Cruz Biotechnology, Inc. (1:1000). Grb–2 was detected with a rabbit polyclonal antibody (C-23) from Santa Cruz Biotechnology, Inc. (1:1000). Tissue culture supernatant from a rat monoclonal antibody (TROMA-1: Brûlet et al., 1980; Kemler et al., 1981) was used to detect cytokeratin-8 (1:50). Phosphotyrosine blots were probed with mouse anti-phosphotyrosine antibodies (PY20) obtained from Transduction Laboratories (1:1000). In each case, horseradish peroxidase-conjugated anti-mouse, anti-rabbit or anti-rat secondary antibodies (1:2500) (Jackson Laboratories) were used. Quantitative immunoblot analysis was performed using 125I-conjugated secondary antibodies.

Detection of Neu dimer formation in tumors derived from MMTV/NDL transgenic mice and erbB-2 dimer formation in established Rat-1 cell lines was performed as described previously (Siegel and Muller, 1996). Lysates from NDL mammary tumors were incubated with anti-Neu antibodies (Ab-4) while lysates from Rat-1 stable cells lines were immunoprecipitated with anti-erbB-2 antibodies (Ab-5). Protein G–Sepharose was then added and immunoprecipitations were carried out for 3 h at 4°C followed by 3–4 washes in TNE lysis buffer. Duplicate immunoprecipitates were separated by electrophoresis through 4–12% gradient SDS–polyacrylamide gels, in the presence or absence of 2–mercaptoethanol. Immunoblotting was performed with rabbit polyclonal anti-Neu antibodies (06-562) from Upstate Biotechnology.

Histological evaluation

Complete autopsies were performed, and both gross and microscopic examinations were conducted. Virgin female animals from both wild-type FVB/N and each transgenic strain were sacrificed at 6 months of age to examine the mammary tumors histologically. Tissues were fixed overnight in 4% paraformaldehyde and transferred to 70% ethanol the next day. Samples were then blocked in paraffin, sectioned at 4 mum, mounted on glass slides and stained with hematoxylin and eosin (Anatomical Pathology, McMaster University). Whole-mount analyses were also performed as described (Vonderhaar and Geco, 1979), with the exception that number three mammary fat pads were used instead of the number four glands.

Note added in proof

Kwong and Hung (1998) have recently reported a similar splice variant of HER2.



Acknowledgements

Top

We wish to thank Nancy Hynes, Ann-Marie Mes-Mason, Suhba Kannan and Michael Rudnicki for providing plasmids used in this study. We thank Brian Allore for automated DNA sequence analysis, and Dinsdale Gooden for oligonucleotide synthesis (MOBIX Central Facility, McMaster University). We are grateful to Monica Graham for technical support and to Robert Munn for photographic assistance. We are also indebted to John Hassell for his critical reading of the manuscript. This work was supported by grants awarded to W.J.M. by the Canadian Breast Cancer Research Initiative and US Army (DAMD17-94-J-4300). W.J.M. is a recipient of a Medical Research Council of Canada scientist award, and P.M.S. was supported by a studentship from the Medical Research Council of Canada.

References

Top

Abe Y, Odaka M, Inagaki F, Lax I, Schlessinger J and Kohda D (1998) Disulfide bond structure of human epidermal growth factor receptor. J Biol Chem, 273, 11150–11157. | Article | PubMed | ISI | ChemPort |

Alimandi M, Romano A, Curia MC, Muraro R, Fedi P, Aaronson SA, Di Fiore PP and Kraus MH (1995) Cooperative signaling of ErbB3 and ErbB2 in neoplastic transformation and human mammary carcinomas. Oncogene, 10, 1813–1821. | PubMed | ISI | ChemPort |

Andrulis IL et al. (1998) neu/erbB-2 amplification identifies a poor-prognosis group of women with node-negative breast cancer. J Clin Oncol, 16, 1340–1349. | PubMed | ISI | ChemPort |

Asai N, Iwashita T, Matsuyama M and Takahashi M (1995) Mechanism of activation of the ret proto-oncogene by multiple endocrine neoplasia 2A mutations. Mol Cell Biol, 15, 1613–1619. | PubMed | ISI | ChemPort |

Bacus SS, Zelnick CR, Plowman G and Yarden Y (1994) Expression of the erbB-2 family of growth factor receptors and their ligands in breast cancers. Am J Clin Pathol, 102, S13–S24. | PubMed | ISI | ChemPort |

Bargmann CI and Weinberg RA (1988) Increased tyrosine kinase activity associated with the protein encoded by the activated neu oncogene. Proc Natl Acad Sci USA, 85, 5394–5398. | Article | PubMed | ChemPort |

Bargmann CI, Hung M-C and Weinberg RA (1986a) The neu oncogene encodes an epidermal growth factor receptor-related protein. Nature, 319, 226–230. | Article | PubMed | ISI | ChemPort |

Bargmann CI, Hung M-C and Weinberg RA (1986b) Multiple independent activations of the neu oncogene by a point mutation altering the transmembrane domain of p185. Cell, 45, 649–657. | Article | PubMed | ISI | ChemPort |

Bodey B, Bodey B Jr, Groger AM, Luck JV, Siegel SE, Taylor CR and Kaiser HE (1997) Clinical and prognostic significance of the expression of the c-erbB-2 and c-erbB-3 oncoproteins in primary and metastatic malignant melanomas and breast carcinomas. Anticancer Res, 17, 1319–1330. | PubMed | ISI | ChemPort |

Bouchard L, Lamarre L, Tremblay PJ and Jolicoeur P (1989) Stochastic appearance of mammary tumors in transgenic mice carrying the MMTV/c-neu oncogene. Cell, 57, 931–936. | Article | PubMed | ISI | ChemPort |

Brûlet P, Babinet C, Kemler R and Jacob F (1980) Monoclonal antibodies against trophectoderm-specific markers during blastocyst formation. Proc Natl Acad Sci USA, 77, 4113–4117. | PubMed | ISI | ChemPort |

Cardiff RD, Sinn E, Muller W and Leder P (1991) Transgenic oncogene mice. Am J Pathol, 139, 495–501. | PubMed | ISI | ChemPort |

Cohen BD, Kiener PA, Green JM, Foy L, Fell HP and Zhang K (1996) The relationship between human epidermal growth-like factor receptor expression and cellular transformation in NIH3T3 cells. J Biol Chem, 271, 30897–30903. | Article | PubMed | ISI | ChemPort |

Collesi C, Santoro MM, Gaudino G and Comoglio PM (1996) A splicing variant of the Ron transcript induces constitutive tyrosine kinase activity and an invasive phenotype. Mol Cell Biol, 16, 5518–5526. | PubMed | ISI | ChemPort |

Coulier F, Kumar R, Ernst M, Klein R, Martin-Zanca D and Barbacid M (1990) Human trk oncogenes activated by point mutation, in-frame deletion and duplication of the tyrosine kinase domain. Mol Cell Biol, 10, 4202–4210. | PubMed | ISI | ChemPort |

Coussens L et al. (1985) Tyrosine kinase receptor with extensive homology to EGF receptor shares chromosomal location with neu oncogene. Science, 230, 1132–1139. | Article | PubMed | ISI | ChemPort |

Dudek H, Datta SR, Franke TF, Birnbaum MJ, Yao R, Cooper GM, Segal RA, Kaplan DR and Greenberg ME (1997) Regulation of neuronal survival by the serine-threonine protein kinase Akt. Science, 275, 661–664. | Article | PubMed | ISI | ChemPort |

Fedi P, Pierce JH, Di Fiore PP and Kraus MH (1994) Efficient coupling with phosphatidylinositol 3-kinase, but not phospholipase Cgamma or GTPase-activating protein, distinguishes erbB-3 signaling from that of other ErbB/EGFR family members. Mol Cell Biol, 14, 492–500. | PubMed | ISI | ChemPort |

Galvin BD, Hart KC, Meyer AN, Webster MK and Donoghue DJ (1996) Constitutive receptor activation by Crouzon syndrome mutations in fibroblast growth factor receptor (FGFR) 2 and FGFR2/Neu chimeras. Proc Natl Acad Sci USA, 93, 7894–7899. | Article | PubMed | ChemPort |

Gasparini G et al. (1994) c-erbB-3 and c-erbB-2 protein expression in node-negative breast carcinoma—an immunocytochemical study. Eur J Cancer, 30A, 16–22.

Gingras A-C, Kennedy SG, O'Leary MA, Sonenberg N and Hay N (1998) 4E-BP1, a repressor of mRNA translation, is phosphorylated and inactivated by the Akt (PKB) signaling pathway. Genes Dev, 12, 502–513. | Article | PubMed | ISI | ChemPort |

Gullick WJ, Love SB, Wright C, Barnes DM, Gusterson B, Harris AL and Altman DG (1991) C-erbB-2 protein overexpression in breast cancer is a risk factor in patients with involved and uninvolved lymph nodes. Br J Cancer, 63, 434–438. | PubMed | ISI | ChemPort |

Guy CT, Webster MA, Schaller M, Parsons TJ, Cardiff RD and Muller WJ (1992a) Expression of the neu protooncogene in the mammary epithelium of transgenic mice induces metastatic disease. Proc Natl Acad Sci USA, 89, 10578–10582. | Article | PubMed | ChemPort |

Guy CT, Cardiff RD and Muller WJ (1992b) Induction of mammary tumors by expression of polyomavirus middle T oncogene: a transgenic mouse model for metastatic disease. Mol Cell Biol, 12, 954–961. | PubMed | ISI | ChemPort |

Guy CT, Cardiff RD and Muller WJ (1996) Activated neu induces rapid tumor progression. J Biol Chem, 271, 7673–7678. | Article | PubMed | ISI | ChemPort |

Guy PM, Platko JV, Cantley LC, Cerione RA and Carraway KL III (1994) Insect cell-expressed p180erbB3 possesses an impaired tyrosine kinase activity. Proc Natl Acad Sci USA, 91, 8132–8136. | Article | PubMed | ChemPort |

Karunagaran D, Tzahar E, Beerli RR, Chen X, Graus-Porta D, Ratzkin BJ, Seger R, Hynes NE and Yarden Y (1996) erbB-2 is a common auxiliary subunit of NDF and EGF receptors: implications for breast cancer. EMBO J, 15, 254–264. | PubMed | ISI | ChemPort |

Kauffman-Zeh A, Rodriguez-Viciana P, Ulrich E, Gilbert C, Coffer P, Downward J and Evan G (1997) Suppression of c-Myc-induced apoptosis by Ras signalling through PI (3)K and PKB. Nature, 385, 544–548. | Article | PubMed | ChemPort |

Kemler R, Brulet P, Schnebelen M-T, Gaillard J and Jacob F (1981) Reactivity of monoclonal antibodies against intermediate filament proteins during embryonic development. J Embryol Exp Morphol, 64, 45–60. | PubMed | ISI | ChemPort |

Kennedy SG, Wagner AJ, Conzen SD, Jordan J, Bellacosa A, Tsichlis PN and Hay N (1997) The PI 3-kinase/Akt signaling pathway delivers an anti-apoptotic signal. Genes Dev, 11, 701–713. | Article | PubMed | ISI | ChemPort |

Khwaja A, Rodriguez-Viciana P, Wennstrom S, Warme PH and Downward J (1997) Matrix adhesion and Ras transformation both activate a phosphoinositide 3-OH kinase and protein kinase B/Akt survival pathway. EMBO J, 16, 2783–2793. | Article | PubMed | ISI | ChemPort |

Kim H-H, Sierke SL and Koland JG (1994) Epidermal growth factor-dependent association of phosphatidylinositol 3-kinase with the erbB-3 gene product. J Biol Chem, 269, 24747–24755. | PubMed | ISI | ChemPort |

Kitsberg DI and Leder P (1996) Keratinocyte growth factor induces mammary and prostatic hyperplasia and mammary adenocarcinoma in transgenic mice. Oncogene, 13, 2507–2515. | PubMed | ISI | ChemPort |

Kokai Y, Myers JN, Wada T, Brown VI, LeVea CM, Davis JG, Dobashi K and Greene MI (1989) Synergistic interaction of p185c-neu and the EGF receptor leads to transformation of rodent fibroblasts. Cell, 58, 287–292. | Article | PubMed | ISI | ChemPort |

Kraus MH, Issing W, Miki T, Popescu NC and Aaronson SA (1989) Isolation and characterization of ERBB3, a third member of the ERBB/epidermal growth factor family: evidence for overexpression in a subset of human mammary tumors. Proc Natl Acad Sci USA, 86, 9193–9197. | Article | PubMed | ChemPort |

Kulik G, Klippel A and Weber MJ (1997) Antiapoptotic signalling by the insulin-like growth factor I receptor, phosphatidylinositol 3-kinase and Akt. Mol Cell Biol, 17, 1595–1606. | PubMed | ISI | ChemPort |

Kwong KY and Hung MC (1998) A novel splice variant of HER2 with increased transformation activity. Mol Carcinogen, 23, 62–68. | Article | ISI | ChemPort |

Lemoine NR, Staddon S, Dickson C, Barnes DM and Gullick WJ (1990) Absence of activating transmembrane mutations in the c-erbB-2 proto-oncogene in human breast cancer. Oncogene, 5, 237–239. | PubMed | ISI | ChemPort |

Lemoine NR, Barnes DM, Hollywood DP, Hughes CM, Smith P, Dublin E, Prigent SA, Gullick WJ and Hurst HC (1992) Expression of the ERBB3 gene product in breast cancer. Br J Cancer, 66, 1116–1121. | PubMed | ISI | ChemPort |

Li X, Park W-J, Pyeritz RE and Jabs EW (1995) Effect on splicing of a silent FGFR2 mutation in Crouzon syndrome. Nature Genet, 9, 232–233. | Article

Lucchini F et al. (1992) Early and multifocal tumors in breast, salivary, Harderian and epididymal tissues developed in MMTV-Neu transgenic mice. Cancer Lett, 64, 203–209. | Article | PubMed | ISI | ChemPort |

Meyers GA et al. (1996) FGRF2 exon IIIa and IIIc mutations in Crouzon, Jackson–Weiss and Pfeiffer syndromes: evidence for missense changes, insertions and a deletion due to alternative RNA splicing. Am J Hum Genet, 58, 491–498. | PubMed | ISI | ChemPort |

Morgenstern JP and Land H (1990) A series of mammalian expression vectors and characterization of their expression of a reporter gene in stably and transiently transfected cells. Nucleic Acids Res, 18, 1068 | Article | PubMed | ISI | ChemPort |

Morita T, Tondella MLC, Takemoto Y, Hashido K, Ichinose Y, Nozaki M and Matsushiro A (1988) Nucleotide sequence of mouse Endo A cytokeratin cDNA reveals polypeptide characteristics of the type-II keratin subfamily. Gene, 68, 109–117. | Article | PubMed | ISI | ChemPort |

Muller WJ, Sinn E, Pattengale PK, Wallace R and Leder P (1988) Single-step induction of mammary adenocarcinoma in transgenic mice bearing the activated c-neu oncogene. Cell, 54, 105–115. | Article | PubMed | ISI | ChemPort |

Muller WJ et al. (1996) Synergistic interaction of the Neu proto-oncogene product and transforming growth factor alpha in the mammary epithelium of transgenic mice. Mol Cell Biol, 16, 5726–5736. | PubMed | ISI | ChemPort |

Mulligan LM et al. (1993) Germ-line mutations of the RET proto-oncogene in multiple endocrine neoplasia type 2A. Nature, 363, 458–460. | Article | PubMed | ISI | ChemPort |

Muthuswamy SK, Siegel PM, Dankort DL, Webster MA and Muller WJ (1994) Mammary tumors expressing the neu proto-oncogene possess elevated c-Src tyrosine kinase activity. Mol Cell Biol, 14, 735–743. | PubMed | ISI | ChemPort |

Ng S-Y, Gunning P, Eddy R, Ponte P, Leavitt J, Shows T and Kedes L (1985) Evolution of the functional human b-actin gene and its multi-pseudogene family: conservation of noncoding regions and chromosomal dispersion of pseudogenes. Mol Cell Biol, 5, 2720–2732. | PubMed | ISI | ChemPort |

Nishikawa R, Ji X-D, Harmon RC, Lazar CS, Gill GN, Cavenee WK and Su Huang H-J (1994) A mutant epidermal growth factor receptor common in human glioma confers enhanced tumorigenicity. Proc Natl Acad Sci USA, 91, 7727–7731. | Article | PubMed | ChemPort |

Padhy LC, Shih C, Cowing D, Finkelstein R and Weinberg RA (1982) Identification of a phosphoprotein specifically induced by the transforming DNA of rat neuroblastomas. Cell, 28, 865–871. | Article | PubMed | ISI | ChemPort |

Paterson MC et al. (1991) Correlation between c-erbB2 amplification and risk of recurrent disease in node-negative breast cancer. Cancer Res, 51, 556–567. | PubMed | ISI | ChemPort |

Pinkas-Kramarski R et al. (1996) Diversification of Neu differentiation factor and epidermal growth factor signaling by combinatorial receptor interactions. EMBO J, 15, 2452–2467. | PubMed | ChemPort |

Plowman GD, Whitney GS, Neubauer MG, Green JM, McDonald VL, Todaro GJ and Shoyab M (1990) Molecular cloning and expression of an additional epidermal growth factor receptor-related gene. Proc Natl Acad Sci USA, 87, 4905–4909. | Article | PubMed | ChemPort |

Plowman GD, Culouscou J-M, Whitney GS, Green JM, Carlton GW, Foy L, Neubauer MG and Shoyab M (1993) Ligand-specific activation of HER4/p180erbB4, a fourth member of the epidermal growth factor receptor family. Proc Natl Acad Sci USA, 90, 1746–1750. | Article | PubMed | ChemPort |

Press MF et al. (1993) Her-2/neu expression in node-negative breast cancer: direct tissue quantitaion by computerized image analysis and association of overexpression with increased risk of recurrent disease. Cancer Res, 53, 4960–4970. | PubMed | ISI | ChemPort |

Prigent SA and Gullick WJ (1994) Identification of c-erbB-3 binding sites for phosphatidylinositol 3'-kinase and SHC using an EGF receptor/c-erbB-3 chimera. EMBO J, 13, 2831–2841. | PubMed | ISI | ChemPort |

Quinn CM, Ostrowski JL, Lane SA, Loney DP, Teasdale J and Benson EA (1994) c-erbB-3 protein expression in human breast cancer: comparison with other tumour variables and survival. Histopathology, 25, 247–252. | Article | PubMed | ISI | ChemPort |

Rajikumar T and Gullick WJ (1994) The type I growth factor receptors in human breast cancer. Breast Cancer Res Treat, 29, 3–9. | PubMed |

Riese DJ II, van Raaji TM, Plowman GD, Andrews GC and Stern DF (1995) The cellular response to neuregulins is governed by complex interactions of the erbB receptor family. Mol Cell Biol, 15, 5770–5776. | PubMed | ISI | ChemPort |

Robertson SC, Meyer AN, Hart KC, Galvin BD, Webster MK and Donoghue DJ (1998) Activating mutations in the extracellular domain of the fibroblast growth factor receptor 2 function by disruption of the disulfide bond in the third immunoglobulin-like domain. Proc Natl Acad Sci USA, 95, 4567–4572. | Article | PubMed | ChemPort |

Rodrigues GA, Naujokas MA and Park M (1991) Alternative splicing generates isoforms of the met receptor tyrosine kinase which undergo differential processing. Mol Cell Biol, 11, 2962–2970. | PubMed | ISI | ChemPort |

Santoro M et al. (1995) Activation of RET as a dominant transforming gene by germline mutations of MEN2A and MEN2B. Science, 267, 381–383. | Article | PubMed | ISI | ChemPort |

Shih C, Padhy LC, Murray M and Weinberg RA (1981) Transforming genes of carcinomas and neuroblastomas introduced into mouse fibroblasts. Nature, 290, 261–264. | Article | PubMed | ISI | ChemPort |

Siegel PM and Muller WJ (1996) Mutations affecting conserved cysteine residues within the extracellular domain of Neu promote receptor dimerization and activation. Proc Natl Acad Sci USA, 93, 8878–8883. | Article | PubMed | ChemPort |

Siegel PM, Dankort DL, Hardy WR and Muller WJ (1994) Novel activating mutations in the neu proto-oncogene involved in induction of mammary tumors. Mol Cell Biol, 14, 7068–7077. | PubMed | ISI | ChemPort |

Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A and McGuire WL (1987) Human breast cancer: correlation of relapse and survival with the amplification of the HER-2/neu oncogene. Science, 235, 177–182. | Article | PubMed | ISI | ChemPort |

Slamon DJ et al. (1989) Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science, 244, 707–712. | Article | PubMed | ISI | ChemPort |

Soltoff SP, Carraway KL III, Prigent SA, Gullick WJ and Cantley LC (1994) ErbB3 is involved in activation of phosphatidylinositol 3-kinase by epidermal growth factor. Mol Cell Biol, 14, 3550–3558. | PubMed | ISI | ChemPort |

Stern DF, Kamps MP and Cao H (1988) Oncogenic activation of p185neu stimulates tyrosine phosphorylation in vivo. Mol Cell Biol, 8, 3969–3973. | PubMed | ISI | ChemPort |

Stewart TA, Pattengale PK and Leder P (1984) Spontaneous mammary adenocarcinomas in transgenic mice that carry and express MTV/c-myc fusion genes. Cell, 38, 627–637. | Article | PubMed | ISI | ChemPort |

Sugawa N, Ekstrand AJ, James CD and Collins VP (1990) Identical splicing of aberrant epidermal growth factor receptor transcripts from amplified rearranged genes in human gliomas. Proc Natl Acad Sci USA, 87, 8602–8606. | Article | PubMed | ChemPort |

Tzahar E, Waterman H, Chen X, Levkowitz G, Karunagaran D, Lavi S, Ratzkin BJ and Yarden Y (1996) A hierarchical network of interreceptor interactions determines signal transduction by Neu differentiation factor/Neuregulin and epidermal growth factor. Mol Cell Biol, 16, 5276–5287. | PubMed | ISI | ChemPort |

Ullrich A et al. (1984) Human epidermal growth factor receptor cDNA sequence and aberrant expression of the amplified gene in A431 epidermoid carcinoma cells. Nature, 309, 418–425. | Article | PubMed | ISI | ChemPort |

Vonderhaar BK and Greco AE (1979) Lobulo-alveolar development of mouse mammary glands is regulated by thyroid hormones. Endocrinology, 104, 409–418. | PubMed | ISI | ChemPort |

Wallasch C, Weisse FU, Niederfellner G, Jallal B, Issing W and Ullrich A (1995) Heregulin-dependent regulation of HER2/neu oncogenic signaling by heterodimerization with HER3. EMBO J, 14, 4267–4275. | PubMed | ISI | ChemPort |

Watowich SS, Yoshimura A, Longmore GD, Hilton DJ, Yoshimura Y and Lodish HF (1992) Homodimerization and constitutive activation of the erythropoietin receptor. Proc Natl Acad Sci USA, 89, 2140–2144. | PubMed | ChemPort |

Webster MA et al. (1998) Requirement for both shc and phosphatidylinositol 3' kinase signaling pathways in polyomavirus middle T-mediated mammary tumorigenesis. Mol Cell Biol, 18, 2344–2359. | PubMed | ISI | ChemPort |

Webster MK and Donoghue DJ (1997) FGFR activation in skeletal disorders: too much of a good thing. Trends Genet, 13, 178–182. | Article | PubMed | ISI | ChemPort |

Weiner DB, Kokai Y, Wada T, Cohen JA, Williams WV and Greene MI (1989a) Linkage of tyrosine kinase activity with transforming ability of the p185neu oncoprotein. Oncogene, 4, 1175–1183. | PubMed | ISI | ChemPort |

Weiner DB, Liu J, Cohen JA, Williams WV and Greene MI (1989b) A point mutation in the neu oncogene mimics ligand induction of receptor aggregation. Nature, 339, 230–231. | Article | PubMed | ISI | ChemPort |

Wong AJ, Ruppert JM, Bigner SH, Grzeschik CH, Humphrey PA, Bigner DS and Vogelstein B (1992) Structural alterations of the epidermal growth factor receptor gene in human gliomas. Proc Natl Acad Sci USA, 89, 2965–2969. | Article | PubMed | ChemPort |

Yamamoto T, Ikawa S, Akiyama T, Semba K, Nomura N, Miyajima N, Saito T and Toyoshima K (1986) Similarity of protein encoded by the human c-erb-B-2 gene to epidermal growth factor receptor. Nature, 319, 230–234. | Article | PubMed | ISI | ChemPort |

Yao R and Cooper GM (1995) Requirement for phosphatidylinositol-3 kinase in the prevention of apoptosis by nerve growth factor. Science, 267, 2003–2006. | Article | PubMed | ISI | ChemPort |

Zhang K, Sun J, Liu N, Wen D, Chang D, Thomason A and Yoshinaga SK (1996) Transformation of NIH 3T3 cells by HER3 or HER4 receptors requires the presence of HER1 or HER2. J Biol Chem, 271, 3884–3890. | Article | PubMed | ISI | ChemPort |

Zoll B, Kynast B, Corell B, Marx D, Fischer G and Schauer A (1992) Alterations of the c-erbB2 gene in human breast cancer. J Cancer Res Clin Oncol, 118, 468–473. | PubMed | ISI | ChemPort |