Effects of p300 on TR-RXR-dependent transcription and DNA topology of the TR
A minichromosome in the Xenopus oocytes. (A) p300 augments transcriptional activation by ligand-bound TR-RXR from the TR
A promoter. Xenopus oocytes were first injected with different mRNAs for protein synthesis. Two hours after the cytoplasmic injection, single-stranded TR
A promoter was injected into the nucleus in 9.2 nl (0.1
g/
l). The oocytes were then incubated in the presence or absence of 50 nM T3 hormone at 18°C for 16 h. The microinjected oocytes (15–20) for each experimental group were collected for assay of transcription activity by primer extension. Lane 1, TR and RXR mRNA (2 fmol) without hormone induction; lane 2, TR, RXR mRNA (2 fmol) and p300 mRNA (2 fmol) without T3 induction; lane 3, mRNA injection as in lane 1 but with T3 induction; lane 4, mRNA injection as in lane 2 but with T3 induction. Primer extensions of endogenous histone H4 mRNA serves as a loading control (Materials and methods). The Southern blots of chloroquine gels serve as control for the microinjection of constant amounts of template DNA (C and D). (B) Quantification of the experiment in (A) by PhosphorImager analysis. The endogenous H4 signal is used as a loading control. The transcription signals are plotted as fold induction relative to control [(lane 1 in (A)]. A.U. indicates arbitrary units of transcriptional activity. (C) p300 decreases the DNA topological change caused by ligand-bound TR-RXR. DNA from the same batch of oocytes as in (A) was purified and analyzed for its topology on a 1.2% agarose gel in 1
TPE buffer with 90
g/ml chloroquine. The detection of DNA was done by conventional Southern blotting. Non-injected DNA (In) and topoisomerase I relaxed DNA (Re) were used as markers for the Southern analysis. Lanes 1–4 as lanes 1–4 in (A). The arrow indicates the direction of increase in negative superhelicity (i.e. nucleosomes). NC shows the migration of nicked circular DNA. (D) The experimental procedure is as in (C) except that the chloroquine concentration is 30
g/ml. NC shows the migration of nicked circular DNA. Densitometric scans of lanes 1–4 are shown for ease of comparison of topoisomers. (E)
-amanitin blocks transcription from TR
A promoter. The oocytes were first injected with different mRNA, then with single-stranded TR
A promoter (1 ng).
-amanitin (6 ng) was coinjected with the DNA. The microinjected oocytes (15–20) for each experimental group were collected for the transcription activity by primer extension. Lane 1, TR and RXR mRNA (2 fmol) without T3 induction; lane 2, as in lane 1 except with coinjected
-amanitin; lane 3, TR and RXR mRNA (2 fmol) with T3 induction; lane 4, as in lane 3 except with
-amanitin; lane 5, TR, RXR mRNA (2 fmol) and p300 mRNA (2 fmol) with T3 induction; lane 6, as in lane 5 except with coinjected
-amanitin. (F) DNA topological change is independent of transcription. DNA from the same batch of oocytes as in (E) was purified and analyzed for its topology on 1.2% agarose with 60
g/ml chloroquine. The detection of DNA was done by conventional Southern blot analysis. Lanes 1–6 as lanes 1–6 in (E). (G) Effects of p300 alone on transcription in the absence of TR-RXR as in (A) except lane 1, no hormone addition; lane 2, TR, RXR mRNA (2 fmol) with hormone induction; lane 3, p300 mRNA (2 fmol) with hormone; lane 4, TR, RXR mRNA (2 fmol) and p300 mRNA (2 fmol) with hormone induction. (H) Topological analysis of minichromosomes transcribed in (G). Experimental procedures were as described in (C). Topoisomers were resolved in 90
g/ml chloroquine. (I) As in (H), except topoisomers were resolved in 30
g/ml chloroquine. Densitometric scans of lanes 1–4 are shown to facilitate comparison of topoisomers.
Article
- The EMBO Journal (1999) 18, 5634 - 5652
- doi:10.1093/emboj/18.20.5634
p300 stimulates transcription instigated by ligand-bound thyroid hormone receptor at a step subsequent to chromatin disruption
Qiao Li1, Axel Imhof1, Trevor N. Collingwood1, Fyodor D. Urnov1 and Alan P. Wolffe1
- Laboratory of Molecular Embryology, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892-5431, USA
Correspondence to:
Alan P. Wolffe, E-mail: awlme@helix.nih.gov
Received 5 May 1999; Accepted 23 August 1999; Revised 12 August 1999
Abstract
We investigate the role of the transcriptional coactivator p300 in gene activation by thyroid hormone receptor (TR) on addition of ligand. The ligand-bound TR targets chromatin disruption independently of gene activation. Exogenous p300 facilitates transcription from a disrupted chromatin template, but does not itself disrupt chromatin in the presence or absence of ligand-bound receptor. Nevertheless, the acetyltransferase activity of p300 is required to facilitate transcription from a disrupted chromatin template. Expression of E1A prevents aspects of chromatin remodeling and transcriptional activation dependent on TR and p300. E1A selectively inhibits the acetylation of non-histone substrates. E1A does not prevent the assembly of a DNase I-hypersensitive site induced by TR, but does inhibit topological alterations and the loss of canonical nucleosome arrays dependent on the addition of ligand. Mutants of E1A incompetent for interaction with p300 partially inhibit chromatin disruption but still allow nuclear receptors to activate transcription. We conclude that p300 has no essential role in chromatin disruption, but makes use of acetyltransferase activity to stimulate transcription at a subsequent step.
Keywords:
- chromatin disruption,
- E1A,
- non-histone acetylation,
- nuclear receptors,
- p300
Introduction
Introduction
Top of pageThe precise mechanisms by which coactivators function to regulate transcription remain unclear. Coactivators have a structural role in serving as focal points for multiple protein–protein interactions including association with many transcriptional activation domains (Verrijzer and Tjian, 1996; Shikama et al., 1997; Xu et al., 1999). These interactions might help recruit components of the basal transcriptional machinery including RNA polymerase to a particular promoter (Barlev et al., 1995; Nakajima et al., 1997a, b). Coactivators can also function as enzymes that modify both other transcriptional regulators and the chromatin environment within which transcription occurs (Brownell and Allis, 1996; Gregory and Horz, 1998). The exact significance of these diverse roles is a topic of substantial research interest.
Among the best studied systems for the analysis of coactivator function is the GCN5p–ADA2p–ADA3p complex (Berger et al., 1992; Candau and Berger, 1996; Candau et al., 1997; Grant et al., 1997). Components of this complex physically contact transcription activation domains and components of the basal transcriptional machinery (Barlev et al., 1995). The bromodomain of GCN5p also makes specific contacts with the N-terminal tail of histone H4 (Ornaghi et al., 1999). GCN5p is an acetyltransferase that modifies histones (Brownell et al., 1996). Histone acetylation occurs in the vicinity of promoters to which it is targeted (Kuo et al., 1998) and acetyltransferase activity is required to regulate transcription (Kuo et al., 1998; Wang et al., 1998). The histone acetyltransferase activity of GCN5p contributes to alterations in chromatin structure in vivo (Gregory et al., 1998), and mutations in the core histones that mimic the consequences of acetylation relieve the requirement for GCN5p for gene activation in vivo (Zhang et al., 1998). This is impressive progress, yet the exact biochemical mechanism by which the GCN5p coactivator stimulates transcription remains unclear. For example, histone modification and acetyltransferase activity might be required either to disrupt chromatin or to maintain a fully disrupted active state. Histone acetylation might yet be a secondary consequence of recruitment and modification of the basal transcriptional machinery by GCN5p.
Histone acetylation provided an early link between transcription and chromatin modification (Allfrey et al., 1964). Genetic, biochemical and chromatin immunoprecipitation experiments in yeast all reinforce this association (reviewed by Edmondson et al., 1998; Gregory and Horz, 1998; Mizzen et al., 1998). Structural studies indicate that histone acetylation destabilizes both local and higher-order chromatin folding, thereby facilitating transcription (Lee et al., 1993; Vettesse-Dadey et al., 1996; Ura et al., 1997; Krajewski and Becker, 1998; Nightingale et al., 1998; Tse et al., 1998). It is also probable that the acetylation of specific lysines in the core histones provides novel recognition surfaces to promote the association of positive regulators of the transcription process (Dutnall et al., 1998). What is clear is that histone acetylation is not a universal transcriptional activation mechanism (Van Lint et al., 1996a), and that while some genes can be selectively activated by increases in histone acetylation (Van Lint et al., 1996b), others are not (Bresnick et al., 1990). An explanation for this variation may lie either in specific aspects of nucleoprotein architecture to which histone acetylation might contribute (van Holde, 1993), or in the recognition that acetyltransferases modify many transcriptional regulators aside from the histones (Gu and Roeder, 1997; Imhof et al., 1997; Boyes et al., 1998) with largely unknown functional consequences.
In contrast to the experiments in yeast that establish a role for the coactivator GCN5p in chromatin remodeling (Gregory and Horz, 1998, Gregory et al., 1998), the capacity of targeted transcriptional coactivators to remodel chromatin in animal systems has not been investigated. Many transcriptional activators, including nuclear hormone receptors, interact with the structurally related coactivators p300 and CREB-binding protein (CBP) (Chrivia et al., 1993; Chakravarti et al., 1996; Hanstein et al., 1996; Kamei et al., 1996; Smith et al., 1996; Chen et al., 1997; Nakajima et al., 1997a, b; Puri et al., 1997; Ramirez et al., 1997; Shikama et al., 1997; Li et al., 1998). The basal transcription factors TATA-binding protein (TBP) and TFIIB also make contact with CBP and p300 (Kwok et al., 1994; Yuan et al., 1996), as does RNA polymerase (Nakajima et al., 1997a, b). These diverse interactions might facilitate recruitment of the basal transcriptional machinery to promoters. p300 and CBP are HATs (Ogryzko et al., 1996) and this enzymatic activity stimulates trans-cription in model systems (Li et al., 1998; Martinez-Balbas et al., 1998). One model for transcriptional control by coactivators suggests that their acetyltransferase activity is important for rendering chromatin accessible to the basal transcriptional machinery (Wolffe and Pruss, 1996; Jenster et al., 1997; Mizzen et al., 1998). However, the influence of p300 and CBP on chromatin disruption has not yet been examined.
Chromatin disruption has long been associated with transcription of chromosomal DNA (reviewed by van Holde, 1988). Disruption has been defined through the use of diverse assays. These include alterations in cleavage of DNA using nucleases such as DNase I (Zaret and Yamamoto, 1984; Emerson et al., 1985; Gregory et al., 1998), micrococcal nuclease (Almer and Horz, 1986; Carr and Richard-Foy, 1990; Cavalli and Thoma, 1993; Tsukiyama et al., 1994; Cavalli et al., 1996) and restriction endonucleases (Emerson and Felsenfeld, 1984; Fascher et al., 1993; Lee and Archer, 1994; Truss et al., 1995; Logie and Peterson, 1997; Varga-Weisz et al., 1997). Alterations in the topology of closed circular DNA molecules have also been used to monitor changes in nucleosome integrity (Norton et al., 1989; Kwon et al., 1994; Wechser et al., 1997). The assay for topological change of minichromosomes monitors chromatin reconfiguration or disruption. It is based on the fact that each nucleosome constrains a single negative superhelical turn (Germond et al., 1975; Simpson et al., 1985). Removal of nucleosomes (Randall and Kelly, 1992), reduction in DNA wrapping (Norton et al., 1989) and alterations in higher-order structure dependent on DNA crossing over at the entry and exit of the nucleosome (Worcel et al., 1981) can, in principle, all be monitored by the reduction in negative superhelicity. These chromatin disruption assays have allowed several investigators to establish unambiguously that chromatin disruption can occur in the absence of transcription itself, so that it potentially functions to prepare the promoter for true activation that would occur as a subsequent step (Fascher et al., 1993; Becker, 1994; Owen-Hughes et al., 1996; Svaren and Horz, 1997; Wong et al., 1997a).
The regulation of gene expression by nuclear hormone receptors has proven particularly useful in determining the relationships between coactivators, corepressors and chromatin (Parker, 1998; Torchia et al., 1998; Stunnenberg et al., 1999; Xu et al., 1999). Nuclear receptors have the capacity to bind to their recognition elements efficiently in chromatin (Wong et al., 1995; Ciana et al., 1998; Minucci et al., 1998). In the absence of ligand, the thyroid hormone receptor (TR) and retinoic acid receptor (RAR) recruit a corepressor complex that contains histone deacetylase (Alland et al., 1997; Heinzel et al., 1997; Nagy et al., 1997). This enzymatic activity is essential for transcriptional silencing in the Xenopus oocyte (Wong et al., 1998). On the addition of hormone the corepressor complex is released (Chen and Evans, 1995; Horlein et al., 1995; Collingwood et al., 1998) and a complex of histone acetyltransferases is recruited to the receptor (Chakravarti et al., 1996; Kamei et al., 1996; Chen et al., 1997). The TR can target chromatin disruption as assayed by micrococcal nuclease cleavage and topological change in the absence of transcription (Wong et al., 1997a). This leads to a model for gene regulation in which the unliganded nuclear receptor initially targets the assembly of a repressive chromatin structure in response to ligand, the receptor recruits coactivators with histone acetyltransferase activity to first destabilize the repressive structure and subsequently activate transcription (Jenster et al., 1997; Pazin and Kadonaga, 1997; Wolffe, 1997).
In this work, we have examined the role of p300 and acetylation in chromatin dynamics and transcriptional activation in response to the addition of hormone to chromatin-bound TR. Surprisingly, we find that p300 itself neither disrupts chromatin, nor activates transcription from a non-disrupted template. However, p300 facilitates transcription from a previously disrupted chromatin template. This activation of transcription requires acetyltransferase activity. E1A is known to influence transcriptional activation by nuclear receptors (Berkenstam et al., 1992; Meyer et al., 1996; Kurokawa et al., 1998; Wahlstrom et al., 1999). We make use of E1A to explore further the role of p300 and acetylation in transcriptional control by the TR in chromatin. We establish that E1A acts selectively to impair chromatin remodeling and that there are additional targets involved in this process apart from p300.
Results
Top of pagep300 does not stimulate transcription from a chromatin-bound TR unless chromatin is disrupted in the presence of ligand
We microinjected the Xenopus thyroid hormone receptor
A (TR
A) promoter into Xenopus oocyte nuclei in single-stranded form. Replication-coupled chromatin assembly drives the repression of basal transcription under these conditions (Almouzni and Wolffe, 1993). Expression of exogenous TR further stabilizes this repression of transcription in the absence of hormone (Wong et al., 1995, 1998). The expression of exogenous p300 in the Xenopus oocyte (Li et al., 1998) does not lead to a significant relief of the repression of transcription established on the TR
A promoter containing template, which occurs in the presence of unliganded TR-retinoid X receptor (RXR) (Figure 1A, compare lanes 1 and 2; Wong et al., 1995, 1998). The addition of ligand activates transcription from the TR
A promoter and the expression of exogenous p300 further facilitates transcription (Figure 1A and B, compare lanes 1–4). Under these conditions, all of the minichromosomes assembled in the Xenopus oocyte nucleus are bound by the TR-RXR (Wong et al., 1995, 1997a, 1998). This is shown by in vivo footprinting of the receptor on the TR
A promoter, by complete receptor-dependent repression of basal transcription and by the receptor altering the topology of all the minichromosomes in the presence of ligand (Figure 1C and D). Since we have a robust connection between chromatin structure and function in this system, we next asked whether the p300 facilitation of transcription (Figure 1A and B) would lead to a further change in minichromosome topology.
Figure 1.
The expression of exogenous p300 has no effect on the topology of minichromosomes in the presence of TR-RXR (Figure 1C, compare lanes 1 and 2). Addition of ligand in the presence of TR-RXR leads to chromatin reconfiguration or disruption as revealed by the decrease in negative superhelical turns (equivalent to loss of nucleosomes) (Figure 1C, compare lanes 1 and 3). Remarkably, expression of exogenous p300, which facilitates transcription in the presence of ligand-bound TR-RXR (Figure 1A and B), does not further disrupt chromatin (Figure 1C, compare lanes 1 and 4). In fact, exogenous p300 appears to stabilize the minichromosome because the topological change is reduced relative to that directed by ligand-bound TR-RXR alone (Figure 1C, compare lanes 3 and 4). Quantitation of topological change using a different concentration of chloroquine (Figure 1D) indicates that ligand-bound TR-RXR on the TR
A promoter targets the loss of eight negative superhelical turns, each a putative reconfigured or disrupted nucleosome, while in the presence of exogenous p300 only five negative superhelical turns are lost. The loss of negative superhelical turns is dependent on the abundance of TR-RXR and the total of four thyroid hormone response elements (TREs) present in the TR
A regulatory DNA, which span from -800 to +264 (Wong et al., 1997a; F.Urnov, manuscript in preparation). Each TR-RXR and TRE can target the loss of two or three negative superhelical turns in the presence of ligand (Wong et al., 1997a). As a control, we examined whether the major topological change was dependent on transcription itself. Addition of
-amanitin at concentrations sufficient to inhibit transcription (Figure 1E) did not prevent significant chromatin disruption targeted by hormone-bound TR-RXR (Figure 1F). The addition of
-amanitin did lead to minor topological changes comparable to those observed with p300 (Figure 1F, compare lanes 3–6). This would be consistent with a small level of nucleosomal stabilization in the absence of transcription. Finally, it is conceivable that TR bound to DNA in the absence of hormone, as in Figure 1A–D, prevents p300 effects. To test this possibility, we compared transcription and DNA topology plus or minus p300 in the presence or absence of ligand-bound TR-RXR (Figure 1G–I). We find that p300 alone has no influence on transcription or topology (Figure 1G–I, compare lanes 1 and 3). However, p300 augments transcription in the presence of TR-RXR and hormone (Figure 1G, compare lanes 2 and 4). As seen previously (Figure 1C and D), p300 also leads to recovery of topology in the presence of TR-RXR and ligand (Figure 1H and I, compare lanes 2 and 4). We conclude that TR bound in the absence of hormone does not interfere with the activity of p300.
Taken together, these results suggest that chromatin disruption is largely independent of transcription and that exogenous p300 facilitates transcription but does not do so by further disrupting chromatin. We do not yet understand why the expression of exogenous p300 would reduce topological change or potentially stabilize nucleosomes. The expression of p300 may capacitate transcription by facilitating the assembly of regulatory nucleoprotein complexes other than nucleosomes, which nevertheless wrap DNA in a comparable way (e.g. Du et al., 1993; Katsani et al., 1999). It has been proposed that the TFIID complex itself may resemble a histone octamer (Hoffman et al., 1997). It is also possible that the overexpression of p300 competes for endogenous chromatin disrupting factors, thereby inhibiting topological change; however, we do not see such marked effects on topology following expression of SRC-1 or p300/CBP-associating factor (PCAF) (see Figure 3 and Discussion).
Figure 3.
Effects of SRC-1 and PCAF on TR-dependent transcription and DNA topology of the TR
A minichromosome in Xenopus oocytes. PCAF, but not SRC-1, significantly enhances activation from the TR
A promoter. Two hours after cytoplasmic injection of mRNA for TR (1 fmol), RXR (1 fmol), SRC-1 (2 fmol) and PCAF (2 fmol), single-stranded TR
A promoter (1 ng) was injected into the nucleus. Oocytes were then incubated in the presence or absence of 100 nM T3 at 18°C for 14 h. Twenty oocytes for each sample were pooled and analyzed for transcription and topological change in the TR
A promoter DNA. (A) Primer extension analysis of transcription. (B) Quantitation of primer extension corrected for endogenous H4 mRNA recovery. (C) Topology of TR
A using 90
g/ml chloroquine on a 1.2% agarose gel. PhosphorImager analysis showing distribution of topoisomer bands is also shown. Non-injected double-stranded supercoiled DNA (In); supercoiled DNA relaxed by digestion with topoisomerase (Re). NC indicates the mobility of nicked circular DNA.
Earlier work has established that in mammalian cells the association of transcriptional coactivators with nuclear receptors is usually hormone dependent (Chakravarti et al., 1996; Kamei et al., 1996; Henttu et al., 1997; Collingwood et al., 1998); however, under certain circumstances coactivators can interact with nuclear receptors through hormone-independent pathways (White et al., 1997; Blanco et al., 1998; Hammer et al., 1999; Tremblay et al., 1999; reviewed by Freedman, 1999). We examined the association of p300 with the TR-RXR in oocytes in the presence or absence of ligand. Surprisingly, p300 interacts with TR-RXR independently of ligand (Figure 2A, compare lanes 7 and 8; see also Figure 3A, lanes 6 and 8). The N-terminal domain of p300 was sufficient for association with TR-RXR (Figure 2A, compare lanes 9 and 10) as described previously (Chakravarti et al., 1996; Kamei et al., 1996), and negative controls using Xenopus heat-shock transcription factor, a known positive regulator of transcription in Xenopus oocytes (Landsberger and Wolffe, 1995), indicated that the association was specific (Figure 2A, lane 11). In the absence of the expressed p300 protein, the M2-antibody immunoprecipitates very few radioactive proteins (Figure 2A, lane 12). This further indicates that interaction with p300 is necessary for immunoprecipitation. We note that in our assay, less TR is precipitated by anti-p300 serum in the presence of ligand compared with the absence of ligand (Figure 2A, compare lanes 7 and 8, 9 and 10). This might be the consequence of a competition between exogenous p300 and other, endogenous, coactivators for interaction interfaces on the surface of liganded TR. The fraction of intracellular receptor bound to p300 would thus be lowered. As a control, we also examined the association of SRC-1 (Onate et al., 1995; Kalkhoven et al., 1998) with TR-RXR and found it to be dependent on ligand (Figure 2B, lanes 1–3; see Lanz et al., 1999). The interaction of SRC-1 with TR-RXR was dependent on the intact N-terminal domain of the coactivator (Figure 2B, lanes 6–9) demonstrating specificity (Korzus et al., 1998). Note that endogenous levels of p300 are extremely low (Li et al., 1998) and are not detectable in this assay.
Figure 2.
The TR-RXR interacts with p300 in the absence of ligand, whereas SRC-1 shows a ligand-dependent interaction. (A) Xenopus oocytes were injected with different mRNAs and [35S]methionine for protein synthesis as indicated. Two hours after the cytoplasmic injection, single-stranded TR
A promoter was injected into the nucleus in 9.2 nl (0.1
g/
l). The oocytes were then incubated in the presence or absence of 50 nM T3 hormone at 18°C for 16 h. At the end of this time, oocytes were homogenized and p300-bound proteins immunoprecipitated using the M2-antibodies specific for p300. Lanes 1–6 show total radiolabeled proteins, while lanes 7–12 show immunoprecipitates (Materials and methods). Lanes 1, 2, 7 and 8 show results with wild-type p300, while lanes 3, 4, 9 and 10 use a deletion mutant 'N' containing the N-terminal amino acids 1–670. There are no injected mRNAs in lanes 6 and 12, only [35S]methionine. The positions of p300-WT, p300-N, RXR and TR are indicated. (B) Xenopus oocytes were injected with mRNA against SRC-1a and deletion mutants together with TR and RXR as in (A). Lanes 1, 4 and 7 show one-tenth of the [35S]methionine radiolabeled proteins in the oocyte extract. In lanes 2, 3, 5, 6, 8 and 9, antibodies against TR are used to immunoprecipitate bound proteins in the presence (+) or absence (-) of 50 nM T3 as indicated. The position of SRC-1a is indicated.
These results indicate that within the oocyte nucleus, exogenous p300 is bound to the TR independently of ligand. This association is insufficient to activate transcription significantly from a chromatin template (Figure 1A, compare lanes 1 and 2, and Figure 1G, compare lanes 1 and 3). On addition of ligand, chromatin is disrupted independently of the presence of exogenous p300 (Figure 1C and D). Once chromatin has been disrupted, exogenous p300 can facilitate transcription but without further removal of nucleosomes (Figure 1). In this model, chromatin disruption would be a necessary first step before p300 could stimulate transcription.
The interaction of p300 with TR-RXR in the absence of ligand is surprising; however, this association also occurs in two hybrid experiments (T.Collingwood, unpublished observations). It is possible that the overexpression of p300 and TR-RXR in oocytes forces a non-physiological interaction between these proteins, or titrates away transcriptional corepressors that would normally contribute to ligand-dependent control of association (Blanco et al., 1998). Blanco et al. (1998) observed that the release of corepressor facilitates the binding of PCAF to RAR-RXR. We have also observed the constitutive association of PCAF with TR-RXR when overexpressed in Xenopus oocytes, consistent with such a corepressor titration effect (data not shown). Any potential titration of corepressors does not, however, influence the regulated recruitment of SRC-1 (Figure 2B).
We next asked whether the capacity to augment transcription without additional chromatin disruption was a general function of transcriptional coactivators, both those that show ligand-dependent recruitment, like SRC-1 (Figure 2B) and those that do not, such as p300 (Figure 2A) and PCAF (data not shown). Neither SRC-1 nor PCAF influence basal transcription in the absence of TR-RXR (Figure 3A and B); however, in the presence of TR-RXR and ligand, PCAF (Figure 3A and B, lane 7) provides a significant increase in transcription (2- to 3-fold; also see Figure 5), whereas SRC-1 only augments transcription by 50% (Figure 3A and B, lane 6). Neither PCAF nor SRC-1 overexpression leads to any significant topological charge beyond that induced by receptor alone (Figure 3C). We deliberately used conditions in which a limiting level of TR-RXR increases expression only 4-fold in the presence of ligand (Figure 3A and B, compare lanes 4 and 5) such that the change in DNA topology (Figure 3C) is less than under the conditions of TR-RXR saturation used in Figure 1A–D. We wished to be able to detect sensitively any augmentation of chromatin disruption by the coactivators. The densitometric scans demonstrate that expression of the SRC-1 and PCAF coactivators does not further alter topology towards a more disrupted state. The stimulation of transcription by PCAF in the presence of ligand-bound TR-RXR (Figure 3A and B, lanes 5 and 7) is comparable to that obtained with p300 (Figure 1A and B, lanes 3 and 4). However, unlike p300, PCAF does not appear to help restore the original topology of the minichromosome (see also Figure 5).
Figure 5.
E1A inhibits transcriptional activation and topological changes induced by ligand-bound TR-RXR, p300 and PCAF. (A) E1A inhibits the transcriptional activation by p300 and PCAF. The oocytes were first injected with different mRNA as indicated. Two hours later, single-stranded TR
A promoter was injected into the nucleus in 9.2 nl (0.1
g/
l). The oocytes were then incubated with 50 nM T3 hormone at 18°C for 16 h. The microinjected oocytes (15–20) for each experimental group were collected for the transcription activity by primer extension. Lane 1, oocytes without exogenous mRNA; lane 2, TR and RXR mRNA (1 fmol); lane 3, TR, RXR mRNA (1 fmol) and p300 mRNA (2 fmol); lane 4, TR, RXR mRNA (1 fmol), p300 mRNA (2 fmol) and E1A mRNA (2 fmol); lane 5, TR, RXR mRNA (1 fmol) and PCAF mRNA (2 fmol); lane 6, TR, RXR mRNA (1 fmol), PCAF mRNA (2 fmol) and E1A mRNA (2 fmol). (B) E1A prevents the topological change. DNA from the same batch of oocytes as in (A) was purified and analyzed for its topology on 1.2% agarose with 90
g/ml chloroquine. The detection of DNA was carried out by conventional Southern blotting. Non-injected DNA (In) and topoisomerease I relaxed DNA (Re) were used as markers for the Southern analysis. Lanes 1–4 as lanes 1–4 in (A). NC shows the migration of nicked circular DNA. (C) The experimental procedure is as in (B) except that the chloroquine concentration is 30
g/ml. Densitometric scans of the lanes indicated are shown.
The acetyltransferase activity of p300 is required for transcriptional stimulation
As exogenous p300 is not required to disrupt chromatin, we next examined whether acetyltransferase activity would be required to stimulate transcription. We expressed a mutant form of p300 in which the acetyltransferase activity had been eliminated by a deletion in the active site (Li et al., 1998; Martinez-Balbas et al., 1998). This mutant form of p300 interacts with TR-RXR (Figure 4A, lanes 5 and 7), but does not stimulate transcription in the presence of ligand (Figure 4B), nor does the association of the mutant p300 with the receptor prevent chromatin disruption (Figure 4C). Put another way, the mutant p300 that binds efficiently to TR-RXR does not exert a dominant-negative function on chromatin disruption. This is consistent with our hypothesis that p300 (endogenous and exogenous) is not required for chromatin disruption. Interestingly, the mutant p300 deficient in acetyltransferase activity does not cause any topological recovery in disrupted chromatin (Figure 4C, compare lanes 2 and 3). We conclude that the acetyltransferase activity of p300 is not essential for chromatin disruption, but is essential for transcriptional stimulation of a disrupted chromatin template.
Figure 4.
p300 stimulation of transcriptional activity on the TR
A promoter is acetyltransferase activity (AT) domain-dependent. (A) The AT mutant of p300 (hm) is able to interact with TR-RXR equivalently to the wild-type p300 (WT). The oocytes were injected with different mRNA as indicated and incubated with T3 in the presence or absence of [35S]methionine at 18°C for 18 h for exogenous protein synthesis. The homogenized oocytes were then subjected to SDS–PAGE for monitoring protein synthesis (lanes 1–3) and immunoprecipitation by antibody against TR (lanes 4–6) or antibody against p300 (lanes 7–8). (B) The AT mutant of p300 (hm) can not enhance transcriptional activation from TR
A promoter. Oocytes were first injected with different mRNAs, then with single-stranded TR
A promoter (1 ng) and incubated in the presence or absence of 50 nM T3 hormone at 18°C for 16 h. The microinjected oocytes (15–20) for each experimental group were collected for assay of transcription activity by primer extension. Lane 1, TR and RXR mRNA (1 fmol) without hormone induction; lane 2, TR and RXR mRNA (1 fmol) with T3 induction; lane 3, TR, RXR mRNA (1 fmol) and the acetyltransferase mutant of p300 mRNA (2 fmol) with T3 induction. (C) The AT mutant of p300 can not reduce DNA topological change. DNA from the same batch of oocytes as in (B) was purified and analyzed for its topology on 1.2% agarose gel in 1
TPE buffer with 30
g/ml chloroquine. The detection of DNA was done by conventional Southern blotting. Lanes 1–3 as lanes 1–3 in (B). The arrow indicates the direction of increasing negative superhelicity (i.e. nucleosomes). NC shows the migration of nicked circular DNA. (D) The experimental procedure is as in (C) except that the chloroquine concentration is 90
g/ml. Non-injected DNA (In) and topoisomerease I relaxed DNA (Re) were used as markers for the Southern analysis. NC shows the migration of nicked circular DNA.
E1A inhibits transcription instigated by ligand-bound TR-RXR and inhibits topological change dependent on ligand-bound TR-RXR and p300
p300 was originally defined through interactions with the adenovirus oncoprotein E1A (Eckner et al., 1994). Subsequent experiments have indicated that E1A interferes with p300 function at several levels (Eckner et al., 1994, 1996a, b; Arany et al., 1995; Lundblad et al., 1995; Chakravati et al., 1996; Gerritsen et al., 1997; Aarnisalo et al., 1998; Blobel et al., 1998). This inhibition of p300 function can be a consequence of E1A interference with the association of p300 with transcriptional activation domains or other coactivators such as PCAF (Yang et al., 1996; Kurokawa et al., 1998). E1A also influences the histone acetyltransferase activity of p300 (Ait-Si-Ali et al., 1998; Chakravarti et al., 1999; Hamamori et al., 1999). Importantly, the site of E1A interaction with p300 is distinct from the N-terminal domain of p300 that interacts with TR-RXR; therefore, E1A does not influence the association of TR-RXR with p300 (data not shown; see also Kurokawa et al., 1998; Wahlstrom et al., 1999). We find that expression of exogenous E1A blocks transcriptional activation by TR-RXR in the presence of ligand and exogenous p300 (Figure 5A, lanes 1–4). The small amount of basal transcription is not activated by E1A and there is a reduction in transcription below basal levels in the presence of p300, ligand-bound receptor and E1A (Figure 5A, compare lanes 1 and 4; data not shown). This contrasts with the substantial activation of the RAR
2 promoter dependent on the RAR, TFIID and an E1A-mediated bridge between the two transcription factors (Berkenstam et al., 1992). E1A has also recently been reported to facilitate transcriptional activation by the TR in mammalian cells during transfection experiments in the presence and absence of ligand using direct repeat and palindromic hormone response sites in model templates (Wahlstrom et al., 1999). As we discuss later, E1A could have diverse effects on transcription dependent on the excess of the protein relative to other components of the transcriptional machinery (see Figure 6). We next examined the influence of E1A on the topological changes instigated by ligand-bound TR-RXR and exogenous p300 under these particular conditions. We find that E1A inhibits the topological change induced by ligand-bound receptor and p300 (Figure 5B and C, compare lanes 1–4). These results suggest that E1A inhibits chromatin disruption. We also tested the effect of E1A on transcriptional control by PCAF (Reid et al., 1998). Expression of exogenous PCAF facilitates transcriptional activation by ligand-bound TR-RXR (Figure 5A, compare lanes 2 and 5). Addition of E1A interferes with this activation (Figure 5A, compare lanes 5 and 6). As seen previously (Figure 3), PCAF does not augment the topological change induced by ligand-bound TR-RXR (Figure 5B and C, compare lanes 1 and 2 with 5 and 6), nor does PCAF lead to partial topological recovery in contrast to p300 (Figure 5B and C, compare lanes 2, 3 and 5). E1A blocks any topological changes induced by TR-RXR in the presence or absence of PCAF.
Figure 6.
E1A selectively inhibits acetylation of non-histone substrate by p300. (A) Recombinant TFIIE
was used as an acetylation substrate for p300 at a concentration of 3
M. Molar ratios of E1A to histone of 1:5 or 2:1 were used and the kinetics of modification of TFIIE
by p300 assayed. After a 30 min incubation, a 20
l aliquot of the reaction mixture was loaded onto an SDS–polyacrylamide gel, stained with Coomassie Blue, destained, treated with Amplify (Amersham) for 15 min, dried and the gel exposed for 24 h. The left panel shows the quantitation, whereas the right panel shows both a stained gel and the autoradiograph. (B) Various other substrates have been used for acetylation assays. Two micrograms of GST–MyoD (lanes 1 and 2); TR-RXR heterodimers (lanes 3 and 4) at molar ratios of E1A to substrate of 2:1; TFIIF (lanes 5 and 6); TFIIE
(lanes 7 and 8) at molar ratios of E1A to substrate of 1:1; and core histones (lanes 9 and 10) at molar ratios of E1A to substrate of 1:5 were incubated with p300 (40 fmol) in the presence (lanes 2, 4 and 6) or absence (lanes 1, 3 and 5) of GST–E1A in a total volume of 20
l with an acetyl-CoA concentration of 20
M for 30 min at 37°C. Reactions were loaded on a 12% SDS–polyacrylamide gel, stained with Coomassie Blue, destained, treated with Amplify (Amersham) for 15 min, dried and exposed for 24 h. (C) Quantitation of acetylation reactions shown in (B).
The acetyltransferase activity of p300 is important for both transcriptional stimulation and the partial topological recovery of disrupted chromatin (Figure 4). However, our evidence demonstrates that the acetyltransferase activity of p300 is not required for chromatin disruption. Therefore, either the acetyltransferase function is required to maintain (but not establish) a disrupted chromatin structure through the modification of histones, or a non-histone substrate is being modified with functional consequences. Recent observations have produced divergent results concerning the influence of E1A on the acetyltransferase function of p300. In a mammalian cell line, E1A stimulates histone acetylation (Ait-Si-Ali et al., 1998), whereas in vitro E1A inhibits histone acetylation (Chakravarti et al., 1999; Hamamori et al., 1999). In light of our observation concerning the requirement for p300 acetyltransferase activity at a step subsequent to chromatin disruption, we have focused on the effects of E1A on acetylation of substrates other than histones. We find that at high excesses of E1A to substrate (2-fold molar excess), acetylation of the histone is inhibited as reported (Chakravarti et al., 1999; Hamamori et al., 1999; A.Imhof, data not shown). The effects of E1A on acetyltransferase activity are more complex than simple inhibition, because under these same conditions the acetylation of MyoD is stimulated, whereas that of TR-RXR is inhibited (Figure 6B, lanes 1–4). At a more modest excess of E1A to substrate (1:5 ratio of E1A:histone), we find that E1A enhances acetylation of the core histones (Figure 6B, lanes 9–10). This same low ratio of E1A to other substrates has highly selective consequences for acetylation of the transcription factors TFIIE and TFIIF. Acetylation of TFIIE
and TFIIF (RAP 74) is severely inhibited at low ratios of E1A to substrate (Figure 6A and B, lanes 5–8). These results would be consistent with a model whereby the p300 acetyltransferase function is required to modify other substrates aside from the histones. E1A might impair or facilitate modification of these substrates, altering their function and consequently the influence of p300 on minichromosome architecture and transcription.
The effects of E1A on transcriptional activation of the TR
A promoter by the histone deacetylase inhibitor trichostatin A (TSA)
As E1A influences the acetylation of multiple substrates in distinct ways depending on the nature of the substrate and the excess of E1A (Figure 6), we next approached the role of acetylation using a different reagent, the deacetylase inhibitor TSA. This deacetylase inhibitor has previously been shown to activate the TR
A promoter in Xenopus oocyte nuclei when assembled into chromatin during a replication-coupled reaction to an extent equivalent to the addition of ligand-bound TR-RXR (Wong et al., 1998). We find that E1A inhibits basal transcription (Figure 7, compare lanes 1 and 2) and that TSA activates transcription (compare lanes 1 and 3). Interestingly, E1A substantially reduces but does not eliminate TSA-activated transcription (Figure 7, compare lanes 3 and 4). This implies that E1A acts to inhibit transcription through mechanisms in addition to any influence on histone acetylation. As TSA addition also interferes with the deacetylation of the basal transcriptional machinery components TFIIE
and TFIIF (A.Imhof, unpublished observations), it is probable that E1A can influence transcription in this system through mechanisms independent of any change in protein acetylation status.
Figure 7.
E1A effects on TSA-activated transcription and chromatin remodeling of the TR
A minichromosome. Xenopus oocytes were either incubated or not in 10 ng/ml TSA as indicated. Where indicated, groups of 15–20 oocytes were injected with 2 fmol of E1A mRNA. Two hours after this cytoplasmic injection, single-stranded TR
A promoter was injected into the nucleus in 9.2 nl (0.1
g/
l). The oocytes were then incubated for 16 h at 18°C. (A) Transcriptional activity as assayed by primer extension. The positions of the TR
A transcripts and the histone H4 loading control are indicated. (B) Nucleosomal array organization as assayed by micrococcal nuclease digestion of the minichromosomes whose transcriptional activity was digested with 4–120 U of micrococcal nuclease at 25°C for 2 min. The DNA was then purified, separated on a 2% agarose gel, transferred to Hybond+ membrane and hybridized with random primed probe from the entire TR
A plasmid. Lanes 1–3 as lane 1 in (A); lanes 4–6 as lane 2 in (A); lanes 7–9 as lane 3 in (A); and lanes 10–12 as lane 4 in (A). The numbers indicate mono-, di-, tri- and tetranucleosomal size DNA fragments. (C) TSA and E1A effects on topology. DNA from the same batch of oocytes as in (A) was purified and analyzed for its topology on a 1.2% agarose gel in 1
TPE buffer with 90
g/ml chloroquine. The detection of DNA was done by conventional Southern blotting. Non-injected DNA (In) and topoisomerise I relaxed DNA (Re) were used as markers for the Southern analysis. Lanes 1–4 as lanes 1–4 in (A). The arrow indicates the direction of increase in negative superhelicity (i.e. nucleosomes). NC shows the migration of nicked circular DNA. (D) The experimental procedure is as in (C) except that the chloroquine concentration is 30
g/ml. The densitometric scans of lanes 1–4 are for ease of comparison of the topoisomers.
As E1A inhibits TR-RXR-induced chromatin remodeling in the presence of ligand (Figure 5), we next examined whether E1A would influence any effect of TSA on chromatin disruption. As previously reported (Wong et al., 1998), we find that the addition of TSA has relatively little effect on the topology of DNA (Figure 7C and D, lanes 1 and 3) in spite of the robust activation of transcription (Figure 7A, lanes 1 and 3). The addition of E1A leads to small changes in the distribution of topoisomers with a slight increase in superhelicity in the absence of TSA and a decrease in the presence of TSA (Figure 7C and D, lanes 1–4). Using micrococcal nuclease to assay nucleosomal spacing and accessibility, we find that the addition of TSA leads to a disruption of the nucleosomal array (Figure 7B, compare lanes 1–6 with 7–12). This disruption is larger than we have reported previously (Wong et al., 1998); however, we are using twice the concentration of TSA used previously. The addition of E1A improved the quality of the nucleosomal array in the absence of TSA, but less so in the presence of the deacetylase inhibitor (Figure 7B, compare lanes 1–3 with 4–6, and 7–9 with 10–12).
These experiments show that E1A interferes with TSA-activated transcription (Figure 7A), but in contrast to the complete inhibition of transcription induced by TR-RXR plus ligand (Figure 5A), E1A does not completely inhibit activation of the TR
A promoter. Consistent with the effects on transcription, while E1A inhibits topological change induced by ligand-bound TR-RXR (Figure 5B and C), addition of E1A does not inhibit the more modest alterations in topology induced by TSA (Figure 7C and D). We conclude that E1A can impede transcriptional activation of the TR
A promoter by mechanisms that are auxiliary to any influence on protein acetylation.
E1A selectively restricts chromatin structural transitions instigated by ligand-bound TR-RXR
An alternative hypothesis for the action of E1A is that it impedes not only p300 function, but also that of other chromatin remodeling activities that are required for p300 to activate transcription or alter template topology. In fact, chromatin remodeling might be independent of p300 entirely, and the effects of E1A on the process might not require interaction with p300 at all. In addition, E1A prevents topological change due to ligand-bound receptor (Figure 5); however, it is possible that chromatin functional or structural transitions, as reflected by transcription or nuclease accessibility, might occur independently of major changes in minichromosome topology (see Figure 7; Pederson and Morse, 1990; Drabik et al., 1997; Wong et al., 1998). Minichromosomes including the TR
A gene promoter showed the same stimulation of transcription by exogenous p300 and inhibition of transcription by E1A as previously observed in the presence of ligand-bound TR-RXR (Figure 8A and B). DNase I-hypersensitive site analysis (Figure 8C) revealed that the addition of hormone to the chromatin-bound receptor enhances DNase I hypersensititivity as previously observed (Figure 8C, lanes 1–4; Wong et al., 1997a, b). In contrast, neither p300 nor E1A had any major influence on hypersensitivity at the TR
A TRE. Densitometric analysis suggests that p300 enhances DNase I hypersensitivity slightly, whereas E1A represses DNase I cleavage (data not shown). However, whereas ligand-bound TR-RXR would disrupt the regular nucleosomal array obtained on micrococcal cleavage of repressed chromatin (Figure 8D, compare lanes 1–3 with 4–6), E1A inhibited this chromatin disruption (lanes 10–12). Exogenous p300 did not enhance or inhibit chromatin disruption using the micrococcal nuclease cleavage assay (Figure 8D, lanes 7–9). The inhibition of chromatin disruption by E1A, induced by ligand-bound TR-RXR as assayed by micrococcal nuclease and minichromosome topology (Figures 5, 8C and D), is in contrast to the failure to inhibit the effects of the histone deacetylase inhibitor TSA completely (Figure 7). We conclude that whereas a DNase I-hypersensitive site can be established on the TR
A promoter in chromatin independently of exogenous p300 or E1A, the chromatin disruption assayed by changes in DNA topology (Figure 5) or micrococcal nuclease cleavage (Figure 8D) is inhibited by E1A. We suggest that E1A must be targeting a chromatin remodeling activity independently of p300. To test this hypothesis further, we made use of a mutant form of E1A (
N) that lacks the N-terminal domain important for association with p300 (Arany et al., 1995). We find that expression of both wild-type E1A and the
N variant impairs chromatin disruption over the TR
A promoter instigated by ligand-bound TR-RXR (Figure 8E and F, compare lanes 2, 5, 8 and 11). However, examination of the micrococcal cleavage patterns with densitometry suggests that the
N mutation of E1A does not restore the regular nucleosomal array as effectively as wild-type E1A. In agreement with Chakravarti et al. (1999), we also find that the
N mutant of E1A inhibits transcription from the TR
A promoter weakly in comparison with wild-type E1A (Figure 8G, compare lanes 3 and 4). Examination of the topological change of the minichromosome shows that while wild-type E1A gives a complete inhibition of the topological change induced by ligand-bound TR-RXR, the
N mutant gives only a partial inhibition (Figure 8H, compare lanes 3 and 4). Taken together, these observations suggest that while p300 may have a facilitating or stabilizing role in chromatin disruption, other activities will have significant roles in the remodeling events necessary to activate transcription at the TR
A promoter.
Figure 8.
p300 and E1A regulate transcriptional activation and nucleosome remodeling from TR
A promoter. (A) Effects of p300 and E1A on TR-RXR-induced transcription. Xenopus oocytes were first injected with different mRNAs for protein synthesis. Two hours after the cytoplasmic injection, single-stranded TR
A promoter was injected into the nucleus in 9.2 nl (0.1
g/
l). The oocytes were then incubated in the presence or absence of 50 nM T3 hormone at 18°C for 16 h. The microinjected oocytes (15–20) for each experimental group were collected for the transcription activity by primer extension. Lane 1, TR and RXR mRNA (1 fmol) without hormone induction; lane 2, TR and RXR mRNA (1 fmol) with T3 induction; lane 3, TR, RXR mRNA (1 fmol) and p300 mRNA (2 fmol) in the presence of T3; lane 4, TR, RXR mRNA (1 fmol), p300 mRNA (2 fmol) and E1A mRNA (2 fmol) with T3 hormone induction. (B) Quantification of the experiment in (A) by PhosphorImager analysis. The endogenous H4 signal is used as a loading control. The transcription signals are plotted as fold induction relative to control [lane 1 in (A)]. (C) DNase I-hypersensitivity analysis of the experiment in (A). Twenty oocytes from each experimental group were used for the DNase I-hypersensitivity assay. DNase I digestion was carried out at 9–18 U/100
l at 37°C for 2 min. The purified DNA was then digested with EcoRI restriction enzyme, separated on a 1% agarose gel, transferred to Hybond+ membrane and hybridized with random primed probe from a 268 bp CAT segment (BglII–EcoRI, from +306 to +584). Lanes 1 and 2 as lane 1 in (A); lanes 3 and 4 as lane 2 in (A); lanes 5 and 6 as lane 3 in (A); and lanes 7 and 8 as lane 4 in (A). (D) E1A prevents nucleosome remodeling. The organization of minichromosome was analyzed by MNase digestion of the same batch of oocytes as in (A). The microinjected oocytes (20–25) were used for each experimental group. The oocytes were homogenized and digested with 4–120 U of micrococcal nuclease at 25°C for 2 min. The DNA was then purified, separated on 2% agarose gel, transferred onto Hybond+ membrane and hybridized with random primed probe from the promoter region of the TR
A plasmid (a 108 bp PstI–RsaI fragment from -255 to -147). Lanes 1–3 as lane 1 in (A); lanes 4–6 as lane 2 in (A); lanes 7–9 as lane 3 in (A); and lanes 10–12 as lane 4 in (A). (E) E1A synthesis in the oocytes by [35S]methionine labeling. The oocytes were injected with either wild-type E1A (WT, lane 1) or the N-terminus deletion of E1A (
N, lane 2). Lane 3 is a control for no exogenous protein expression. (F) Effects on nucleosome remodeling by E1A and
N E1A. The experimental procedure is as in (D). Lanes 1–3, TR and RXR mRNA (1 fmol) without hormone induction; lanes 4–6, TR and RXR mRNA (1 fmol) with T3 induction; lanes 7–9, TR, RXR mRNA (1 fmol), p300 mRNA (2 fmol) and wild-type E1A mRNA (20 fmol) with T3 induction; lanes 10–12, TR, RXR mRNA (1 fmol), p300 mRNA (2 fmol) and mutant E1A mRNA (2 fmol) with T3 induction. (G) Influence of E1A and
N E1A on transcription. The experimental procedure is as in (A). Xenopus oocytes were first injected with different mRNAs for protein synthesis as indicated. Two hours after cytoplasmic injection, single-stranded TR
A was injected into the nucleus in 9.2 nl (0.1
g/
l). The oocytes were then incubated in the presence or absence of T3 hormone at 18°C for 16 h as indicated. The microinjected oocytes (15–20) were then collected for transcription assay by primer extension. Lane 1, TR, RXR mRNA (1 fmol) without hormone induction; lane 2, TR and RXR mRNA (1 fmol) with T3 induction; lane 3, TR, RXR mRNA (1 fmol), p300 mRNA (2 fmol) and WT E1A (2 fmol) with hormone induction; lane 4, TR, RXR mRNA (1 fmol), p300 mRNA (2 fmol) and
N E1A (2 fmol) with hormone induction. The positions of TR
A transcripts and the H4 loading control are shown. Quantitation of transcription (not shown) reveals a 40% reduction in transcription of TR
A in lane 2 relative to lane 4 when normalized to the H4 loading control. (H) Influence of E1A and
N E1A on topological change induced by ligand-bound TR-RXR. DNA from the same batch of oocytes as in (G) was purified and analyzed for its topology on a 1.2% agarose gel in 1
TPE buffer with 90
g/ml chloroquine. The detection of DNA was done by conventional Southern analysis. Lanes 1–4 as lanes 1–4 in (G). The arrow indicates the direction of increase in negative superhelicity (i.e. nucleosomes). NC shows the migration of nicked circular DNA. Densitometric scans are shown for ease of comparison between topoisomers.
Discussion
Top of pageThe major conclusion from this work is that p300 itself does not disrupt chromatin, but stimulates transcription from a disrupted chromatin template. This transcriptional stimulation requires acetyltransferase activity. Moreover, overexpression of a p300 mutant deficient in acetyltransferase activity leads to association with TR-RXR but does not inhibit chromatin disruption or transcription. This provides further evidence that p300 has no essential role in chromatin disruption and transcriptional activation induced by ligand-bound TR-RXR. E1A eliminates chromatin disruption by ligand-bound TR-RXR; however, E1A can inhibit but not eliminate transcription from a chromatin template in the presence of the deacetylase inhibitor TSA. This indicates that protein acetylation can stabilize promoter activity such that any inhibitory effect of E1A on acetyltransferase function can not completely inactivate the TR
A promoter. A mutant of E1A that has severely reduced binding to p300 impairs disruption and transcriptional activation but does so less efficiently than wild-type E1A. We conclude that p300 does not have an essential role in disrupting chromatin on the TR
A promoter as targeted by the ligand-bound TR-RXR. Instead, p300 acts primarily to stimulate transcription at a subsequent step by acetylation of proteins associated with the TR
A promoter.
Chromatin remodeling and transcription
Canonical nucleosomes can provide a major impediment to transcription. There are two general pathways for alleviating this impediment: histones can be post-translationally modified to destabilize chromatin, especially by acetylation (reviewed by Hansen et al., 1998); and nucleosomes can be disrupted through the activity of ATP-driven machines such as DNA polymerase (Sogo et al., 1986), RNA polymerase (Studitsky et al., 1997) or the SWI–SNF complex (Coté et al., 1994; Kwon et al., 1994). In yeast, these histone acetyltransferases and SWI–SNF activities have overlapping functional roles (Pollard and Peterson, 1997, 1998; Holstege et al., 1998). Recent results suggest that the SWI–SNF complex acts before histone acetyltransferases to activate transcription (Cosma et al., 1999). In animal cells these relationships have not yet been assessed. There is accumulating evidence that nuclear receptors can interact with vertebrate homologs of the SWI–SNF complex (Yoshinaga et al., 1992; Muchardt and Yaniv, 1993; Chiba et al., 1994; Fryer and Archer, 1998). The largest subunit of the mammalian SWI–SNF complex contains key receptor interaction motifs (Heery et al., 1997; Dallas et al., 1998). These interactions might account for the stimulation of receptor-dependent transcription in the presence of SWI–SNF complex (Yoshinaga et al., 1992; Muchardt and Yaniv, 1993). Fryer and Archer (1998) have shown that nuclear receptors can target the vertebrate SWI–SNF complex, and Di Croce et al. (1999) have shown comparable topological changes to those we report here, which are targeted by the progesterone receptor and mediated by ISWI-containing complexes. We have begun to characterize the Xenopus BRG1–BAF complex (Gelius et al., 1999). However, whether other coactivators are required to facilitate the transcription process from a disrupted chromatin template has not been determined.
In Drosophila extracts, the NURF, CHRAC and ACF chromatin remodeling complexes each contain the ISWI member of the SWI2–SNF2 superfamily that disrupts chromatin (Corona et al., 1999) and facilitates both DNA replication (Alexiadis et al., 1998) and transcription (Ito et al., 1997; Mizuguchi et al., 1997). These experiments show that chromatin disruption mediated by ISWI complexes can be an important determinant of template activity. Likewise, chromatin assembly has been shown to be important in revealing transcriptional synergy between ligand-bound nuclear receptors and p300 (Kraus and Kadonaga, 1998). In this case, chromatin disruption was not assayed; however, p300 was determined to facilitate transcription complex assembly but not reinitiation by RNA polymerase. The available evidence suggests that chromatin disruption would have to occur in order to allow the basal transcriptional machinery to gain access to DNA (Workman and Roeder, 1987; Meisterernst et al., 1990; Imbalzano et al., 1994; Godde et al., 1995; Li et al., 1998). Our results indicate that p300 itself does not disrupt chromatin (Figures 1, 2, 5 and 8); in addition, neither SRC-1 nor PCAF, which are also transcriptional coactivators for nuclear receptors (Figure 2; Glass et al., 1997; Spencer et al., 1997), can disrupt chromatin, while PCAF can stimulate transcription >3-fold in the presence of ligand-bound TR-RXR (Figures 3 and 5). This indicates that chromatin remodeling activities other than histone acetyltransferases are required. This conclusion is consistent with recent results in yeast (Cosma et al., 1999) which indicate that SWI–SNF proteins need to act before histone acetyltransferases.
p300 stimulates transcription from a disrupted chromatin template (Figure 1). The PCAF coactivator also facilitates transcription in the absence of further chromatin disruption (Figures 3 and 5). This indicates that chromatin disruption itself, while rendering a chromatin template competent for transcription, does not lead to maximal transcriptional efficiency. p300 and PCAF may enhance transcription from a disrupted chromatin template by facilitating recruitment of the basal transcriptional machinery (Barlev et al., 1995; Nakajima et al., 1997a, b; Kraus and Kadonaga, 1998). However, our results indicate that acetyltransferase activity is required for transcriptional stimulation from a disrupted chromatin template (Figure 4). This implies that this acetyltransferase activity is required either to maintain directly a disrupted chromatin structure or to modify other transcriptional regulators to facilitate transcription. Consistent with the requirement for chromatin disruption, there is evidence that the acetyltransferase activity of coactivators operates more effectively on free histone than nucleosome histone (Ogryzko et al., 1996; Ohba et al., 1999). It should be noted that hyperacetylated histones have relatively small effects on chromatin topology even when incorporated into less stable nucleosomal arrays, while still facilitating transcription (Norton et al., 1989; Lutter et al., 1992; Nightingale et al., 1998; Tse et al., 1998). This conclusion is further reinforced by our results on transcriptional activation by the histone deacetylase inhibitor TSA (Figure 7; Wong et al., 1998). In these experiments, transcription is induced to the same levels as in the presence of ligand-bound TR-RXR, but topological changes are relatively minor. Thus, acetylation itself can not account for all of the characteristics of disrupted chromatin, suggesting that other activities such as SWI–SNF, which stably modify chromatin, will be important (Snitzler et al., 1998; Di Croce et al., 1999).
It is possible that histone acetylation might inhibit SWI–SNF-mediated remodeling, leading to a partial recovery of nucleosomal architecture and superhelicity (Figure 1C and D, compare lanes 5 and 6). The histone tails are important for the activity of Drosophila NURF, an ISWI-containing chromatin remodeling complex (Georgel et al., 1997), and for the efficiency of chromatin remodeling by the human SWI–SNF complex (Guyon et al., 1999). In this respect, it is also interesting to note that a robust biochemical connection exists between chromatin deacetylation and nucleosome remodeling by other SWI–SNF superfamily members (Tong et al., 1998; Wade et al., 1998a). Evidence consistent with functional roles connected with the modification of transcription factors is less direct; however, it is clear that E1A inhibits the acetylation of TFIIE
, TFIIF and the TR itself with much greater sensitivity than acetylation of histones (Figure 6). Both TFIIE
and TFIIF have important roles in pre-initiation complex assembly and function (Tan et al., 1994; Yokomori et al., 1998). Alterations in pre-initiation complex assembly could also indirectly influence chromatin structure (Gregory et al., 1998). Interestingly, E1A will only partially inhibit transcription from a chromatin template assembled in the presence of high concentrations of TSA. Under these conditions, chromatin never has the opportunity to mature to a deacetylated repressed state (Ura et al., 1997). This implies that either E1A can act to interfere with the acetylation of substrates that are deacetylated by enzymes that are TSA resistant, or E1A can also interfere with transcription at levels other than those dependent on protein acetylation (see below). Future experiments will explore these possibilities.
The nature of chromatin disruption
The extent of chromatin disruption assayed by change in DNA topology that can be achieved on a small minichromosome (5 kb or
28 nucleosomes) is remarkable. The addition of saturating ligand-bound TR-RXR leads to the loss of negative superhelicity equivalent to the displacement of eight nucleosomes or approximately one-third of the minichromosomal chromatin. This would slightly exceed the entire domain of chromatin containing the TR
A regulatory DNA, where the upstream TREs begin 800 bp upstream from the start site of transcription and the most distal 3'TRE lies 264 bp downstream (Machuca et al., 1995; Ranjan et al., 1995; F.Urnov, manuscript in preparation). This domain would include five to six nucleosomes. Each TRE has the capacity to target ligand-bound TR-RXR and alter the organization of two to three nucleosomes (Wong et al., 1997a). Although the loss of regular nucleosomal arrays occurs selectively over the promoter (Wong et al., 1995, 1997a), there is not a huge increase in the rate of cleavage by micrococcal nuclease or DNase I (Figure 8; F.Urnov, manuscript in preparation). Thus, we favor a model in which histones remain associated with DNA. What then could account for a large change in DNA topology? We suggest that rather than a displacement of nucleosomes, a relatively minor alteration in the exit angles of DNA as it wraps around the histone octamer could account for our results. Each nucleosome whose entry and exit paths of the DNA helix crossover on wrapping around the histone octamer introduces one complete negative superhelical turns into DNA. The simple alteration of the path of DNA at the entry and exit of the nucleosome such that the helix does not crossover itself immediately reduces the number of negative superhelical turns introduced by each nucleosome to zero (Worcel et al., 1981). This type of structural transition should also uncoil the linker DNA consistent with a transition from coiled (Yao et al., 1991) to straight configuration (Bednar et al., 1998). The mononucleosome core crystals suggest that DNA has a trajecture leaving the core that could accommodate DNA being either crossed or not crossed without difficulty (Luger et al., 1997). Thus, we suggest that TR-RXR introduces a change in nucleosomal DNA consistent with a movement of DNA from crossed to not crossed within two to three nucleosomes in the vicinity of the TRE. This would lead to a local disruption of the chromatin higher-order structure, which in turn may facilitate transcription. In the case of the 3'TRE at +264, binding of the TR-RXR at the dyad axis of a positioned nucleosome could assist this alteration in DNA path (Wong et al., 1995, 1997b). In this model, p300 might direct a topological recovery by stabilizing aspects of pre-existing higher-order structure perhaps through direct contacts with histones (see Ornaghi et al., 1999). Finally, this type of model, where nucleosome conformational change accounts for changes in topology, offers the potential to reconcile the continued presence of mobile nucleosomes on minichromosomal templates treated with ISWI-containing complexes (Hamiche et al., 1999; Langst et al., 1999), with the large topological changes observed with SWI–SNF-treated minichromosomes (Imbalzano et al., 1994; Kwon et al., 1994). ISWI-directed nucleosome mobility should promote transcription factor access to DNA (Ura et al., 1995, 1997), and if it occurs in conjunction with a change in higher-order structures, as reflected in topological transtions that uncoil linker DNA, this will further facilitate nucleosome mobility and transcription (Di Croce et al., 1999).
The effect of E1A on chromatin remodeling and transcription
The adenovirus E1A gene encodes potent oncoproteins that function to regulate both cellular and viral transcription. E1A physically interacts with Rb, p300, PCAF and other key regulatory proteins, thereby altering their function and disrupting the normal cellular transcriptional program (Dyson and Harlow, 1992; Bayley and Mymryk, 1994; Reid et al., 1998; Chakravarti et al., 1999). In earlier work, E1A has been shown to bind directly to TBP (Meyer et al., 1996) and to contact nuclear receptors (Meyer et al., 1996; Wahlstrom et al., 1999), perhaps facilitating transcription by direct bridging (Berkenstam et al., 1992; Wahlstrom et al., 1999). These experiments largely make use of transient transfections and model reporter constructs that are unlikely to assemble chromatin fully with the same configuration that occurs in a natural chromosomal environment (Archer et al., 1992). In contrast, we have focused on the impact of E1A in a chromatin environment to explore the role of chromatin remodeling in transcription. We have made use of E1A to explore chromatin remodeling and transcriptional stimulation by p300. Mutational analysis has demonstrated that the N-terminus of E1A (amino acids 1–76) plays an important role in p300 binding (Arany et al., 1995) and that this interaction is important in constraining p300 function (Chakravarti et al., 1999). The exact mechanisms by which E1A interferes with p300 function are unclear. E1A can disrupt p300 interaction with PCAF (Yang et al., 1996; Kurokawa et al., 1998); however, PCAF is absent from Xenopus oocytes, which excludes this as a regulatory mechanism in our system (Li et al., 1998). In earlier studies it was found that PCAF acetyltransferase activity was essential for gene activation by the RAR, whereas the acetyltransferase activity of CBP/p300 was not required (Korzus et al., 1998). Our results in the Xenopus oocyte differ in that p300 acetyltransferase activity is essential for maximal transcription efficiency (Figure 4). This difference might be due to more efficient chromatin assembly in our system or to the absence of PCAF from oocytes (Li et al., 1998). Alternatively, the earlier study (Korzus et al., 1998) made use of blocking antibodies to inhibit enzymatic activity, while we make use of p300 mutants deficient in acetyltransferase. E1A does not influence TR-RXR interaction with p300 in our system or in others (Kurokawa et al., 1998); however, E1A does influence the acetyltransferase activity of p300 (Chakravarti et al., 1999; Perissi et al., 1999). Consistent with the inhibition of acetyltransferase model (Chakravarti et al., 1999), we find that E1A inhibits p300 acetyltransferase activity, but does so much more effectively on the transcription factors TFIIE
, TFIIF and TR-RXR than on the histones (Figure 6). This selectivity suggests a mechanism for transcriptional stimulation by p300 where the transcriptional machinery represents preferential targets for interaction and acetylation rather than the histones. Acetylation of TFIIE
and TFIIF has only a low 2-fold stimulatory effect on the transcription of naked DNA (Wade et al., 1998b), so other targets such as the TR and RXR might be important. However, E1A has other consequences with respect to chromatin remodeling.
E1A does not lead to major changes in the assembly of a DNase I-hypersensitive site on the TR
A promoter (Figure 8C). This might be explained by the capacity of the receptor in purified form to associate with chromatin substrates due to features of nucleosome architecture over the TR
A promoter (Wong et al., 1997b). However, E1A blocks the disruption of nucleosomal arrays as assayed by micrococcal nuclease or the alterations in minichromosome topology instigated by ligand-bound TR (Figures 5 and 8). This block in these aspects of chromatin remodeling does not absolutely require interactions with p300 since the N-terminal deletion mutant of E1A still impedes these events (Figure 8E and F). E1A may function in these assays by inhibiting chromatin remodeling by interfering with the activity of vertebrate homologs of the SWI–SNF complex. In yeast, E1A inhibits SWI–SNF functions (Miller et al., 1996). Moreover, the C-terminus of E1A is known to determine interactions with Rb family members (Dyson and Harlow, 1992; Moran, 1993), and Rb physically interacts with hBRG1 and hBRM, two human SNF homologs (Dunaief et al., 1994; Strober et al., 1996). Thus, it is possible that the N-terminal deletion of E1A used in our experiments is impeding the activity of the vertebrate SWI–SNF complex. This would provide an alternative indirect mechanism by which E1A could interfere with p300 function. In this model, the inhibition of chromatin remodeling by E1A would prevent the p300 acetyltransferase from stimulating transcription.
Materials and methods
Top of pagePlasmid DNA
T7TSp300 expression constructs generating M2-tagged p300 were described previously (Li et al., 1998). T7TSE1A and T7PCAF expression plasmids were constructed by BamHI–HindIII digestion from mammalian expression clones (Yang et al., 1996) and blunt end ligation into the EcoRV site of pT7TS vector (Zorn and Krieg, 1997). SP6 expression constructs for murine SRC-1a and derivatives containing amino acids 1107–1441 (SRC-1a, 1107–1441) and 1216–1441 (SRC-1a, 1216–1441) were the kind gift of Dr Daniel Robyr, Université de Lausanne, Switzerland. Xenopus HSF expression clones have been described (Landsberger and Wolffe, 1997).
Microinjection of Xenopus oocytes
Defolliculated Xenopus stage VI oocytes were prepared as described previously (Almouzni and Wolffe, 1993). The amount or combination indicated of mRNA (TR, RXR, p300 and E1A) was injected into oocyte cytoplasm in 27.6 nl volume. Protein synthesis was allowed by incubating the oocytes at 18°C for 16 h. The nuclear injection of single-strand TR
A reporter DNA (1–2 ng in 9.2 nl) was routinely done 2 h after mRNA injection. T3 (50 nM) was used for hormone induction.
Protein extraction
Protein from oocytes was prepared by homogenizing the oocytes in 20 mM HEPES buffer containing 70 mM KCl, 5% sucrose and 1 mM dithiothreitol (DTT). The homogenate was centrifuged at 10 000 r.p.m. at 4°C for 10 min and separated on 4–20% Tris-glycine gradient gel (Novex).
'Histone' acetyltransferase (HAT) assay
Purified p300 (25 ng) was incubated with 1
g of histone or other substrates in 1
HAT buffer [50 mM Tris pH 8.0, 0.1 mM EDTA, 10% glycerol, 1 mM DTT and 1 mM phenylmethylsulfonyl fluoride (PMSF)] in the presence of [3H]acetyl-CoA for 30 min at 37°C in a volume of 20
l. The reaction was stopped by addition of 20
l of 2
SDS sample buffer and subjected to 4–20% SDS–PAGE analysis. The gel was stained by Coomassie Blue R for 10 min and destained overnight. The gel was then vacuum dried, exposed to film and scanned using a PhosphorImager (Molecular Dynamics) (Kodak). For in vitro acetylation reactions the following protocol was used. Recombinant human p300 (40 fmol) was used to acetylate core histones purified from chicken erythrocytes or other substrates. Reactions were done in a total volume of 100
l in 1
HAT buffer (50 mM Tris–HCl pH 8.0, 10% glycerol, 1 mM DTT, 1 mM PMSF, 50 mM NaCl) in the presence of 3.5
l of [3H]acetyl-CoA (Amersham, 0.25 mCi/ml) at 25°C. Inhibition assays were done by preincubating glutathione S-transferase (GST)–E1A with the respective enzyme for 5 min at room temperature (22°C) before assembling the acetylation reaction. A fixed concentration of 3
M substrate was used and GST–E1A concentration was varied. Reactions were loaded on a 12% SDS–polyacrylamide gel, stained with Coomassie Blue, destained, treated with Amplify (Amersham) for 15 min, dried and exposed for 24 h before quantitation in the PhosphorImager.
Immunoprecipitation assay
Ten oocytes equivalent of protein were used for each pull-down assay. Monoclonal antibody against p300 (a kind gift from Dr Betty Moran) and polyclonal antibody against TR were coupled to protein G- or A–Sepharose (Pharmacia Biotech). The [35S]methionine-labeled oocytes extract was incubated with either beaded p300 antibody or TR antibody in 500
l of 1
binding buffer (100 mM NaCl, 20 mM Tris pH 8.0, 5 mM MgCl2, 0.5 mM EDTA, 10% glycerol, 1 mM DTT and 1 mM PMSF) for 1 h at 4°C. The reaction was washed three times with 1 ml of washing buffer (250 mM NaCl, 20 mM Tris pH 8.0, 5 mM MgCl2, 0.5 mM EDTA, 10% glycerol, 1 mM DTT, 1 mM PMSF, 0.05% NP-40). Pellet from the last wash was dissolved in 20
l of SDS sample buffer and analysis on 4–20% SDS–polyacrylamide gel (Li et al., 1998).
mRNA preparation and primer extension
The total RNA from oocytes was prepared using RNA STAT-60 as instructed (Tel-Test, Inc.). Primer extension was performed on two oocytes equivalent of RNA. Primer I (ATCCTTATAAACGGTGAGTAGTGATGTCATCAG) was used to detect the specific TR
A transcript. H4 primer (GGCTTGGTGATGCCCTGGATGTTATCC) was employed to probe the endogenous H4 mRNA as an internal control for sample loading. Annealing of primer was carried out in 1
first strand buffer (Gibco-BRL) at 65°C for 10 min, then at 55°C for 25 min and finally at 42°C for 10 min in a volume of 10
l. Primer extension was performed at 42°C for 1 h in 20
l with Superscript II as recommended (Gibco-BRL). The reaction was stopped by 15
l of denaturing loading buffer and 5
l of the sample was analyzed on 6% denaturing sequencing gel (Wong et al., 1995).
DNase I hypersensitivity analysis
Stage VI oocytes were injected and incubated as described above. Groups of 20 healthy oocytes were collected and homogenized with the following buffer: 10 mM Tris–HCl pH 8.0, 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 5% glycerol and 5 mM MgCl2. The DNase I (Worthington) digestion was carried out at 9–18 U/100
l for 2 min at 37°C. The reaction was stopped by addition of an equal volume of stop solution containing 0.5% SDS and 20 mM EDTA. DNA was then purified by RNase A treatment, proteinase K digestion, phenol–chloroform extraction and isopropanol precipitation. For indirect end labeling, the purified DNA was restricted with EcoRI before resolution on 1% agarose gel, transfer to a filter and hybridization with a BglII–EcoRI DNA fragment that had been radiolabeled by random priming (Wong et al., 1997b).
Micrococcal nuclease mapping
Stage VI oocytes were injected and incubated as described previously. Groups of 25 healthy oocytes were collected and homogenized with the following buffer: 10 mM Tris–HCl pH 8.0, 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 5% glycerol, 3 mM CaCl2 and 5 mM MgCl2. The Mnase (Pharmacia) digestion was carried out at 4–120 U/100
l for 2 min at 25°C. The reaction was stopped by addition of an equal volume of stop solution containing 0.5% SDS and 20 mM EGTA. DNA was then purified by RNase A treatment, proteinase K digestion, phenol–chloroform extraction and isopropanol precipitation. The purified DNA was resolved on 1% agarose gel, transferred to a filter and hybridized with random primed probe containing a segment of the promoter (a 108 bp PstI–RsaI fragment from -255 to -147) from the TR
A plasmid (Wong et al., 1997a).
Supercoiling assay of DNA topology
Purified DNA (1 ng) from injected oocytes was separated on 1% agarose gel in 1
TPE buffer (40 mM Tris, 30 mM NaH2PO4 and 10 mM EDTA) containing 30–90
g/ml freshly prepared chloroquine at 3.5 V/cm in the dark (Clark and Wolffe, 1991). The gel was then washed with distilled water for 1 h and the DNA was detected by conventional Southern blotting as for the micrococcal nuclease mapping.
Acknowledgements
Top of pageWe thank Jiemin Wong for help with the SRC 1 experiment. We thank the anonymous referees for very useful suggestions. We are grateful to Ms Thuy Vo for manuscript preparation. A.I. was supported by the Human Frontiers Science Program.
References
Top of pageAarnisalo P, Palvimo JJ and Janne OA (1998) CREB-binding protein in androgen receptor-mediated signaling. Proc Natl Acad Sci USA, 95, 2122–2177. | Article | PubMed | ChemPort |
Ait-Si-Ali S et al. (1998) Histone acetyltransferase activity of CBP is controlled by cell cycle-dependent kinases and oncoprotein E1A. Nature, 396, 184–186. | Article | PubMed | ISI | ChemPort |
Alexiadis V, Varga-Weisz PD, Boute E, Becker PB and Gruss C (1998) In vitro chromatin remodeling by chromatin accessibility complex (CHRAC) at the SV40 origin of DNA replication. EMBO J, 17, 3428–3438. | Article | PubMed | ChemPort |
Alland L, Muhle R, Hou H,Jr, Potes J, Chin L, Schreiber-Agus N and De Pinho RA (1997) Role of NCoR and histone deacetylase in Sin3-mediated transcriptional and oncogenic repression. Nature, 387, 49–55. | Article | PubMed | ISI | ChemPort |
Allfrey V, Faulkner RM and Mirsky AE (1964) Acetylation and methylation of histones and their possible role in the regulation of RNA synthesis. Proc Natl Acad Sci USA, 51, 786–794. | Article | PubMed | ChemPort |
Almer A and Horz W (1986) Nuclease hypersensitive regions with adjacent positioned nucleosomes mark the gene boundaries of the PHO5/PHO3 locus in yeast. EMBO J, 5, 2681–2687. | PubMed | ISI | ChemPort |
Almouzni G and Wolffe AP (1993) Replication coupled chromatin assembly is required for the repression of basal transcription in vivo. Genes Dev, 7, 2033–2047. | Article | PubMed | ISI | ChemPort |
Arany Z, Newsome D, Oldread E, Livingston DM and Eckner R (1995) A family of transcriptional adaptor proteins targeted by the E1A oncoprotein. Nature, 374, 81–84. | Article | PubMed | ISI | ChemPort |
Archer TK, Lefebvre P, Wolford RG and Hager GL (1992) Transcription factor loading on the MMTV promoter: a bimodal mechanism for promoter activation. Science, 255, 1573–1576. | Article | PubMed | ISI | ChemPort |
Barlev NA, Candau R, Wang L, Darpino P, Silverman N and Berger SL (1995) Characterization of physical interactions of the putative transcriptional adaptor ADA2 with acidic activation domains and TATA-binding-protein. J Biol Chem, 270, 19337–19343. | Article | PubMed | ISI | ChemPort |
Bayley ST and Mymryk JS (1994) Adenovirus E1A proteins and transformation. Int J Oncol, 5, 425–444. | ISI | ChemPort |
Becker PB (1994) The establishment of active promoters in chromatin. BioEssays, 16, 541–547. | Article | PubMed | ISI | ChemPort |
Bednar J, Horowitz RA, Grigoryev SA, Carruthers LM, Hansen JC, Koster AJ and Woodcock CL (1998) Nucleosomes, linker DNA, and linker histone form a unique structural motif that directs the higher order folding and compaction of chromatin. Proc Natl Acad Sci USA, 95, 14173–14178. | Article | PubMed | ChemPort |
Berger SL, Pina B, Silverman N, Marcus GA, Agapite J, Regier JL, Triezenberg SJ and Guarente L (1992) Genetic isolation of ADA2: a potential transcriptional adaptor required for function of certain acidic activation domains. Cell, 70, 251–265. | Article | PubMed | ISI | ChemPort |
Berkenstam A, Ruiz MM, Barettino D, Horikoshi M and Stunnenberg HG (1992) Cooperativity in transactivation between retinoic acid receptor and TFIID requires an activity analogous to E1A. Cell, 69, 401–412. | Article | PubMed | ISI | ChemPort |
Blanco JC, Minucci S, Lu J, Yang XJ, Walker KK, Chen H, Evans RM, Nakatani Y and Ozato K (1998) The histone acetylase PCAF is a nuclear receptor coactivator. Genes Dev, 12, 1638–1651. | PubMed | ISI | ChemPort |
Blobel GA, Nakajima T, Ecknev R, Montminy M and Orkin SH (1998) CREB-binding protein cooperates with transcription factor GATA-1 and is required for erythroid differentiation. Proc Natl Acad Sci USA, 95, 2061–2066. | Article | PubMed | ChemPort |
Boyes J, Byfield P, Nakatani Y and Ogrzyzko V (1998) Regulation of activity of the transcription factor GATA-1 by acetylation. Nature, 396, 594–598. | Article | PubMed | ISI | ChemPort |
Bresnick EH, John S, Berard DS, Lefebvre P and Hager GL (1990) Glucocorticoid receptor-dependent disruption of a specific nucleosome on the mouse mammary tumor virus promoter is prevented by sodium butyrate. Proc Natl Acad Sci USA, 87, 3977–3981. | PubMed | ChemPort |
Brownell JE and Allis CD (1996) Special HATs for special occassions: linking histone acetylation to chromatin assembly and gene activation. Curr Opin Genet Dev, 6, 176–184. | Article | PubMed | ISI | ChemPort |
Brownell JE, Zhou J, Ranalli T, Kobayashi R, Edmondson DG, Roth SY and Allis CD (1996) Tetrahymena histone acetyltransferase A: a homolog to yeast Gcn5p linking histone acetylation to gene activation. Cell, 84, 843–851. | Article | PubMed | ISI | ChemPort |
Candau R and Berger SL (1996) Structural and functional analysis of yeast putative adaptors. Evidence for an adaptor complex in vivo. J Biol Chem, 271, 5237–5245. | Article | PubMed | ISI | ChemPort |
Candau R, Zhou JX, Allis CD and Berger SL (1997) Histone acetyltransferase activity and interaction with ADA2 are critical for GCN5 function in vivo. EMBO J, 16, 555–565. | Article | PubMed | ISI | ChemPort |
Carr KD and Richard-Foy H (1990) Glucocorticoids locally disrupt an array of positioned nucleosomes on the rat tyrosine aminotransferase promoter in hepatoma cells. Proc Natl Acad Sci USA, 87, 9300–9304. | PubMed | ChemPort |
Cavalli G and Thoma F (1993) Chromatin transitions during activation and repression of galactose-regulated genes in yeast. EMBO J, 12, 4603–4613. | PubMed | ISI | ChemPort |
Cavalli G, Bachmann D and Thoma F (1996) Inactivation of topoisomerases affects transcription dependent chromatin transitions in rDNA but not in a gene transcribed by RNA polymerase III. EMBO J, 15, 590–597. | PubMed | ISI | ChemPort |
Chakravarti D, LaMorte VJ, Nelson MC, Nakajima T, Juguilon H, Montminy M and Evans RM (1996) Mediation of nuclear receptor signalling by CBP/p300. Nature, 383, 99–103. | Article | PubMed | ISI | ChemPort |
Chakravarti D, Ogryzyko V, Kao H-Y, Nash A, Chen H, Nakatani Y and Evans RM (1999) A viral mechanism for inhibition of p300 and PCAF acetyltransferase activity. Cell, 96, 393–403. | Article | PubMed | ISI | ChemPort |
Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y and Evans RM (1997) Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell, 90, 569–580. | Article | PubMed | ISI | ChemPort |
Chen JD and Evans RM (1995) A transcriptional co-repressor that interacts with nuclear hormone receptor. Nature, 377, 454–457. | Article | PubMed | ISI | ChemPort |
Chiba H, Muramatsu M, Nomoto A and Kato H (1994) Two human homologs of Saccharomyces cerevisiae SWI2/SNF2 and Drosophila brahma are transcriptional coactivators cooperating with the estrogen receptor and the retinoic acid receptor. Nucleic Acids Res, 22, 1815–1820. | Article | PubMed | ISI | ChemPort |
Chrivia JC, Kwok RP, Lamb N, Hagiwara M, Montminy MR and Goodman RH (1993) Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature, 365, 855–859. | Article | PubMed | ISI | ChemPort |
Ciana P, Braliou GG, Demay FG, von Lindern M, Bavettino D, Beug H and Stunnenberg HG (1998) Leukemic transformation by the v-erbA oncoprotein entails constitutive binding to and repression of an erythroid enhancer in vivo. EMBO J, 17, 7382–7394. | Article | PubMed | ISI | ChemPort |
Clark DJ and Wolffe AP (1991) Superhelical stress and nucleosome mediated repression of 5S RNA gene transcription in vitro. EMBO J, 10, 3419–3428. | PubMed | ISI | ChemPort |
Collingwood TN et al. (1998) A role for helix 3 of the TR
ligand-binding domain in coactivator recruitment identified by characterization of a third cluster of mutations in resistance to thyroid hormone. EMBO J, 17, 4760–4770. | Article | PubMed
Corona DF, Langst G, Clapier CR, Bonte EJ, Ferrari S, Tamkun JW and Becker PB (1999) ISWI is an ATP-dependent nucleosome remodeling factor. Mol Cell, 3, 239–245. | Article | PubMed | ISI | ChemPort |
Cosma MP, Tanaka T and Nasmyth K (1999) Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter. Cell, 97, 299–311. | Article | PubMed | ISI | ChemPort |
Coté J, Quinn J, Workman JL and Peterson CL (1994) Stimulation of GAL4 derivative binding to nucleosomal DNA by the yeast SWI/SNF complex. Science, 265, 53–60. | Article | PubMed | ISI | ChemPort |
Dallas PB, Cheney IW, Liao D-W, Bowrin V, Byam W, Pacchione S, Kobayashi R, Yaciuk P and Moran E (1998) p300/CREB binding protein related p270 is a component of mammalian SW/SNF complexes. Mol Cell Biol, 18, 3596–3603. | PubMed | ISI | ChemPort |
Di Croce L, Koop R, Venditti P, Westphal HM, Nightingale KP, Corona DFV, Becker PB and Beato M (1999) Two step synergism between the progesterone receptor and the DNA-binding domain of nuclear factor 1 on MMTV minichromosomes. Mol Cell, 4, 45–54. | PubMed | ISI | ChemPort |
Drabik CE, Nicita CA and Lutter LC (1997) Measurement of linker number change in transcribing chromatin. J Mol Biol, 267, 794–806. | Article | PubMed | ISI | ChemPort |
Du W, Thanos D and Maniatis T (1993) Mechanisms of transcriptional synergism between distinct virus-inducible enhancer elements. Cell, 74, 887–898. | Article | PubMed | ISI | ChemPort |
Dunaief JL, Strober BE, Guha S, Khavari PA, Alin K, Luban J, Begemann M, Crabtree GR and Goff SP (1994) The retinoblastoma protein and BRG1 form a complex and cooperate to induce cell cycle arrest. Cell, 79, 119–130. | Article | PubMed | ISI | ChemPort |
Dutnall RN, Tafrov ST, Sternglanz R and Ramakrishnan V (1998) Structure of the yeast histone acetyltransferase Hat1: insights into substrate specificity and implications for the Gcn5-related N-acetyltransferase superfamily. Cold Spring Harbor Symp Quant Biol, 63, 501–507. | PubMed | ISI | ChemPort |
Dyson N and Harlow E (1992) Adenovirus E1A targets key regulators of cell proliferation. Cancer Surv, 12, 161–195. | PubMed | ISI | ChemPort |
Eckner R, Ewen ME, Newsome D, Gerdes M, DeCaprio JA, Lawrence JB and Livingston DM (1994) Molecular cloning and functional analysis of the adenovirus E1A-associated 300-kd protein (p300) reveals a protein with properties of a transcriptional adaptor. Genes Dev, 7, 869–884.
Eckner R, Yao TP, Oldread E and Livingston DM (1996a) Interaction and functional collaboration of p300/CBP and bHLH proteins in muscle and B-cell differentiation. Genes Dev, 10, 2478–2490. | Article | PubMed | ISI | ChemPort |
Eckner R, Ludlow JW, Lill NL, Oldread E, Arany Z, Modjtahedi N, DeCaprio JA, Livington DM and Morgan JA (1996b) Association of p300 and CBP with simian virus 40 large T antigen. Mol Cell Biol, 16, 3454–3464. | PubMed | ISI | ChemPort |
Edmondson DG, Zhang W, Watson A, Xu W, Bone JR, Yu Y, Stillman D and Roth SY (1998) In vivo functions of histone acetylation/deacetylation in Tup1p repression and Gcn5p activation. Cold Spring Harbor Symp Quant Biol, 63, 459–468. | PubMed | ISI | ChemPort |
Emerson BM and Felsenfeld G (1984) Specific factor conferring nuclease hypersensitivity at the 5' end of the chicken adult
-globin gene. Proc Natl Acad Sci USA, 81, 95–99. | PubMed | ChemPort |
Emerson BM, Lewis CD and Felsenfeld G (1985) Interaction of specific nuclear factors with the nuclease-hypersensitive region of the chicken adult
-globin gene: nature of the binding domain. Cell, 41, 21–30. | Article | PubMed | ISI | ChemPort |
Fascher KD, Schmitz J and Horz W (1993) Structural and functional requirements for the chromatin transition at the PHO5 promoter in Saccharomyces cerevisiae upon PHO5 activation. J Mol Biol, 231, 658–667. | Article | PubMed | ISI | ChemPort |
Freedman LP (1999) Increasing the complexity of coactivation in nuclear receptor signalling. Cell, 97, 5–8. | Article | PubMed | ISI | ChemPort |
Fryer CJ and Archer TK (1998) Chromatin remodeling by the glucocorticoid receptor requires the BRG1 complex. Nature, 393, 88–91. | Article | PubMed | ISI | ChemPort |
Gelius B, Wade P, Wolffe A, Wrange O and Ostlund Farrants AK (1999) Characterization of a chromatin remodelling activity in Xenopus oocytes. Eur J Biochem, 262, 426–434. | Article | PubMed | ISI | ChemPort |
Georgel PT, Tsukiyama T and Wu C (1997) Role of histone tails in nucleosome remodeling by Drosphila NURF. Embo J, 16, 4717–4726. | Article | PubMed | ISI | ChemPort |
Germond JE, Hirt B, Oudet P, Gross-Bellard M and Chambon P (1975) Folding of the double helix in chromatin like structures from simian virus 40. Proc Natl Acad Sci USA, 72, 1843–1847. | Article | PubMed | ChemPort |
Gerritsen ME, Williams AJ, Neish AS, Moore S, Shi Y and Collins T (1997) CREB-binding protein/p300 are transcriptional coactivators of p65. Proc Natl Acad Sci USA, 94, 2927–2932. | Article | PubMed | ChemPort |
Glass CK, Rose DW and Rosenfeld MG (1997) Nuclear receptor coactivators. Curr Opin Cell Biol, 9, 222–232. | Article | PubMed | ISI | ChemPort |
Godde JS, Nakatani Y and Wolffe AP (1995) The amino-terminal tails of the core histones and the translational position of the TATA box determine TBP/TFIIA association with nucleosomal DNA. Nucleic Acids Res, 23, 4557–4564. | Article | PubMed | ISI | ChemPort |
Grant PA et al. (1997) Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex. Genes Dev, 1, 1640–1650.
Gregory PD and Horz W (1998) Life with nucleosomes: chromatin remodelling in gene regulation. Curr Opin Cell Biol, 10, 339–345. | Article | PubMed | ISI | ChemPort |
Gregory PD, Schmid A, Zavari M, Lui L, Berger SL and Horz W (1998) Absence of Gcn5 HAT activity defines a novel state in the opening of chromatin at the PHO5 promoter in yeast. Mol Cell, 1, 495–505. | Article | PubMed | ISI | ChemPort |
Gu W and Roeder RG (1997) Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell, 90, 595–606. | Article | PubMed | ISI | ChemPort |
Guyon JR, Narlikar GJ, Sif S and Kingston RE (1999) Stable remodeling of tailless nucleosomes by the human SWI–SNF complex. Mol Cell Biol, 19, 2088–2097. | PubMed | ISI | ChemPort |
Hamamori Y, Sartorelli V, Ogryzko V, Puri PL, Wu HY, Wang JY, Nakatani Y and Kedes L (1999) Regulation of histone acetyltransferases p300 and PCAF by the bHLH protein twist and adenoviral oncoprotein E1A. Cell, 96, 405–413. | Article | PubMed | ISI | ChemPort |
Hamiche A, Sandaltzopoulos R, Gdula DA and Wu C (1999) ATP-dependent histone octamer sliding mediated by the chromatin remodeling complex NURF. Cell, 97, 833–842. | Article | PubMed | ISI | ChemPort |
Hammer GD, Krylova I, Zhang Y, Darimont BD, Simpson K, Weigel NL and Ingraham HA (1999) Phosphorylation of the nuclear receptor SF-1 modulates cofactor recruitment integration of hormone signalling in reproduction and stress. Mol Cell, 3, 521–526. | Article | PubMed | ISI | ChemPort |
Hansen JC, Tse C and Wolffe AP (1998) Structure and function of the core histone N-termini: more than meets the eye. Biochemistry, 37, 17637–17641. | Article | PubMed | ISI | ChemPort |
Hanstein B, Eckner R, DiRenzo J, Halachmi S, Liu H, Searoy B, Kurokawa R and Brown M (1996) p300 is a component of an estrogen receptor coactivator complex. Proc Natl Acad Sci USA, 93, 11540–11545. | Article | PubMed | ChemPort |
Heery DM, Kalkhoven E, Hoare S and Parker MG (1997) A signature motif in transcriptional co-activators mediates binding to nuclear receptor. Nature, 387, 733–736. | Article | PubMed | ISI | ChemPort |
Heinzel T et al. (1997) N-CoR, mSIN3, and histone deacetylase in a complex required for repression by nuclear receptors and Mad. Nature, 387, 43–48. | Article | PubMed | ISI | ChemPort |
Henttu PMA, Kalkhoven E and Parker MG (1997) AF-2 activity and recruitment of steroid receptor coactivator 1 to the estrogen receptor depend on a lysine residue conserved in nuclear receptors. Mol Cell Biol, 17, 1832–1839. | PubMed | ISI | ChemPort |
Hoffmann A, Oelgeschlager T and Roeder RG (1997) Considerations of transcriptional control mechanisms: do TFHID-core promoter complexes recapitulate nucleosome-like functions? Proc Natl Acad Sci USA, 94, 8928–8935. | Article | PubMed | ChemPort |
Holstege FCP, Jennings EG, Wyrick JJ, Lee TI, Hengarner CJ, Green MR, Golub TR, Lander ES and Young RA (1998) Dissecting the regulatory circuitry of a eukaryotic genome. Cell, 95, 717–728. | Article | PubMed | ISI | ChemPort |
Horlein AJ et al. (1995) Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature, 377, 397–404. | Article | PubMed | ISI | ChemPort |
Imbalzano AM, Kwon H, Green MR and Kingston RE (1994) Facilitated binding of TATA-binding protein to nucleosomal DNA. Nature, 370, 481–485. | Article | PubMed | ISI | ChemPort |
Imhof A, Yang XJ, Ogryzko VV, Nakatani Y, Wolffe AP and Ge H (1997) Acetylation of general transcription factors by histone acetyltransferases: identification of a major site of acetylation in TFIIE
. Curr Biol, 7, 689–692. | Article | PubMed | ISI | ChemPort |
Ito T, Bulger M, Pazin MJ, Kobayashi R and Kadonaga JT (1997) ACF, an ISWI-containing and ATP utilizing chromatin assembly and remodeling factor. Cell, 90, 145–155. | Article | PubMed | ISI | ChemPort |
Jenster G, Spencer TE, Burcin MM, Tsai SY, Tsai MJ and O'Malley BW (1997) Steroid receptor induction of gene transcription: a two step model. Proc Natl Acad Sci USA, 94, 7879–7884. | Article | PubMed | ChemPort |
Kalkhoven E, Valentine JE, Heery DM and Parker MG (1998) Isoforms of steroid receptor coactivator 1 differ in their ability to potentiate transcription by the oestrogen receptor. EMBO J, 17, 232–243. | Article | PubMed | ChemPort |
Kamei Y et al. (1996) A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell, 85, 403–414. | Article | PubMed | ISI | ChemPort |
Katsani KR, Hajibagheri MA and Verrijzer CP (1999) Co-operative DNA binding by GAGA transcription factor requires the conserved BTB/POZ domain and reorganizes promoter topology. EMBO J, 18, 698–708. | Article | PubMed | ISI | ChemPort |
Korzus E, Torchia J, Rose DW, Xu L, Kurokawa R, McInerney E, Mullen R-M, Glass CK and Rosenfeld MG (1998) Transcription factor-specific requirements for coactivators and their acetyltransferase functions. Science, 279, 703–707. | Article | PubMed | ISI | ChemPort |
Krajewski WA and Becker PB (1998) Reconstitution of hyperacetylated, DNase I-sensitive chromatin characterized by high conformational flexibility of nucleosomal DNA. Proc Natl Acad Sci USA, 95, 1540–1545. | Article | PubMed | ChemPort |
Kraus WL and Kadonaga JT (1998) p300 and estrogen receptor cooperatively activate transcription via differential enhancement of initiation and reinitiation. Genes Dev, 12, 331–342. | Article | PubMed | ISI | ChemPort |
Kuo M-H, Zhou J, Jambeck P, Churchill MEA and Allis CD (1998) Histone acetyltransferase activity of yeast Gcn5p is required for the activation of target genes in vivo. Genes Dev, 12, 627–639. | PubMed | ISI | ChemPort |
Kurokawa R, Kalafus D, Ogliastro M-H, Kioussi C, Xui L, Torchia J, Rosenfeld MG and Glass CK (1998) Differential use of CREB binding protein-coactivator complexes. Science, 279, 700–703. | Article | PubMed | ISI | ChemPort |
Kwok RP, Lundblad JR, Chrivia JC, Richards JP, Bachinger HP, Brennan RG, Roberts SG, Green MR and Goodman RH (1994) Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature, 370, 223–226. | Article | PubMed | ISI | ChemPort |
Kwon H, Imbalzano AN, Khavarl PA, Kingston RE and Green MR (1994) Nucleosome disruption and enhancement of activator binding by a human SWI/SNF complex. Nature, 370, 477–481. | Article | PubMed | ISI | ChemPort |
Landsberger N and Wolffe AP (1995) The role of chromatin and Xenopus heat shock transcription factor (XHSF1) in the regulation of the Xenopus hsp70 promoter in vivo. Mol Cell Biol, 15, 6013–6024. | PubMed | ISI | ChemPort |
Landsberger N and Wolffe AP (1997) Remodeling of regulatory nucleoprotein complexes on the Xenopus hsp70 promoter during meiotic maturation of the Xenopus oocyte. EMBO J, 16, 4631–4373. | Article
Langst G, Bonte EJ, Corona DFV and Becker PB (1999) Nucleosome movement by CHRAC and ISWI without disruption or transdisplacement of the histone octamer. Cell, 96, 843–852. | Article
Lanz RB, McKenna NJ, Onate SA, Albrecht U, Wong J, Tsai SY, Tsai MJ and O'Malley BW (1999) A steroid receptor coactivator, SRA, functions as an RNA and is present in an SRC-1 complex. Cell, 97, 17–27. | Article | PubMed | ISI | ChemPort |
Lee DY, Hayes JJ, Pruss D and Wolffe AP (1993) A positive role for histone acetylation in transcription factor binding to nucleosomal DNA. Cell, 72, 73–84. | Article | PubMed | ISI | ChemPort |
Lee HH and Archer TK (1994) Nucleosome-mediated disruption of transcription factor-chromatin initiation complexes at the mouse mammary tumor virus long terminal repeat in vivo. Mol Cell Biol, 14, 32–41. | PubMed | ISI | ChemPort |
Li Q, Herrler M, Landsberger N, Kaludov N, Ogrzyko VV, Nakatani Y and Wolffe AP (1998) Xenopus NF-Y pre-sets chromatin and potentiates acetylation responsive transcription from the Xenopus hsp70 promoter in vivo. EMBO J, 17, 6300–6315. | Article | PubMed | ISI | ChemPort |
Logie C and Peterson CL (1997) Catalytic activity of the yeast SWI/SNF complex on reconstituted nucleosome arrays. EMBO J, 16, 6772–6782. | Article | PubMed | ISI | ChemPort |
Luger K, Mader AW, Richmond RK, Sargent DF and Richmond TJ (1997) Crystal structure of the nucleosome core particle at 2.8 Å resolution. Nature, 389, 251–260. | Article | PubMed | ISI | ChemPort |
Lundblad JR, Kwok RP, Laurance ME, Harter ML and Goodman RH (1995) Adenoviral E1A-associated protein p300 as a functional homolog of the transcriptional coactivator CBP. Nature, 374, 85–88. | Article | PubMed | ISI | ChemPort |
Lutter LC, Judis L and Paretti RF (1992) Effects of histone acetylation on chromatin topology in vivo. Mol Cell Biol, 12, 5004–5014. | PubMed | ISI | ChemPort |
Machuca I, Esslemont G, Fairclough L and Tata JR (1995) Analysis of structure and expression of the Xenopus thyroid hormone receptor-
gene to explain its autoinduction. Mol Endocrinol, 9, 96–107. | Article | PubMed | ISI | ChemPort |
Martinez-Balbas MA, Bannister AJ, Martin K, Haus-Seuffert P, Meisterernst M and Kouzarides T (1998) The acetyltransferase activity of CBP stimulates transcription. EMBO J, 17, 2886–2893. | Article | PubMed | ISI | ChemPort |
Meisterernst M, Horikoshi M and Roeder RG (1990) Recombinant yeast TFIID, a general transcription factor, mediates activation by the gene specific factor USF in a chromatin assembly assay. Proc Natl Acad Sci USA, 87, 9153–9157. | Article | PubMed | ChemPort |
Meyer M, Sonntag-Buck V, Keaveney M and Stunnenberg HG (1996) Retinoid dependent transcription: the RAR/RXR-TBP-E1A/E1A-LA. Biochem Soc Trans, 62, 97–109. | ChemPort |
Miller ME, Cairns BR, Levinson RS, Yamamoto KR, Engel DA and Smith MM (1996) Adenovirus E1A specifically blocks SWI/SNF-dependent transcriptional activation. Mol Cell Biol, 16, 5737–5743. | PubMed | ISI | ChemPort |
Minucci S, Wong J, Shi Y-B, Wolffe AP and Ozato K (1998) The role of the RXR-RAR heterodimer in directing transcriptional activation and chromatin remodelling of the RAR
2 promoter. Mol Endocrinol, 12, 315–324. | Article | PubMed | ISI | ChemPort |
Mizuguchi G, Tsukiyama T, Wisniewski J and Wu C (1997) Role of nucleosome remodeling factor NURF in transcriptional activation of chromatin. Mol Cell, 1, 141–150. | Article | PubMed | ISI | ChemPort |
Mizzen C et al. (1998) Signaling to chromatin through histone modifications: how clear is the signal? Cold Spring Harbor Symp Quant Biol, 63, 469–481. | PubMed | ISI | ChemPort |
Moran E (1993) DNA tumor virus transforming proteins and the cell cycle. Curr Opin Genet Dev, 3, 63–70. | Article | PubMed | ChemPort |
Muchardt C and Yaniv M (1993) A human homolog of Saccharomyces cerevisiae SNF2/SWI2 and Drosophila brm genes potentiates transcriptional activation by the glucocorticoid receptor. EMBO J, 12, 4279–4290. | PubMed | ISI | ChemPort |
Nagy L, Kao HY, Chakravarti D, Lin RJ, Hassig CA, Ayer DE, Schreiber SL and Evans RM (1997) Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell, 89, 373–380. | Article | PubMed | ISI | ChemPort |
Nakajima T, Uchida C, Anderson SF, Lee C-G, Hurwitz J, Parvin JD and Montminy M (1997a) RNA helicase A mediates association of CBP with RNA polymerase II. Cell, 90, 1107–1112. | Article | PubMed | ISI | ChemPort |
Nakajima T, Uchida C, Anderson SF, Parvin JD and Montminy M (1997b) Analysis of a cAMP-responsive activator reveals a two component mechanism for transcriptional induction via signal dependent factors. Genes Dev, 11, 738–743. | Article | PubMed | ISI | ChemPort |
Nightingale KP, Wellinger RE, Sogo JM and Becker PB (1998) Histone acetylation facilitates RNA polymerase II transcription of the Drosophila hsp26 gene in chromatin. EMBO J, 17, 2865–2875. | Article | PubMed | ChemPort |
Norton VG, Imai BS, Yau P and Bradbury EM (1989) Histone acetylation reduces nucleosome core particle linking number change. Cell, 57, 449–457. | Article | PubMed | ISI | ChemPort |
Ogryzko VV, Schiltz RL, Russanova V, Howard BH and Nakatani Y (1996) The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell, 87, 953–959. | Article | PubMed | ISI | ChemPort |
Ohba R, Steger DJ, Brownell JE, Mizzen CA, Cook RG, Cote J, Workman JL and Allis CD (1999) A novel H2A/H4 nucleosomal histone acetyltransferase in Tetrahymena thermophila. Mol Cell Biol, 19, 2061–2068. | PubMed | ISI | ChemPort |
Onate SA, Tsai SY, Tsai M-J and O'Malley BW (1995) Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science, 270, 1354–1357. | Article | PubMed | ISI | ChemPort |
Ornaghi P, Ballario P, Lena AM, Gouzalez A and Filetici P (1999) The bromodomain of Gcn5p interacts in vitro with specific residues in the N-terminus of histone H4. J Mol Biol, 287, 1–7. | Article | PubMed | ISI | ChemPort |
Owen-Hughes T, Utley RT, Coté J, Peterson CL and Workman JL (1996) Persistent site specific remodeling of a nucleosome array by transient action of the SWI/SNF complex. Science, 273, 515–516.
Parker MG (1998) Transcriptional activation by estrogen receptors. Biochem Soc Symp, 63, 45–50. | PubMed | ChemPort |
Pazin MJ and Kadonaga JT (1997) Whats up and down with histone deacetylation and transcription. Cell, 89, 325–328. | Article | PubMed | ISI | ChemPort |
Pederson DS and Morse RH (1990) Effect of transcription of yeast chromatin on DNA topology in vivo. EMBO J, 9, 1873–1881. | PubMed | ISI | ChemPort |
Perissi V, Dasen JS, Kurokawa R, Wang Z, Korzus E, Rose SW, Glass CK and Rosenfeld MG (1999) Factor-specific modulation of CREB-binding protein acetyltransferase activity. Proc Natl Acad Sci USA, 96, 3652–3657. | Article | PubMed | ChemPort |
Pollard KJ and Peterson CL (1997) Role for ADA/GCN5 products in antagonizing chromatin mediated transcriptional repression. Mol Cell Biol, 17, 6212–6222. | PubMed | ISI | ChemPort |
Pollard KJ and Peterson CL (1998) Chromatin remodeling: a marriage between two families? BioEssays, 20, 771–780. | Article | PubMed | ISI | ChemPort |
Puri PL, Sartorelli V, Yang X-J, Hamamori Y, Ogryzko VV, Howard BH, Graessman A, Nakatani Y and Levrero M (1997) Differential roles of p300 and PCAF acetyltransferases in muscle differentiation. Mol Cell, 1, 35–45. | Article | PubMed | ISI | ChemPort |
Ramirez S, Ait-Si-Ali S, Robin P, Trouche D and Herel-Bellan A (1997) The CREB-binding protein (CBP) cooperates with the serum response factor for transactivation of the c-fos serum response element. J Biol Chem, 272, 31016–31021. | Article | PubMed | ISI | ChemPort |
Randall SK and Kelly TJ (1992) The fate of parental nucleosomes during SV40 DNA replication. J Biol Chem, 267, 14259–14265. | PubMed | ISI | ChemPort |
Ranjan M, Wong J and Shi YB (1994) Transcriptional repression of Xenopus TR
gene is mediated by a thyroid hormone response element located near the start site. J Biol Chem, 269, 24699–24705. | PubMed | ISI | ChemPort |
Reid JL, Bannister AJ, Zegerman P, Martinez-Balbas MA and Kouzarides T (1998) E1A directly binds and regulates the PCAF acetyltransferase. EMBO J, 17, 4469–4477. | Article | PubMed | ISI | ChemPort |
Schnitzler G, Sif S and Kingston RE (1998) Human SWI/SNF interconverts a nucleosome between its base state and a stable remodeled state. Cell, 94, 17–27. | Article | PubMed | ISI | ChemPort |
Shikama N, Lyon J and La Thangue NB (1997) The p300/CBP family: integrating signals with transcription factors and chromatin. Trends Cell Biol, 7, 230–236. | Article | PubMed | ISI | ChemPort |
Simpson RT, Thoma F and Brubaker JM (1985) Chromatin reconstituted from tandemly repeated cloned DNA fragments and core histones: a model system for study of higher order structure. Cell, 42, 799–808. | Article | PubMed | ISI | ChemPort |
Smith CL, Onate SA, Tsai M-J and O'Malley BW (1996) CREB-binding protein acts synergistically with steroid receptor coactivator-1 to enhance steroid receptor-dependent transcription. Proc Natl Acad Sci USA, 93, 8884–8888. | Article | PubMed | ChemPort |
Sogo JM, Stahl H, Koller T and Knippers R (1986) Structure of the replicating SV40 minichromosomes: The replication fork, core histone segregation and terminal structures. J Mol Biol, 189, 189–204. | Article | PubMed | ISI | ChemPort |
Spencer TE et al. (1997) Steroid receptor coactivator-1 is a histone acetyltransferase. Nature, 389, 194–198. | Article | PubMed | ISI | ChemPort |
Strober BE, Dunaief JL, Guha S and Goff SP (1996) Functional interactions between the hBRM/hBRG1 transcriptional activators and the pRB family of proteins. Mol Cell Biol, 16, 1576–1583. | PubMed | ISI | ChemPort |
Studitsky VM, Kassavetis GA, Geiduschek EP and Felsenfeld G (1997) Mechanism of transcription through the nucleosome by eukaryotic RNA polymerase. Science, 278, 1960–1963. | Article | PubMed | ISI | ChemPort |
Stunnenberg HG, Garcia-Jiminez C and Betz JL (1999) Leukemia: the sophisticated subversion of hematopoiesis by nuclear receptor oncoproteins. Biochim Biophys Acta, 1423, F15–F33. | Article | PubMed | ISI | ChemPort |
Svaren J and Horz W (1997) Transcription factors vs nucleosomes: regulation of the PHO5 promoter in yeast. Trends Biochem Sci, 22, 93–97. | Article | PubMed | ISI | ChemPort |
Tan S, Aso T, Conaway RC and Conaway JW (1994) Roles for both the RAP30 and RAP74 subunits of transcription factor IIF in transcription initiation and elongation by RNA polymerase II. J Biol Chem, 269, 25684–25691. | PubMed | ISI | ChemPort |
Tong JK, Hassig CA, Schnitzler GR, Kingston RE and Schreiber SL (1998) Chromatin deacetylation by an ATP-dependent remodelling complex. Nature, 395, 917–921. | Article | PubMed | ISI | ChemPort |
Torchia J, Glass C and Rosenfeld MG (1998) Coactivators and corepressors in the integration of transcriptional responses. Curr Opin Cell Biol, 10, 373–383. | Article | PubMed | ISI | ChemPort |
Tremblay A, Tremblay GB, Labrie F and Giguere V (1999) Ligand-independent recruitment of SRC-1 to estrogen receptor
through phosphorylation of action function AF-1. Mol Cell, 3, 513–519. | Article | PubMed | ISI | ChemPort |
Truss M, Bartsch J, Schelbert A, Haché RJG and Beato M (1995) Hormone induces binding of receptors and transcription factors to a rearranged nucleosome on the MMTV promoter in vivo. EMBO J, 14, 1737–1751. | PubMed | ISI | ChemPort |
Tse C, Sera T, Wolffe AP and Hansen JC (1998) Disruption of higher order folding by core histone acetylation dramatically enhances transcription of nucleosomal arrays by RNA polymerase III. Mol Cell Biol, 18, 4629–4638. | PubMed | ISI | ChemPort |
Tsukiyama T, Becker PB and Wu C (1994) ATP-dependent nucleosome disruption at a heat-shock promoter mediated by binding of GAGA transcription factor. Nature, 367, 525–532. | Article | PubMed | ISI | ChemPort |
Ura K, Hayes JJ and Wolffe AP (1995) A positive role for nucleosome mobility in the transcriptional activity of chromatin templates: resitriction by linker histones. EMBO J, 14, 3752–3765. | PubMed | ISI | ChemPort |
Ura K, Kurumizaka H, Dimitrov S, Almouzni G and Wolffe AP (1997) Histone acetylation: influence on transcription by RNA polymerase, nucleosome mobility and positioning, and linker histone dependent transcriptional repression. EMBO J, 16, 2096–2107. | Article | PubMed | ISI | ChemPort |
van Holde KE (1988) Chromatin. Springer-Verlag, New York, NY.
van Holde KE (1993) The omnipotent nucleosome. Nature, 362, 111–112. | Article | PubMed | ChemPort |
Van Lint C, Emiliani S and Verdin E (1996a) The expression of a small fraction of cellular genes is changed in response to histone hyperacetylation. Gene Expr, 5, 245–253. | PubMed | ChemPort |
Van Lint C, Emiliani S, Ott M and Verdin E (1996b) Transcriptional activation and chromatin remodeling of the HIV-1 promoter in response to histone acetylation. EMBO J, 15, 1112–1120. | PubMed | ISI | ChemPort |
Varga-Weisz PD, Wilm M, Boute E, Dumas K, Mann M and Becker PB (1997) chromatin remodeling factor CHRAC contains the ATPses ISWI and topoisomerase II. Nature, 388, 598–602. | Article | PubMed | ISI | ChemPort |
Verrijzer CP and Tjian R (1996) TAFs mediate transcriptional activation and promoter selectivity. Trends Biochem Sci, 21, 338–342. | Article | PubMed | ISI | ChemPort |
Vettesse-Dadey M, Grant PA, Hebbes TR, Crane-Robinson C, Allis CD and Workman JL (1996) Acetylation of histone H4 plays a primary role in enhancing transcription factor binding to nucleosomal DNA in vitro. EMBO J, 15, 2508–2518. | PubMed |
Wade PA, Jones PL, Vermaak D and Wolffe AP (1998a) A multiple subunit histone deacetylase from Xenopus laevis contains a Snf2 superfamily ATPase. Curr Biol, 8, 843–846. | Article | PubMed | ISI | ChemPort |
Wade PA et al. (1998b) Histone deacetylase directs the dominant silencing of transcription in chromatin: association with MeCP2 and the Mi-2 chromodomain SWI/SNF ATPase. Cold Spring Harbor Symp Quant Biol, 63, 435–446. | PubMed | ISI | ChemPort |
Wahlstrom G, Vennstrom B and Bondesson-Bolin M (1999) The adenovirus E1A protein is a potent coactivator for thyroid hormone receptors. Mol Endocrinol, 13, 1119–1129. | Article | PubMed | ISI | ChemPort |
Wang L, Liu L and Berger SL (1998) Critical residues for histone acetylation by Gcn5, functioning in Ada and SAGA complexes, are also required for transcriptional function in vivo. Genes Dev, 12, 640–653. | PubMed | ISI | ChemPort |
Wechser MA, Kladde MP, Alfieri JA and Peterson CL (1997) Effects of Sin versions of histone H4 on yeast chromatin structure and function. EMBO J, 16, 2086–2095. | Article | PubMed | ISI | ChemPort |
Weiss RE, Xu J, Ning G, Pohlenz J, O'Malley BW and Refetoff S (1999) Mice deficient in the steroid receptor co-activator 1 (SRC-1) are resistant to thyroid hormone. EMBO J, 18, 1900–1904. | Article | PubMed | ISI | ChemPort |
White R, Sjoberg M, Kalkhoven E and Parker MG (1997) Ligand-independent activation of the oestrogen receptor by mutation of a conserved tyrosine. EMBO J, 16, 1427–1435. | Article | PubMed | ISI | ChemPort |
Wolffe AP (1997) Sinful repression. Nature, 387, 6–17. | Article | PubMed
Wolffe AP and Pruss D (1996) Targeting chromatin disruption: transcription regulators that acetylate histones. Cell, 84, 817–819. | Article | PubMed | ISI | ChemPort |
Wong J, Shi Y-B and Wolffe AP (1995) A role for nucleosome assembly in both silencing and activation of the Xenopus TR
A gene by the thyroid hormone receptor. Genes Dev, 9, 2696–2711. | Article | PubMed | ISI | ChemPort |
Wong J, Shi Y-B and Wolffe AP (1997a) Determinants of chromatin disruption and transcriptional regulation instigated by the thyroid hormone receptor: hormone regulated chromatin disruption is not sufficient for transcriptional activation. EMBO J, 16, 3158–3171. | Article | PubMed | ISI | ChemPort |
Wong J, Li Q, Levi B-Z, Shi Y-B and Wolffe AP (1997b) Structural and functional features of a specific nucleosome containing a recognition element for the thyroid hormone receptor. EMBO J, 16, 7130–7145. | Article | PubMed | ChemPort |
Wong J, Patterton D, Imhof A, Shi Y-B and Wolffe AP (1998) Distinct requirements for chromatin assembly in transcriptional repression by thyroid hormone receptor and histone deacetylase. EMBO J, 17, 520–534. | Article | PubMed | ChemPort |
Worcel A, Strogatz S and Riley D (1981) Structure of chromatin and the linking number of DNA. Proc Natl Acad Sci USA, 78, 1461–1465. | Article | PubMed | ChemPort |
Workman JL and Roeder RG (1987) Binding of transcription factor TFIID to the major late promoter during in vitro nucleosome assembly potentiates subsequent initiation by RNA polymerase II. Cell, 51, 613–622. | Article | PubMed | ISI | ChemPort |
Xu L, Glass CK and Rosenfeld MG (1999) Coactivator and corepressor complex in nuclear receptor function. Curr Opin Genet Dev, 9, 140–147. | Article | PubMed | ISI | ChemPort |
Yang X-J, Ogryzko VV, Nishikawa J-I, Howard B and Nakatani Y (1996) A p300/CBP-associated factor that competes with the adenoviral E1A oncoprotein. Nature, 382, 319–324. | Article | PubMed | ISI | ChemPort |
Yao J, Lowary PT and Widom J (1991) Linker DNA bending by the core histones of chromatin. Biochemistry, 30, 8408–8414. | PubMed | ISI | ChemPort |
Yao TP, Ku G, Zhou N, Scully R and Livingston DM (1996) The nuclear hormone receptor coactivator SRC-1 is a specific target of p300. Proc Natl Acad Sci USA, 93, 10626–10631. | Article | PubMed | ChemPort |
Yokomori K, Verrijzer CP and Tjian R (1998) An interplay between TATA box-binding protein and transcription factors IIE and IIA modulates DNA binding and transcription. Proc Natl Acad Sci USA, 95, 6722–6727. | Article | PubMed | ChemPort |
Yoshinaga SK, Peterson SL, Herskowitz I and Yamamoto KR (1992) Roles of SWI1, SWI2 and SWI3 proteins for transcriptional enhancement by steroid receptors. Science, 258, 1598–1604. | Article | PubMed | ISI | ChemPort |
Yuan W, Condorelli G, Caruso M, Felsani A and Giordano A (1996) Human p300 protein is a coactivator for the transcription factor MyoD. J Biol Chem, 271, 9009–9013. | Article | PubMed | ISI | ChemPort |
Zaret KS and Yamamoto KR (1984) Reversible and persistent changes in chromatin structure accompany activation of a glucocorticoid dependent enhancer element. Cell, 38, 29–38. | Article | PubMed | ISI | ChemPort |
Zhang W, Bone JR, Edmondson DG, Turner BM and Roth SY (1998) Essential and redundant functions of histone acetylation revealed by mutation of target lysines and loss of the Gcn5p acetyltransferase. EMBO J, 17, 3155–3167. | Article | PubMed | ISI | ChemPort |
Zorn AM and Krieg PA (1997) The KH domain protein encoded by quaking functions as a dimer and is essential for notochord development in Xenopus embryos. Genes Dev, 11, 2176–2190. | PubMed | ISI | ChemPort |



