Comparison of suppression of the ade1-14 nonsense mutation in isogenic [ETA+], [eta-] and strong [PSI+] derivatives of SL1010-1A and SL1010-6B. Yeast cells were grown on YPD at 30°C for 4 days and on SC-Ade at 20°C for 14 days (note that [ETA+] strains grew more poorly on SC-Ade at 30°C than at 20°C). The growth on SC-Ade and the lack of red pigment on YPD indicate suppression of the ade1-14 nonsense mutation. The [eta-] derivatives were obtained from the [ETA+] strains, SL1010-1A (A) and SL1010-6B (B), either by growth on GuHCl medium (upper) or by selection for spontaneous loss of [ETA+] (lower). The strong [PSI+] derivatives were obtained in spontaneous [eta-] derivatives of SL1010-1A and SL1010-6B by transient overexpression of SUP35.
View full figure (79 KB)Article
- The EMBO Journal (1999) 18, 1182 - 1191
- doi:10.1093/emboj/18.5.1182
The yeast non-Mendelian factor [ETA+] is a variant of [PSI+], a prion-like form of release factor eRF3
Ping Zhou1, Irina L. Derkatch1, Susan M. Uptain2, Maria M. Patino2, Susan Lindquist2 and Susan W. Liebman1
- Laboratory for Molecular Biology, Department of Biological Sciences, University of Illinois at Chicago, Chicago, IL 60607, USA
- Howard Hughes Medical Institute, Department of Molecular Genetics and Cell Biology, University of Chicago, Chicago, IL 60637, USA
Correspondence to:
Susan W. Liebman, E-mail: suel@uic.edu
Received 10 August 1998; Accepted 14 January 1999; Revised 14 January 1999
Abstract
The yeast non-Mendelian factor [ETA+] is lethal in the presence of certain mutations in the SUP35 and SUP45 genes, which code for the translational release factors eRF3 and eRF1, respectively. One such mutation, sup35-2, is now shown to contain a UAG stop codon prior to the essential region of the gene. The non-Mendelian inheritance of [ETA+] is reminiscent of the yeast [PSI+] element, which is due to a self-propagating conformation of Sup35p. Here we show that [ETA+] and [PSI+] share many characteristics. Indeed, like [PSI+], the maintenance of [ETA+] requires the N-terminal region of Sup35p and depends on an appropriate level of the chaperone protein Hsp104. Moreover, [ETA+] can be induced de novo by excess Sup35p, and [ETA+] cells have a weak nonsense suppressor phenotype characteristic of weak [PSI+]. We conclude that [ETA+] is actually a weak, unstable variant of [PSI+]. We find that although some Sup35p aggregates in [ETA+] cells, more Sup35p remains soluble in [ETA+] cells than in isogenic strong [PSI+] cells. Our data suggest that the amount of soluble Sup35p determines the strength of translational nonsense suppression associated with different [PSI+] variants.
Keywords:
- [ETA],
- prion,
- [PSI],
- release factor,
- SUP35
Introduction
Introduction
Top of pageThe prion concept was originally used to describe an infectious protein, PrP, hypothesized to cause several transmissible spongiform encephalopathies, including human Kuru, Creutzfeldt–Jakob disease, mad cow disease and sheep scrapie (Griffith, 1967; Prusiner, 1982). The infectivity of prions is proposed to be due to a self-propagating protein conformation, capable of converting the normal form of the protein (PrPC) into its prion (PrPSc) conformation (for reviews see Prusiner, 1996; Caughey and Chesebro, 1997; Weissmann, 1999).
[PSI+] and [URE3] are heritable yeast factors that have been proposed to be prion-like forms of Sup35p and Ure2p, respectively (Wickner, 1994). [PSI+] causes increased read-through of stop codons with or without other nonsense suppressors (for review see Cox et al., 1988). [URE3] derepresses genes coding for nitrogen catabolic enzymes that would normally be repressed by a good nitrogen source (Aigle and Lacroute, 1975). Both [PSI+] and [URE3] exhibit a non-Mendelian pattern of inheritance and can be eliminated by stress-inducing compounds and the protein-denaturing agent guanidine hydrochloride (GuHCl) (Singh et al., 1979; Tuite et al., 1981; Aigle and Lacroute, 1975, cited by Wickner, 1994).
Genetic and biochemical evidence strongly supports the hypothesis that [PSI+] is a self-propagating conformation of Sup35p. Sup35p is the yeast homologue of the eukaryotic release factor eRF3 (a GTPase) which, together with the other release factor Sup45p/eRF1, recognizes stop codons and facilitates the release of nascent proteins from ribosomes (Frolova et al., 1994; Stansfield et al., 1995; Zhouravleva et al., 1995). Sup35p can be divided roughly into two domains. The C-terminal region (432 amino acids) is homologous to EF-1
, contains GTP-binding domains, is essential for viability (Kushnirov et al., 1988; Wilson and Culbertson, 1988; Ter-Avanesyan et al., 1993) and is probably responsible for release-factor activity. The N-terminal region (253 amino acids) is not essential for viability, but is required for [PSI+] maintenance (Doel et al., 1994; Ter-Avanesyan et al., 1994). Moreover, overexpression of this N-terminal region, as well as of the complete SUP35 gene, induces the appearance of [PSI+] de novo (Chernoff et al., 1993; Derkatch et al., 1996; Patino et al., 1996). The fact that an appropriate level of the chaperone protein Hsp104 is required for the propagation of [PSI+] suggests that [PSI+] heredity is based on a change in the conformation of Sup35p (Chernoff et al., 1995). Indeed, in [PSI+] cells Sup35p forms insoluble aggregates (Sup35PSI+), which are partially resistant to proteinase K, whereas in [psi-] cells Sup35p is soluble (Sup35psi-) (Patino et al., 1996; Paushkin et al., 1996). The aggregation of Sup35p in [PSI+] cells apparently reduces the level of functional Sup35p, providing a simple explanation for the nonsense-suppressor phenotype of [PSI+]. Sup35p or its N-terminal region, purified from Escherichia coli, forms amyloid fibers in vitro and these fibers form much more rapidly when they are 'seeded' by previously formed fibers (Glover et al., 1997; King et al., 1997). Moreover, in cell-free lysates, Sup35p can be converted from a soluble to an aggregated form characteristic of [PSI+] cells upon incubation with Sup35PSI+ (Paushkin et al., 1997a). These data support the hypothesis that the conversion of newly synthesized soluble Sup35p into aggregated Sup35PSI+ by pre-existing aggregated Sup35PSI+ is responsible for the propagation of the [PSI+] factor.
In addition to [PSI+] and [URE3] there may be other prions in yeast. Indeed, [PIN+] and [ETA+], two other GuHCl-curable non-Mendelian elements of yeast, have been proposed to be yeast prions (Wickner et al., 1996; Derkatch et al., 1997; Liebman and Derkatch, 1999), although the molecular basis of these factors is unknown. [PIN+] determines the possibility that [PSI+] can appear de novo in yeast strains (Derkatch et al., 1997). [ETA+] causes a lethal interaction with certain recessive mutant alleles of the release factors, e.g. sup35-2 and sup45-2, which themselves have a nonsense-suppressor phenotype (Liebman and All-Robyn, 1984). When an [ETA+] strain is crossed to a strain bearing either sup35-2 or sup45-2, almost all the sup35-2 or sup45-2 meiotic segregants are dead, whereas the wild-type SUP35 or SUP45 segregants are alive. This behavior of [ETA+] is reminiscent of the lethal interaction of [PSI+] with the allosuppressor mutations sal3 and sal4 (Cox, 1977), which are now known to be alleles of SUP35 (Crouzet and Tuite, 1987) and SUP45 (Crouzet et al., 1988), respectively. Unlike sup35-2 and sup45-2, the sal3 and sal4 alleles do not cause suppression by themselves but rather enhance the efficiency of the tRNA suppressor SUQ5. It was therefore suggested that both [ETA+] and [PSI+] may be related to translation termination and that [ETA+] might be a variant of [PSI+] (Liebman and All-Robyn, 1984; Wickner et al., 1996). Indeed, the existence of [PSI+] variants with various efficiencies of suppression and mitotic stability was observed in our recent study (Derkatch et al., 1996). However, earlier studies uncovered apparent differences between [PSI+] and [ETA+] (Liebman and All-Robyn, 1984): (i) [ETA+] had not been shown to cause nonsense suppression; (ii) [PSI+] was inherited by all of the meiotic progeny, but [ETA+] passed to only 70–85% of the meiotic progeny; and (iii) [ETA+] did not cause lethality in the presence of the SUP3-o and SUP11-o tRNA suppressors (Liebman and All-Robyn, 1984), but [PSI+] did (Cox, 1971). Thus, [ETA+] might be a non-Mendelian factor that is independent of [PSI+] and SUP35.
In this study, we directly tested the relationship between [ETA+] and [PSI+]. As is true for [PSI+], we found that the maintenance of [ETA+] requires the N-terminal region of Sup35p, and that the appearance of [ETA+] can be induced de novo by Sup35p overproduction. Furthermore, the level of Hsp104 is critical for [ETA+] propagation. Moreover, we observed that Sup35p aggregates in [ETA+] but not in [eta-] strain derivatives. In addition, growth inhibition caused by overexpression of SUP35 and weak nonsense suppression can be detected in [ETA+] but not in [eta-] derivatives. We conclude that [ETA+] is actually a weak, unstable [PSI+] factor.
Results
Top of page[ETA+] causes weak nonsense suppression
Previously, strong nonsense suppression was not detected in [ETA+] strains (Liebman and All-Robyn, 1984). Because the [ETA+] strains used previously did not have markers suitable for detecting weak nonsense suppression, we re-scored [ETA+] strains for suppression of nonsense mutations using the ade1-14 (UGA) marker. Two [ETA+] strains with desirable markers were constructed by a cross of the originally described [ETA+] strain SL611-17A (Liebman and All-Robyn, 1984) and [psi-] [eta-] 74-D694 using classical tetrad analysis. Two of the segregants from this cross, SL1010-1A and SL1010-6B, when crossed to the sup35-2 mutant, SL429-10B, gave rise to inviable sup35-2 meiotic progeny (0:24 and 1:13, sup35-2:SUP35 viable segregants, respectively), indicating the presence of [ETA+]. Throughout this paper, only these strains and the [ETA+] strains originally described by Liebman and All-Robyn (1984) will be referred to as [ETA+]. The level of ade1-14 nonsense suppression in both SL1010-1A and SL1010-6B was weak but unambiguous (Figure 1): they were pink (instead of red) on YPD medium after 3–4 days of incubation at 30°C and grew on SC-Ade medium after 10–14 days of incubation at 20°C.
Next, we tested the ability of GuHCl to 'cure' the suppressor phenotype in these strains. Passage on plates containing GuHCl was previously shown to eliminate both [ETA+] and [PSI+] (Tuite et al., 1981; Liebman and All-Robyn, 1984). After SL1010-1A and SL1010-6B strains were grown for
21 cell generations on YPD containing 5 mM GuHCl, their color changed from pink to red and they no longer grew on SC-Ade (Figure 1). The absence of [ETA+] in GuHCl-treated derivatives was confirmed by crossing them to a sup35-2 mutant: the sup35-2 progeny were viable. Suppression was also occasionally lost spontaneously (Figure 1), and this was correlated with the loss of [ETA+]: a cross of a spontaneous non-suppressor (red) colony to a sup35-2 mutant gave rise to viable sup35-2 progeny. These results demonstrate that both SL1010-1A and SL1010-6B contain [ETA+] and that [ETA+] is associated with weak nonsense suppression.
The N-terminal region of SUP35 is required for the maintenance of [ETA+]
The C-terminal region of Sup35p (amino acids 254–685) is essential for cell growth, whereas deletion of the N-terminal region (amino acids 1–253) is viable but cannot maintain [PSI+] (Ter-Avanesyan et al., 1994). If [ETA+], like [PSI+], is a prion form of Sup35p, then deletion of the N-terminal region of SUP35 should eliminate [ETA+].
The N-terminal region of SUP35 was deleted by the method of integration and excision in the [ETA+] strain, SL1010-1A (see Materials and methods). Following the excision step, derivatives that retained the intact SUP35 gene as opposed to the SUP35-
N allele, were used as controls. These SUP35 wild-type control derivatives maintained pink color on YPD and caused lethality when combined with sup35-2 (Table I), indicative of [ETA+]. In contrast, the three independent SUP35-
N derivatives were all red on YPD. Moreover, when crossed to a sup35-2 mutant, they produced viable meiotic progeny containing sup35-2 (Table I). This clearly shows that the SUP35-
N derivatives became [eta-]. Thus, the N-terminal region of the SUP35 gene is required for [ETA+] propagation.
The level of Hsp104 is crucial for [ETA+] maintenance
Another characteristic of [PSI+] is that it is cured by either deletion or overexpression of the chaperone protein Hsp104 (Chernoff et al., 1995). To test whether Hsp104 affects the propagation of [ETA+], four independent disruptions of the HSP104 gene were made in the [ETA+] strain, SL611-17A (see Materials and methods). Analyses of crosses to a sup35-2 mutant established that all four hsp104-
::LEU2 disruption derivatives lost the [ETA+] phenotype, whereas the wild-type HSP104 control strain remained [ETA+] (Table II). This demonstrates that Hsp104 is required for [ETA+] maintenance.
To investigate the effects of overexpression of the HSP104 gene on [ETA+], plasmid pYS-Gal104, containing the HSP104 gene under the control of the galactose-inducible promoter, GAL1, was introduced into two ade1-14 strains containing [ETA+], SL1010-1A and SL1010-6B. Transformants were pink on YPD following growth on glucose medium without uracil, where the plasmid was under selection but the GAL promoter was repressed. In contrast, almost all cells were red on YPD following transient growth on galactose medium without uracil, where overexpression of HSP104 was induced. Following these treatments and colony purification on YPD, colonies from SL1010-1A and SL1010-6B were crossed to the tester strain SL429-10B containing sup35-2 and their meiotic progeny were analyzed (Table III). Clearly, [ETA+] was eliminated by transient growth on galactose but not glucose. When the pRS416 control plasmid lacking the HSP104 gene was used, [ETA+] was not eliminated either by growth in glucose or galactose media (data not shown). Thus, either deletion or overexpression of the HSP104 gene causes the loss of [ETA+].
Overexpression of SUP35 can induce [ETA+]-like factors
It has been shown that [PSI+] can be induced de novo by Sup35p overproduction in certain strains (Chernoff et al., 1993; Derkatch et al., 1996). We tested whether overexpression of SUP35 can also induce the appearance of [ETA+]-like factors. A spontaneous [eta-] derivative of SL1010-1A was transformed with a SUP35-bearing plasmid, pEMBL-SUP35, or the control plasmid, pEMBL-yex4. Transformants were first selected on SC-Ura and subsequently plated on YPD to allow for plasmid loss. White and pink colonies with increased efficiency of ade1-14 nonsense suppression (Ade+) were observed in plasmidless derivatives of pEMBL-SUP35 transformants but not pEMBL-yex4 transformants. Nonsense suppression in both white and pink colonies (indicative of strong [PSI+] and weak [PSI+] or [ETA+], respectively) was curable by growth on 5 mM GuHCl medium. Two pink Ade+ derivatives of pEMBL-SUP35 transformants, as well as two Ade- derivatives of pEMBL-yex4 transformants, were crossed to a sup35-2 strain, SL429-10B, to score for [ETA]. Analysis of their progeny shows that the two Ade+ colonies contained a factor that was lethal in combination with sup35-2 (0:17 and 0:16 sup35-2:SUP35 viable segregants, respectively), whereas the two Ade- control clones did not contain such a factor (15:16 and 16:15, sup35-2:SUP35 viable segregants, respectively). Therefore, like [PSI+], [ETA+] factors can be obtained de novo by transient overexpression of SUP35.
Overexpression of the SUP35 gene causes weak growth inhibition in [ETA+] strains
Overexpression of the SUP35 gene severely inhibits the growth of [PSI+] strains, and plasmids carrying SUP35 are very unstable in [PSI+] strains (Chernoff et al., 1988, 1992; Dagkesamnskaya and Ter-Avanesyan, 1991; Derkatch et al., 1996). Similarly, an instability of SUP35-containing plasmids in [ETA+] strains was noticed previously, although SUP35 overexpression did not cause any visible inhibition of growth (Dagkesamnskaya and Ter-Avanesyan, 1991). Here we re-examined the effects of overexpression of SUP35 on the growth of [ETA+] strains.
A centromeric plasmid, pGal-SUP35, or a control plasmid, YCp50, was introduced into [ETA+] SL1010-1A and into [eta-] derivatives obtained on GuHCl, in which [PSI+] cannot be induced. All transformants grew well on glucose medium lacking uracil, where the plasmid was under selection but the GAL promoter was repressed. However, on galactose medium lacking uracil, where overexpression of SUP35 was induced, growth inhibition was observed in the [ETA+], but not in any of the [eta-] derivatives (Figure 2). When the experiment was repeated with the [ETA+] strain SL1010-6B, a slight inhibition of growth by SUP35 overexpression was observed but only within 3 days at 30°C.
Figure 2.
Growth of an [ETA+] strain is inhibited by overexpression of the SUP35 gene. [ETA+] SL1010-1A and an [eta-] derivative obtained on GuHCl were transformed with the indicated plasmids. Spots show growth of representative transformants on SC-Ura medium where the GAL::SUP35 is repressed, and on SGal-Ura medium where the GAL::SUP35 is induced. Incubation was at 30°C for 5 days.
View full figure (47 KB)Interestingly, when both SL1010-1A and SL1010-6B [ETA+] cells transformed with pGal-SUP35 were replica plated from galactose medium lacking uracil to glucose medium lacking adenine and colony purified, some colonies showed stronger suppression than the untransformed strains. Furthermore, this increase in suppression was sometimes maintained even after the pGal-SUP35 plasmid was lost. Since this suppression was cured in both strains by growth on 5 mM GuHCl medium, it suggests that strong [PSI+] factors appeared.
[ETA+] strains contain less soluble Sup35p than [eta-] strains but more than strong [PSI+] strains
The physical state of Sup35p is strikingly different in [PSI+] and [psi-] cells. Sup35p is soluble in [psi-] cells and functions normally in translation termination; however, in [PSI+] cells, the majority of Sup35p is in large aggregates where it is presumably unable to participate in translation termination (Patino et al., 1996; Paushkin et al., 1996). To examine the physical state of Sup35p in [ETA+] cells, we compared the solubility of Sup35p in lysates from isogenic SL1010-1A derivatives containing [ETA+], strong [PSI+] or lacking both elements using differential centrifugation (see Materials and methods; Figure 3A). In each case, the sedimentation of ribosomal protein L3 was independent of the yeast strain used. In addition, no difference in protein amount or composition between corresponding sucrose-cushion fractions from the different derivatives was detected by Coomassie Blue staining of the transfer membrane with the exception of lane 15 which appears to be slightly underloaded (Figure 3A). Unlike the ribosomal proteins, the distribution of Sup35 differed between the individual isogenic cell lysates, particularly in the top and pellet fractions. As expected, the majority of Sup35p from [eta-] cells was soluble and was found in the top sucrose-cushion fraction (Figure 3A, lane 24). Notably, less Sup35p was soluble in [ETA+] cells than in [eta-] cells (Figure 3A, compare lane 16 with 24), and more Sup35p was found in the pellet fraction of lysates from [ETA+] than from [eta-] cells (Figure 3A, compare lane 10 with 18). Thus, Sup35p forms aggregates in [ETA+] cells. However, the extent or type of aggregation in [ETA+] cells differs from that in [PSI+] cells since we observed more Sup35p in the pellet fraction (Figure 3A, lanes 2 and 26) and less in the top fraction from [PSI+] cells (Figure 3A, lanes 8 and 32).
Figure 3.
An [ETA+] strain contains more soluble Sup35 protein than isogenic [PSI+] strains, but less than an [eta-] strain. (A) Analysis of Sup35p solubility in SL1010-1A derivatives by differential centrifugation: the fractionation of Sup35 from four isogenic [ETA] and [PSI] strains was analyzed by differential centrifugation. Upper panel: immunoblots of sucrose-cushion fractions probed with either Sup35p or L3 antisera. Lanes 1, 9, 17 and 25 (load) represent the composition of total proteins layered on the sucrose cushion. Lanes 2, 10, 18 and 26 contain proteins found in the pellet fraction. Lanes 8, 16, 24 and 32 contain proteins from the top fraction. The other lanes represent intermediate (left) to upper (right) sucrose-cushion fractions, from bottom to top. Lower panel: Coomassie Blue-stained PVDF membranes. The phenotype and origin of the [ETA] and [PSI] strains are indicated above the immunoblots. The [eta-] derivative arose by spontaneous loss of [ETA+] in SL1010-1A. The two [PSI+] strains were obtained by transient overexpression of SUP35 either in [ETA+] SL1010-1A (leftmost) or in [eta-] SL1010-1A (right-most). (B) Semi-quantitative Western dot-blot analysis: the total protein from top sucrose-cushion fraction of each strain (lanes 8, 16, 24 and 32 of Figure 3A) was adjusted to 0.66 mg/ml, serially diluted in 2-fold increments and applied to a PVDF membrane. Left, reactivity with Sup35p antisera. Right, the same membrane stained by Ponceau S, a non-specific protein stain. The phenotype and origin of the strains are indicated on the left.
View full figure (61 KB)To determine more quantitatively the relative amounts of soluble Sup35p in these isogenic strains, we performed semi-quantitative Western dot-blot analysis using the top fraction from each sucrose cushion (see Materials and methods). The fractions were adjusted to contain equivalent amounts of protein, serially diluted and then spotted on a membrane. Ponceau S staining of the membrane demonstrated that equivalent amounts of protein were applied for each of the dilution series (Figure 3B). The amount of Sup35p, however, was not equivalent. We estimate that there was
50-fold more soluble Sup35p in [ETA+] cells than in [PSI+] cells and
200-fold more soluble Sup35p in [eta-] cells than in [PSI+] cells. The intermediate level of soluble Sup35p in [ETA+] cells compared with either strong [PSI+] or [eta-] correlates well with the intermediate degree of nonsense suppression exhibited by [ETA+] cells.
To visualize the aggregates of Sup35p in living yeast cells, plasmid pCUPSUP35GFP containing a SUP35–GFP fusion was transformed into isogenic [ETA+], strong [PSI+] and [eta-] derivatives of both SL1010-1A and SL1010-6B. In [eta-] transformants of both strains, when SUP35-GFP transcription was induced with 5
M CuSO4 for 4 h, fluorescence was evenly distributed in >94% of the cells. The remaining cells contained intense fluorescent foci, probably due to the induction of [PSI+] de novo (Patino et al., 1996). In contrast, 60–90% of the fluorescent cells of isogenic [ETA+] derivatives transformed with SUP35–GFP showed intense fluorescent foci after 4 h of induction (Figure 4). As expected, intense fluorescent foci were also observed in the [PSI+] cells (Figure 4). When GFP not fused to SUP35 was induced for 4 h, fluorescence was diffusely distributed in [ETA+], [PSI+] and [eta-] transformants.
Figure 4.
The SUP35–GFP fusion protein forms aggregates in [ETA+] and [PSI+] strains. The fluorescent images of the cells of the indicated strains transformed with pCUPGFP (GFP) or pCUPSUP35GFP (SUP35GFP) were taken after 5
M CuSO4 was added to early log-phase cultures and incubation continued for 4 h.
These results suggest that pre-existing Sup35p aggregates promote the aggregation of newly synthesized Sup35p in [ETA+] strains. However, since SUP35 overexpression in [ETA+] strains might induce the appearance of [PSI+], it was necessary to rule out the possibility that the Sup35–GFP aggregation observed in the [ETA+] strains was caused by newly appearing [PSI+]. [ETA+] cells were plated on YPD following 4 h of induction by 5
M CuSO4 and were analyzed for the appearance of strong [PSI+], scored as more efficient nonsense suppression than that in the original [ETA+] strain (see Materials and methods). Strong [PSI+] appeared in 0.8–2% of these [ETA+] pCUPSUP35GFP transformants. When [eta-] pCUPSUP35GFP transformants were analyzed, the appearance of [PSI+] was <3%. Thus the majority of aggregates seen in the [ETA+] derivatives were caused not by newly induced [PSI+] but by pre-existing [ETA+].
The lethality caused by the combination of [ETA+] and the sup35-2 mutation cannot be rescued by excess Sup45p
The above experiments establish that [ETA+] is a variant of [PSI+]. To investigate the mechanism by which the [ETA+] and sup35-2 combination causes lethality, we tested if this lethality could be overcome by overexpression of SUP45. This seemed possible since some data suggest that eRF1 (Sup45p) is the only release factor that is indispensable for translation termination while eRF3 (a Sup35p homologue) only stimulates the eRF1 activity (Frolova et al., 1994; Zhouravleva et al., 1995; Drugeon et al., 1997; Le Goff et al., 1997).
Meiotic progeny from crosses of the sup35-2 strain SL1020-3C and transformants of [ETA+] strain SL1010-1A, carrying SUP45 plasmids with moderate (YEp13-SUP45) or high (pJDB-SUP45) copy number, showed the typical [ETA+] phenotype (0:17 and 0:33, sup35-2:SUP35 viable segregants, respectively). Since the YEp13-SUP45 and pJDB-SUP45 plasmids were retained in 50–60% and nearly 100% of the viable meiotic progeny, respectively, it is clear that neither moderate nor high-level SUP45 overexpression can prevent the lethal interaction between [ETA+] and sup35-2. We also showed that Sup45p overproduction at high or moderate levels is unable to rescue a deletion of SUP35 in a [psi-] [eta-] background (J.Kuna, I.L.Derkatch and S.W.Liebman, unpublished data).
The sup35-2 suppressor contains a UAG mutation
To understand the basis for the lethality of [ETA+] and [PSI+] with the sup35-2 allele, we compared the sequences of the SUP35 and sup35-2 open reading frames (ORFs). There was a single nucleotide change (T
A) between the wild-type SUP35 and the suppressor sup35-2 ORFs. This mutation substitutes a UAG stop codon for the leucine residue at amino acid position 110. Because amino acids 254–685 of Sup35p are essential for viability (Ter-Avanesyan et al., 1993), the sup35-2 mutant strain should only be viable if the UAG codon was efficiently read through and/or if translation were initiated downstream of the UAG. To clarify this, Western blot analyses were performed on crude yeast lysates prepared from the wild-type (L475) and sup35-2 (SL429-10B) strains using antibodies specific for either amino acids 137–151 (M) or for amino acids 87–102 (N) (data not shown). In both lysates, both antibodies reacted with a protein corresponding to full-length Sup35p. Notably, Sup35p was expressed at a lower level in the sup35-2 strain than in the wild-type strain. Another polypeptide, found only in the sup35-2 lysate, migrated at
12 kDa and reacted with N antibody, but not with M antibody. This protein is presumably the prematurely terminated, 109 amino-acid Sup35p fragment. The signal from the
12 kDa protein was much weaker than that of the full-length protein, indicating that the truncated protein was present at a much lower steady-state concentration than Sup35p.
Discussion
Top of pageWe have linked the inheritance of the [ETA+] factor, a non-Mendelian, heritable element in yeast, to an altered self-propagating prion-like conformation of Sup35p. First, deletion of the N-terminal region of SUP35 caused the loss of [ETA+]. Secondly, [ETA+] caused nonsense suppression. Thirdly, Sup35p formed aggregates in [ETA+] but not in [eta-] cells. Fourthly, transient SUP35 overexpression induced the appearance of [ETA+] de novo. Fifthly, moderate SUP35 overexpression inhibited growth of [ETA+] cells but not [eta-] strain derivatives. Sixthly, an appropriate level of the chaperone protein Hsp104 was required for the propagation of [ETA+] but not for the normal function of Sup35p. Earlier observations that [ETA+] is characterized by a non-Mendelian pattern of inheritance and can be cured by low concentrations of GuHCl (Liebman and All-Robyn, 1984) also support this argument. Thus, [ETA+] shares all the notable features of [PSI+] and therefore should be considered a variant of [PSI+].
Several aspects of [ETA+] distinguish it from previously described strong [PSI+] variants. For example, nonsense suppression was weaker in [ETA+] than in [PSI+] cells. [ETA+] was less stable in mitosis and meiosis than [PSI+], and the growth of [ETA+] cells was only moderately inhibited in the presence of excess Sup35p. Recently, it was reported that weak variants of [PSI+] exhibiting weak nonsense suppression efficiencies and reduced mitotic stabilities could be induced de novo in isogenic cells by Sup35p overproduction (Derkatch et al., 1996). Thus, we conclude that [ETA+] is also a weak variant [PSI+].
The intermediate level of soluble Sup35p in [ETA+] cells compared with either strong [PSI+] or [eta-] correlated well with the intermediate degree of nonsense suppression exhibited by [ETA+] cells. This result suggests a possible biochemical explanation for the phenotypic difference between strong and weak [PSI+] variants: the larger the fraction of the soluble Sup35p, the more efficient the translational termination and the weaker the nonsense suppression phenotype.
Currently, there are two major models for how prions are propagated, and our data can be interpreted within the framework of either. According to the seeded-nucleation model, the propagation of prions involves the joining of non-prion protein with a pre-existing prion aggregate (Jarret and Lansbury, 1993). The dimerization model postulates that the non-prion molecule acquires the prion conformation during transient interaction with another protein in the prion conformation and that aggregation, when it occurs, is a secondary process (Cohen et al., 1994). If the seeded-nucleation model, favored by some investigators of [PSI+] (Paushkin et al., 1997a), is correct, then [PSI+] variants may differ in the efficiency with which the normal form of Sup35p joins the [PSI+] aggregates or in the stability of [PSI+] aggregates themselves. Indeed, 50-fold more Sup35p remained soluble in [ETA+] cells than in isogenic [PSI+] cells (see Figure 3). In the context of the dimerization model, different efficiencies of translation termination could be due to different levels of inactivation of soluble Sup35p upon conformational change before it goes into an aggregate. This might reflect the existence of different soluble Sup35PSI+ conformations with different aggregational properties in weak and strong [PSI+] variants. Note that other models could also be devised that would also accommodate our data.
Although most models for [PSI+] focus on the changes in the Sup35p protein, it is important to consider the effect of other proteins. [ETA+] and [PSI+] may differ because the type or amount of other proteins associated with the Sup35PSI+ aggregates are different. Indeed, it has been reported that Upf1p, which functions in nonsense-mediated mRNA decay, and Sup45p, the translational release factor eRF1, are found in [PSI+] aggregates (Paushkin et al., 1997b; Czaplinski et al., 1998) and that excess Sup45p reduces the appearance of [PSI+] de novo (Derkatch et al., 1998). Such co-aggregated proteins could change the stability of the aggregates, and thereby alter the levels of soluble Sup35p.
Our previous findings that UAG tRNA suppressors antisuppress sup35-2 suggested that the sup35-2 allele might contain a UAG nonsense mutation (Song and Liebman, 1985). Indeed, we now show that sup35-2 encodes a UAG mutation at codon 110, near the end of the [PSI+] prion domain. Since the C-terminal region of SUP35 is essential for viability (Ter-Avanesyan et al., 1993), one might expect a nonsense mutation near the beginning of the gene to be lethal unless it is frequently read through or unless ribosomes reinitiate translation further downstream. Indeed, Western blot analyses support the former explanation since there was considerable expression of the full-length protein in sup35-2 strains. One reason for the readthrough of the stop codon is that it is followed by a cytidine residue. UAGC has been shown to be misread as sense three- to 10-times more frequently than other tetranucleotide stop codons in Saccharomyces cerevisiae (Bonetti et al., 1995). Likewise, the non-acidic Asn codon at the -2 position relative to the UAG places this stop codon in a context that is inefficient for termination (Mottagui-Tabar et al., 1998). In addition, although some full-length Sup35p was present in the sup35-2 strain, there was less of it in the mutant strain than in the wild-type strain. This also contributes to the nonsense suppression phenotype of the sup35-2 strain: reduced levels of eRF3 result in increased suppression of all stop codons, including the UAG mutation in sup35-2.
We have also investigated the relationship between the sup35-2 allele and [PSI+] variants. In crosses between the sup35-2 strain and [ETA+] strains or other [PSI+] variants in SL1010-1A and other genetic backgrounds, almost all of the sup35-2 meiotic progeny die (Liebman and All-Robyn, 1984; this study; our unpublished observations). Such a lethal interaction may be explained if the low level of Sup35p in sup35-2 segregants is sequestered into prion-induced aggregates. This would further reduce the amount of eRF3, causing it to fall below the level required to sustain viability in the sup35-2 spores. This hypothesis of the lack of soluble Sup35p causing lethality is consistent with our finding that excess Sup45p fails to rescue [ETA+] sup35-2 spores.
The presence of the truncated Sup35p1-109 polypeptides in sup35-2 strains may explain an interesting paradox. [ETA+] is not very stable in meiosis and 15–30% of SUP35 segregants are [eta-] (Liebman and All-Robyn, 1984). Thus, one would expect 15–30% of the sup35-2 segregants of an [ETA+] SUP35/sup35-2 heterozygous diploid to be viable. Instead, almost all the sup35-2 segregants die. This is likely because Sup35p1-109 adopts the [ETA+] conformation more easily than the complete Sup35p (Derkatch et al., 1996; Kochneva-Pervukhova et al., 1998). Thus, all the sup35-2 progeny would retain [ETA+] and would die. However, the SUP35 progeny would lose [ETA+] at an appreciable frequency because they do not synthesize Sup35p1-109.
Finally, we note that a strong [PSI+] variant appeared in [ETA+] strains following transient overexpression of SUP35. Although excess Sup35p causes growth inhibition in [ETA+] strains, the cells still grow. The strong [PSI+] induced in [ETA+] strains could be formed (i) de novo from newly synthesized Sup35ppsi- and coexist with [ETA+], (ii) de novo after [ETA+] was lost because [ETA+] is not stable, or (iii) by converting the pre-existing Sup35ETA+ conformation into a strong Sup35PSI+ conformation. We also noticed that strong [PSI+] is dominant over [ETA+] in diploids (unpublished data; Derkatch et al., 1999). These results raise the interesting questions of whether one prion conformation can be converted into another prion conformation, and whether two prion conformations can coexist.
Materials and methods
Top of pageStrains and plasmids
SL1010-1A ([ETA+] MAT
ade1-14 met8-1 leu2-1 his5-2 trp1-1 ura3-52) and SL1010-6B ([ETA+] MAT
ade1-14 met8-1 leu2-1 his5-2 trp1-1 ura3-52 lys2-1) were derived from a cross between the previously described [ETA+] strain, SL611-17A ([ETA+] MAT
met8-1 leu2-1 his5-2 trp1-1 lys2-1; Liebman and All-Robyn, 1984) and a [psi-] [eta-] derivative of strain 74-D694 (MATaade1-14 leu2-3,112 his3-
200 trp1-289 ura3-52) (Chernoff et al., 1995). The [eta-] SL1010-1A and [eta-] SL1010-6B derivatives were obtained either by 5 mM GuHCl treatment or by selecting for spontaneous loss of [ETA+] during subcloning. The former were shown to be [pin-] (not inducible to [PSI+] by overexpression of SUP35), while the latter were shown to be [PIN+] (inducible to [PSI+] by overexpression of SUP35) (Derkatch et al., 1997). Using the suppression phenotype to score for [ETA+], we estimated that the frequency of spontaneous loss of [ETA+] during subcloning was <3% in SL1010-1A and 2–8% in SL1010-6B. [PSI+] derivatives of SL1010-1A and SL1010-6B, which exhibited strong nonsense suppression, were obtained by transient overexpression of SUP35 in either [ETA+] or [eta-] derivatives.
Deletions of the region of SUP35 encoding amino acid residues 1–253 of Sup35p in the [ETA+] derivatives of SL1010-1A and SL1010-6B were constructed using plasmid pEMBL-
3ATG (Table IV) by the method of integration and excision (Rose et al., 1990). Following the excision step, either the SUP35-
N deletion or the wild-type SUP35 allele was retained and these were distinguished by PCR analysis using primers CACTTCTTACCTTGCTCTTA and TGAGAGGTGAAGTTTACTTG. To obtain hsp104-
::LEU2 mutants, a PvuI–HindIII fragment containing an hsp104-
::LEU2 disruption from plasmid pYABL5 (Chernoff et al., 1995) was used to replace the HSP104 allele in SL611-17A by the one-step gene replacement method (Rothstein, 1983). Disruptions were verified by PCR analysis using two sets of primers: (i) CCTTCAAGACGCTGCTAAGA and GAGTCGGCATCTTCATCTCT, homologous to the HSP104 gene; (ii) GCGCAGATCTAACTGTGGGAATACTCAGG, homologous to LEU2 and GAGTCGGCATCTTCATCTCT, homologous to HSP104.
Other strains used in this study are SL1020-3C (MATaade1-14 met8-1 leu2-3, 112 trp1-1 lys2-1 ilv1-1 ura3-52 sup35-2, [psi-] [eta-]), SL429-10B (MATaade3-26 met8-1 leu2-1 his5-2 trp1-1 lys1-1 aro7-1can1-132 cyc1-176 ilv1-1 sup35-2, [psi-] [eta-]) and L475 (Liebman and Cavenagh, 1980) which contains the wild-type SUP35 allele from which the sup35-2 mutation was induced.
Plasmids used in this study are listed in Table IV. Yeast transformation was according to Ito et al. (1983).
Media and growth conditions
Standard yeast media were used (Sherman et al., 1986). Yeast strains were grown at 30°C unless specified. Transformants were grown in synthetic media selective for plasmid maintenance. To eliminate [ETA+] or [PSI+], cells were replica plated three times on YPD medium supplemented with 5 mM GuHCl and then colony purified on YPD. The GAL1 promoter was induced by growth on appropriate synthetic media where 20 mg/ml galactose was the single carbon source (e.g. SGal-Ura). The CUP1 promoter was induced by growth on appropriate synthetic media supplemented with 5
M CuSO4.
Genetic methods
Standard yeast genetic procedures of crossing, sporulation and tetrad analysis were used (Sherman et al., 1986). The sup35-2 mutation was scored by suppression of the met8-1 (UAG) or leu2-1 (UAA) nonsense mutations on synthetic complete medium lacking methionine (SC-Met) or leucine (SC-Leu), respectively. Strains were scored for [ETA+] by crossing to a sup35-2 containing tester strain. If most of the tetrads had only two viable spores and none or only a few of the sup35-2 segregants were viable in comparison with the wild-type SUP35 segregants, the strains were scored as [ETA+] (Liebman and All-Robyn, 1984). Suppression of ade1-14 (UGA) was used to score for [PSI+] as previously described (Derkatch et al., 1996) and was also used to score for [ETA+] in this study. The better the growth on SC-Ade medium and the less red the color on YPD medium, the higher the suppression of the ade1-14 mutation.
PCR amplification and sequencing of sup35-2 and Western analysis of Sup35-2p
Yeast genomic DNA (Hoffman and Winston, 1987) was PCR amplified using Vent DNA polymerase (New England BioLabs, Beverly, MA). DNA used for coding-strand sequence was generated using oligonucleotides (Research Genetics, Huntsville, AL) Bal2-1, CTCACTAGTCATATGTCGGATTCAAACCAAGG and Sup35C-3BamH1, CGCGGATC- CTTACTCGGCAATTTTAAC. DNA used for non-coding strand sequence was generated using oligonucleotides SMU3, CGGAGCTCCAAAGCTCCCATTGCTTCTG and SMU4, CGGGATCCGAAAACGTGATTGAAGGAGTTG. To minimize the possibility of PCR-generated sequencing errors, eight independent amplification reactions were pooled for both the coding and non-coding strand sequencing reactions. Sequencing (Sanger et al., 1977), which was performed by the University of Chicago Cancer Research Center DNA Sequencing Facility, was obtained for both strands of the SUP35 or sup35-2 alleles from L475 and SL429-10B, respectively. Western analyses of total protein extracts were as described by Patino et al. (1996) and rabbit Sup35p affinity-purified antipeptide polyclonal antibodies to amino acids 137–151 (M) (Patino et al., 1996) and amino acids 87–102 (N) (Quality Controlled Biochemicals, Hopkinton, MA) were used.
Analysis of Sup35p aggregates
Differential sedimentation and Western blot analyses were performed as described by Paushkin et al. (1996) with modifications. [PSI+], [ETA+] and [eta-] [psi-] derivatives of SL1010-1A were grown in YPD at 25°C to a density of 4–5
107 cells/ml. Harvested cells were suspended in buffer A [25 mM Tris–HCl pH 7.5, 100 mM NaCl, 5 mM MgCl2, 1 mM dithiothreitol (DDT), 4% v/v glycerol, 4 mM Pefabloc, 5
g/ml aprotinin and 5
g/ml leupeptin]. Cells were lysed using acid-washed glass beads and a BioSpec bead beater at 6°C. The crude lysates were partially clarified by differential centrifugation at 4000 g for 20 min at 4°C. Total protein (2 mg) of each supernatant fraction was layered upon 30% w/v sucrose in buffer A and centrifuged at 200 000 g for 34 min in a Beckman SW60 rotor. Fractions of 200
l were then drawn from the top of the sucrose cushion. The pelleted proteins were resuspended in 200
l of 30% sucrose in buffer A. To follow the fractionation of Sup35p, 20
g total protein from each fraction was resolved by 7.5% SDS–PAGE, transferred to PVDF membranes, immunoblotted with rabbit Sup35p antipeptide polyclonal serum to amino acids 137–151 (Patino et al., 1996) and a mouse monoclonal antibody raised against ribosomal protein L3 (gift from J.Warner, Albert Einstein College of Medicine, NY), and visualized by enhanced chemiluminescence (ECL).
To estimate more precisely the relative amount of Sup35p in the uppermost [PSI] and [ETA] sucrose-cushion fractions, semi-quantitative Western dot-blot analysis was performed as follows. The total protein from the top fraction was normalized to 0.66 mg/ml and then serially diluted in 2-fold increments. Protein concentration was determined by Bradford protein assay using BSA as standard. The diluted protein, which ranged from 100 to 0.78
g total protein, was applied to PVDF membranes using a Dot Blot apparatus (V&P Scientific, Inc.). The membrane was immunoblotted with the Sup35p antisera and visualized by ECL. The amount of total protein per dot was assessed by staining the PVDF membrane with Ponceau S.
To visualize Sup35p aggregates in vivo, isogenic [ETA+] and [eta-] SL1010-1A and SL1010-6B were transformed with the pCUPSUP35GFP or the control pCUPGFP plasmid. Transformants were grown to early log phase (OD600 = 0.2–0.4) in SC-Ura medium selective for plasmid maintenance. CuSO4 was added to a final concentration of 5
M. After 4 h of growth, samples were taken for observation under a fluorescence microscope, Axioskop (Carl Zeiss, Inc).
Induction of the appearance of [PSI+] de novo
The induction of [PSI+] by SUP35-carrying plasmids pGal-SUP35 and pEMBL-SUP35 in strains SL1010-1A and SL1010-6B was tested essentially as described previously (Derkatch et al., 1996). The appearance of Ade+ derivatives with GuHCl-curable nonsense suppression following transient overexpression of SUP35 indicated the appearance of [PSI+] in [eta-] strains. When the analysis was carried out in [ETA+] strains, the appearance of derivatives that, following plasmid loss, had a higher level of GuHCl-curable nonsense suppression than in the original [ETA+] strains, indicated the appearance of strong [PSI+].
To determine the frequency of the de novo appearance of [PSI+] caused by plasmid pCUPSUP35GFP bearing the SUP35–GFP fusion after Cu2+ induction, transformants grown in liquid SC-Ura medium containing 5
M CuSO4 for 4 h were plated on YPD (80–200 cells/plate). Colonies with a higher level of ade1-14 suppression (whiter color) than the control pCUPGFP transformants treated the same way, were scored as [PSI+]. By growing several of these colonies on YPD + 5 mM GuHCl medium we confirmed that the acquired suppression was curable. The rare colonies that showed a few white sectors were not counted as [PSI+] because the [PSI+] induction probably occurred after plating on YPD.
Acknowledgements
Top of pageWe are grateful to P.Okkema for allowing us to use his fluorescence microscope. We thank J.Warner for antibodies to ribosomal protein L3. This work was supported by grants from the National Institutes of Health (GM56350 and GM25874) and the Alzheimer's Association. S.M.U. was supported by Postdoctoral Fellowship, PF98135-01-GMC, from the American Cancer Society and the Training Program in Cancer Biology, ST32CA09594.
References
Top of pageAigle M and Lacroute F (1975) Genetical aspects of [URE3], a non-Mendelian, cytoplasmically inherited mutation in yeast. Mol Gen Genet, 136, 327–335. | Article | PubMed | ISI | ChemPort |
Beggs JD (1981) Multiple-copy yeast plasmid vectors. In Von Wettstein,D., Friis,J., Kielland-Bradt,M. and Stenderup,A. (eds), Molecular Genetics in Yeast. Vol. 16. Alfred Benzon Symposium, Manksgaard, Copenhagen, pp. 383–396.
Bonetti B, Fu L, Moon J and Bedwell DM (1995) The efficiency of translation termination is determined by a synergistic interplay between upstream and downstream sequences in Saccharomyces cerevisiae. J Mol Biol, 251, 334–345. | Article | PubMed | ISI | ChemPort |
Broach JR, Strathern JN and Hicks JB (1979) Transformation in yeast: Development of a hybrid cloning vector and isolation of the CAN1 gene. Gene, 8, 121–127. | Article | PubMed | ISI | ChemPort |
Caughey B and Chesebro B (1997) Prion protein and the transmissible spongiform encephalopathies. Trans Cell Biol, 7, 56–62. | Article | ChemPort |
Cesarini G and Murray AH (1987) Plasmid vectors carrying the replication origin of filamentous single-stranded phages. In Setlow,J.K. (ed.), Genetic Engineering: Principles and Methods. Vol. 4. Plenum Press, New York, NY, pp. 135–154.
Chernoff YO, Derkach IL, Dagkesamanskaya AR, Tikhomirova VL, Ter-Avanesyan MD and Inge-Vechtomov SG (1988) Nonsense suppression caused by the amplification of translation factor gene. Dokl Akad Nauk SSSR (Biol Sci), 301, 1227–1229.
Chernoff YO, Inge-Vechtomov SG, Derkach IL, Ptyushkina MV, Tarunina OV, Dagkesamanskaya AR and Ter-Avanesyan MD (1992) Dosage-dependent translational suppression in yeast Saccharomyces cerevisiae. Yeast, 8, 489–499. | PubMed | ISI | ChemPort |
Chernoff YO, Derkach IL and Inge-Vechtomov SG (1993) Multicopy SUP35 gene induces de novo appearance of psi-like factors in the yeast Saccharomyces cerevisiae. Curr Genet, 24, 268–270. | Article | PubMed | ISI | ChemPort |
Chernoff YO, Lindquist SL, Ono B-I, Inge-Vechtomov SG and Liebman SW (1995) Role of the chaperone protein Hsp104 in propagation of the yeast prion-like factor [psi+]. Science, 268, 880–884. | Article | PubMed | ISI | ChemPort |
Cohen FE, Pan KM, Huang Z, Baldwin M, Fletterick RJ and Prusiner SB (1994) Structural clues to prion replication. Science, 264, 530–531. | Article | PubMed | ISI | ChemPort |
Cox BS (1971) A recessive lethal super-suppressor mutation in yeast and other
phenomena. Heredity, 26, 211–232. | PubMed | ISI | ChemPort |
Cox BS (1977) Allosuppressors in yeast. Genet Res, 30, 187–205. | ISI |
Cox BS, Tuite MF and Mclaughlin CS (1988) The
factor of yeast: a problem in inheritance. Yeast, 4, 159–178. | Article | PubMed | ISI | ChemPort |
Crouzet M and Tuite MF (1987) Genetic control of translational fidelity in yeast: molecular cloning and analysis of the allusuppressor gene SAL3. Mol Gen Genet, 210, 581–583. | PubMed | ISI | ChemPort |
Crouzet M, Izgu F and Tuite MF (1988) The allosuppressor gene SAL4 encodes a protein important for maintaining translational fidelity in Saccharomyces cerevisiae. Curr Genet, 14, 537–543. | PubMed | ISI | ChemPort |
Czaplinski K, Ruiz-Echevarria MJ, Paushkin SV, Han X, Weng Y, Perlick HA, Deitz HC, Ter-Avanesyan MD and Peltz SW (1998) The surveillance complex interacts with the translation release factors to enhance termination and degrade aberrant mRNAs. Genes Dev, 12, 1665–1677. | Article | PubMed | ISI | ChemPort |
Dagkesamanskaya AR and Ter-Avanesyan MD (1991) Interaction of the yeast omnipotent suppressers SUP1 (SUP45) and SUP2 (SUP35) with non-Mendelian factors. Genetics, 128, 513–520. | PubMed | ISI | ChemPort |
Derkatch IL, Chernoff YO, Kushnirov VV, Inge-Vechtomov SG and Liebman SW (1996) Genesis and variability of [PSI] prion factors in Saccharomyces cerevisiae. Genetics, 144, 1375–1386. | PubMed | ISI | ChemPort |
Derkatch IL, Bradley ME, Zhou P, Chernoff YO and Liebman SW (1997) Genetic and environmental factors affecting the de novo appearance of the [PSI+] prion in Saccharomyces cerevisiae. Genetics, 147, 507–519. | PubMed | ISI | ChemPort |
Derkatch IL, Bradley ME and Liebman SW (1998) Overexpression of the SUP45 gene encoding a Sup35p-binding protein inhibits the induction of the de novo appearance of the [PSI+] prion. Proc Natl Acad Sci USA, 95, 2400–2405. | Article | PubMed | ChemPort |
Derkatch IL, Bradley ME, Zhou P and Liebman SW (1999) The PNM2 mutation in the prion protein domain of SUP35 has distinct effects on different variants of the [PSI+] prion in yeast. Curr Genet., in press.
Doel SM, McCready SJ, Nierras CR and Cox BS (1994) The dominant PNM2-mutation which eliminates the
factor of Saccharomyces cerevisiae is the result of a missense mutation in the SUP35 gene. Genetics, 137, 659–670. | PubMed | ISI | ChemPort |
Drugeon G, Jean-Jean O, Frolova L, Le Goff X, Philippe M, Kisselev L and Haenni AL (1997) Eukaryotic release factor 1 (eRF1) abolishes readthrough and competes with suppressor tRNAs at all three termination codons in messenger RNA. Nucleic Acids Res, 25, 2254–2258. | Article | PubMed | ISI | ChemPort |
Frolova L et al. (1994) A highly conserved eukaryotic protein family processing properties of polypeptide chain release factor. Nature, 372, 701–703. | Article | PubMed | ISI | ChemPort |
Glover JR, Kowal AS, Schirmer EC, Patino MM, Liu JJ and Lindquist S (1997) Self-seeded fibers formed by Sup35, the protein determinant of [PSI+], a heritable prion-like factor of S. cerevisiae. Cell, 89, 811–819. | Article | PubMed | ISI | ChemPort |
Griffith JS (1967) Self-replication and scrapie. Nature, 215, 1043–1044. | Article | PubMed | ISI | ChemPort |
Hoffman CS and Winston F (1987) A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene, 57, 267–272. | Article | PubMed | ISI | ChemPort |
Ito H, Fukuda Y, Murata K and Kimura A (1983) Transformation of intact yeast cells treated with alkali cations. J Bacteriol, 153, 163–168. | PubMed | ISI | ChemPort |
Jarret JT and Lansbury PT (1993) Seeding 'one dimensional crystallization' of amyloid: a pathogenic mechanism in Alzheimer's disease and scrapie? Cell, 73, 1055–1058. | Article | PubMed
King CY, Tittmann P, Gross H, Gebert R, Aebi M and Wuthrich K (1997) Prion-inducing domain 2–114 of yeast Sup35 protein transforms in vitro into amyloid-like filaments. Proc Natl Acad Sci USA, 94, 6618–6622. | Article | PubMed | ChemPort |
Kochneva-Pervukhova NV, Poznyakovski AI, Smirnov VN and Ter-Avanesyan MD (1998) C-terminal truncation of the Sup35 protein increases the frequency of de novo generation of a prion-based [PSI+] determinant in Saccharomyces cerevisiae. Curr Genet, 34, 146–151. | Article | PubMed | ISI | ChemPort |
Kushnirov VV, Ter-Avanesyan MD, Telckov MV, Surguchov AP, Smirnov VN and Inge-Vechtomov SG (1988) Nucleotide sequence of the SUP2 (SUP35) gene of Saccharomyces cerevisiae. Gene, 66, 45–54. | Article | PubMed | ISI | ChemPort |
Le Goff X, Philippe M and Jean-Jean O (1997) Overexpression of human release factor 1 alone has an antisuppressor effect in human cells. Mol Cell Biol, 17, 3164–3172. | PubMed | ChemPort |
Liebman SW and All-Robyn JA (1984) A non-Mendelian factor, [eta+], causes lethality of yeast omnipotent-suppressor strains. Curr Genet, 8, 567–573. | ISI | ChemPort |
Liebman SW and Cavenagh M (1980) An antisuppressor that acts on omnipotent suppressors in yeast. Genetics, 95, 49–61. | PubMed | ISI | ChemPort |
Liebman SW and Derkatch IL (1999) The yeast [PSI+] prion: making sense of nonsense. J Biol Chem, 274, 1181–1184. | Article | PubMed | ISI | ChemPort |
Mottagui-Tabar S, Tuite MF and Isaksson LA (1998) The influence of 5' codon context on translation termination in Saccharomyces cerevisiae. Eur J Biochem, 257, 249–254. | Article | PubMed | ISI | ChemPort |
Patino MM, Liu JJ, Glover JR and Lindquist S (1996) Support for the prion hypothesis for inheritance of a phenotypic trait in yeast. Science, 273, 622–626. | Article | PubMed | ISI | ChemPort |
Paushkin SV, Kushnirov VV, Smirnov VN and Ter-Avanesyan MD (1996) Propagation of the yeast prion-like [psi+] determinant is mediated by oligomerization of the SUP35-encoded polypeptide chain release factor. EMBO J, 15, 3127–3134. | PubMed | ISI | ChemPort |
Paushkin SV, Kushnirov VV, Smirnov VN and Ter-Avanesyan MD (1997a) In vitro propagation of the prion-like state of yeast Sup35 protein. Science, 277, 381–383. | Article | PubMed | ISI | ChemPort |
Paushkin SV, Kushnirov VV, Smirnov VN and Ter-Avanesyan MD (1997b) Interaction between yeast Sup45p (eRF1) and Sup35p (eRF3) polypeptide chain release factors: implications for prion-dependent regulation. Mol Cell Biol, 17, 2798–2805. | PubMed | ISI | ChemPort |
Prusiner SB (1982) Novel proteinaceous infectious particles cause scrapie. Science, 216, 136–144. | Article | PubMed | ISI | ChemPort |
Prusiner SB (1996) Molecular biology and pathogenesis of prion diseases. Trends Biochem Sci, 21, 482–487. | Article | PubMed | ISI | ChemPort |
Rose MD, Novick P, Thomas JH, Botstein D and Fink GR (1987) A Saccharomyces cerevisiae genomic plasmid bank based on a centromere-containingshuttle vector. Gene, 60, 237–243. | Article | PubMed | ISI | ChemPort |
Rose MD, Winston F and Heiter P (1990) Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Rothstein (1983) One step gene disruption in yeast. Methods Enzymol, 101, 202–211. | PubMed | ISI | ChemPort |
Sanger F, Nicklen S and Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA, 74, 5463–5467. | Article | PubMed | ChemPort |
Singh A, Helms C and Sherman F (1979) Mutation of the non-Mendelian suppressor,
+, in yeast by hypertonic media. Proc Natl Acad Sci USA, 76, 1952–1956. | Article | PubMed
Sherman F, Fink GR and Hicks JB (1986) Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Song JM and Liebman SW (1985) Interaction of UAG suppressors and omnipotent suppressors in Saccharomyces cerevisiae. J Bacteriol, 161, 778–780. | PubMed | ISI | ChemPort |
Stansfield I et al. (1995) The products of the SUP45 (eRF1) and SUP35 genes interact to mediate translation termination in Saccharomyces cerevisiae. EMBO J, 14, 4365–4373. | PubMed | ISI | ChemPort |
Ter-Avanesyan MD, Kushnirov VV, Dagkesamanskaya AR, Didichenko SA, Chernoff YO, Inge-Vechtomov SG and Smirnov VN (1993) Deletion analysis of the SUP35 gene of the yeast Saccharomyces cerevisiae reveals two non-overlapping functional regions in the encoded protein. Mol Microbiol, 7, 683–692. | Article | PubMed | ChemPort |
Ter-Avanesyan MD, Dagkesamanskaya AR, Kushnirov VV and Smirnov VN (1994) The SUP35 omnipotent suppressor gene is involved in the maintenance of the non-Mendelian determinant [psi+] in the yeast Saccharomyces cerevisiae. Genetics, 137, 671–676. | PubMed | ChemPort |
Tuite MF, Mundy CR and Cox BS (1981) Agents that cause a high frequency of genetic change from [psi+] to [psi-] in Saccharomyces cerevisiae. Genetics, 98, 691–711. | PubMed | ISI | ChemPort |
Weissmann C (1999) Molecular genetics of transmissible spongiform encephalopathies. J Biol Chem, 274, 3–6. | Article | PubMed | ISI | ChemPort |
Wickner RB (1994) [URE3] as an altered Ure2 protein: evidence for prion analogue in Saccharomyces cerevisiae. Science, 264, 566–569. | Article | PubMed | ISI | ChemPort |
Wickner RB, Masison DC and Edskes HK (1996) [URE3] and [PSI] as prions of Saccharomyces cerevisiae: genetic evidence and biochemical properties. Semin Virol, 7, 215–233. | Article | ISI | ChemPort |
Wilson PG and Culbertson MR (1988) SUP12 suppressor protein of yeast. A fusion protein related to the EF-1 family of elongation factors. J Mol Biol, 199, 559–573. | Article | PubMed | ISI | ChemPort |
Zhouravleva G, Frolova L, Le Goff X, Le Guellec R, Inge-Vechtomov SG, Kisselev L and Philippe M (1995) Termination of translation in eukaryotes is governed by two interacting polypeptide chain release factors, eRF1 and eRF3. EMBO J, 14, 4065–4072. | PubMed | ISI | ChemPort |



