Article

• The EMBO Journal (1998) 17, 5477 - 5483
• doi:10.1093/emboj/17.18.5477

McrB_s, a modulator peptide for McrBC activity

Daniel Panne¹, Elisabeth A. Raleigh² and Thomas A. Bickle¹

1. Department of Microbiology, Biozentrum, Basel University, Klingelbergstrasse 70, CH-4056 Basel, Switzerland
2. New England Biolabs, 32 Tozer Road, Beverly, MA 01915, USA

Correspondence to:

Thomas A. Bickle, E-mail: bickle@ubaclu.unibas.ch

Received 17 June 1998; Accepted 21 July 1998; Revised 20 July 1998

• Keywords:

  • GTP,
  • GTPase,
  • McrBC restriction,
  • 5-methylcytosine

Introduction

Escherichia coli K-12 contains at least four restriction systems to monitor the origin of invading DNA and determine its fate (Bickle and Krüger, 1993). In addition to the type I EcoKI system, which restricts unmodified DNA, there are three systems, McrA, Mrr and McrBC, which specifically recognize modified DNA (Noyer-Weidner et al., 1986; Raleigh and Wilson, 1986; Heitman and Model, 1987; Waite-Rees et al., 1991). McrBC is the best characterized of the modification-dependent enzymes. It stands out from the rest of the family of restriction–modification endonucleases in several respects. In contrast to classical restriction–modification systems where methylation of the target sequence provides a means of protection, methylated DNA is an absolute requirement for DNA cleavage to occur. McrBC specifically recognizes DNA containing 5-hydroxymethylcytosine, 5-methylcytosine or 4-methylcytosine preceded by a purine residue (RmC) (Raleigh and Wilson, 1986). Restriction requires at least two RmC sites that are separated optimally by 40–80 bp but can be spaced as far as 2 kb apart (Sutherland et al., 1992; Stewart and Raleigh, 1998).

The mcrBC locus contains two genes, mcrB and mcrC (Figure 1A). Three major polypeptides are encoded by this operon. The mcrB gene encodes a large, full-length gene product termed McrB_L of 53 kDa and a small McrB_s protein of 34 kDa (Ross et al., 1987, 1989a; Dila et al., 1990; Krüger et al., 1992). McrB_s lacks the N-terminal 161 amino acids encoded by the mcrB gene but retains the C-terminal 287 residues (Ross et al., 1989a). This truncation is produced by internal in-frame translational initiation rather than post-translational processing of the full-length product (Ross et al., 1989a; Krüger et al., 1992). McrB_s alone or in the presence of McrC cannot support restriction in vivo (Beary et al., 1997; D.Dila and E.A.Raleigh, unpublished results). The mcrC gene directs the synthesis of a 39 kDa McrC gene product (Ross et al., 1989b).

Figure 1.

(A) Organization of the McrBC operon. Three proteins, McrB_L, McrB_s and McrC, are encoded by the mcrBC genes. McrB_s lacks the first 161 amino acids of the full-length gene products which comprise the DNA-binding domain. McrB_L, McrC and GTP are required for DNA cleavage. McrB_s modulates this activity by binding to McrC. Two R^mC recognition sites, which can be spaced between 40 and 2000 bp, are required for DNA cleavage. (B) Modular organization of the mcrB gene. A DNA-binding domain has been assigned to the N-terminus of McrB_L. This domain is lacking in McrB_s. The GTP–binding domains are shown as proposed by Dila et al. (1990).

View full figure (51 KB)

DNA cleavage in vitro requires McrB_L, McrC, GTP and Mg²⁺ (Sutherland et al., 1992). McrB_s is not required for this reaction. DNA binding abilities have been attributed to McrB_L (Krüger et al., 1995; F.J.Stewart and E.A. Raleigh, in preparation), and it was shown that the DNA-binding domain resides in a fragment comprising the N-terminal 190 amino acids (Gast et al., 1997). Dila et al. (1990) identified a GTP-binding motif in the central part of the mcrB gene (Figure 1B). This assignment was confirmed by the demonstration that McrB_L binds and hydrolyzes GTP in an McrC-dependent fashion (Pieper et al., 1997). Thus, McrBC is the only known nuclease which requires GTP for activity.

In this communication, we have shown in vitro that the DNA cleavage rate depends on the relative and the absolute amounts of McrB_L and McrC. A maximal rate was obtained at 3–5 McrB_L per molecule of McrC, showing that DNA cleavage occurs by a multisubunit complex. Excess of either protein decreased the DNA cleavage rate. Because McrB_s may retain domains for protein–protein interaction which are also found in the full-length protein, it has been proposed that McrB_s might serve to modulate McrBC restriction activity (Ross et al., 1989a). Strikingly, either over- or underexpression of McrB_s abolished or reduced McrBC restriction in vivo (Beary et al., 1997). The first case can be understood by dominant-negative inhibition in which the truncated variant McrB_s interferes with the functional assembly of the oligomeric wild-type protein. Similar cases have been reported in the literature (Roman et al., 1991; Treacy et al., 1992; de la Cruz et al., 1993). However, reduction of McrBC restriction by reduced levels of McrB_s was more difficult to explain, and the authors suggested that McrB_s may be required for stabilization of the McrBC restriction complex (Beary et al., 1997).

The data presented here define the role of McrB_s in restriction by McrBC. We found that McrB_s enhanced or decreased McrBC activity depending on the relative amounts of McrB_L and McrC. At optimal molar ratios of 3–5 McrB_L per molecule of McrC, the addition of McrB_s led to an inhibition of the DNA cleavage reaction. Inhibition was due to binding of McrC, thus decreasing the amount of cleavage-competent McrB_L–McrC complexes. At equimolar ratios of McrB_L and McrC, conditions which gave suboptimal cleavage activity, addition of McrB_s stimulated the DNA cleavage reaction. Stimulation occurred by sequestering excess McrC, leading to more favorable ratios between McrB_L and McrC. Pre-incubation experiments showed that GTP was required for, or stimulated the interaction of, McrB_s with McrC. This suggests that the C-terminal 287 residues of McrB_L and McrB_s contain a domain which interacts with McrC. Inhibition and stimulation of the reaction can be explained by interaction of McrB_s with McrC, which modulates the formation of cleavage-competent McrB_L–McrC complexes.

Overexpression and purification of McrB proteins

Three major gene products are encoded by the mcrBC locus. Two polypeptides, McrB_L (53 kDa) and McrB_s (34 kDa), are produced from the mcrB gene, and one, McrC (39 kDa), from the mcrC gene. The McrB_L and McrB_s proteins were purified using the IMPACT protein purification system [New England Biolabs Inc., Beverly, MA (NEB)]. Briefly, the tripartite fusion protein contains the McrB_L gene fused at the N-terminus of a mutant intein, which is capable of N-terminal junction cleavage in the presence of thiol reagents. A chitin-binding domain is fused to the C-terminus of the intein, which allows affinity purification of the fusion protein on a chitin resin. The intein fusion proteins were constructed so that an additional glycine residue remains at the C-terminus of McrB_L after cleavage from the intein tag. We found that this extra residue increased the cleavage efficiency from the affinity tag as compared with a direct fusion construct.

The McrB_L start site was that used previously (Ross et al., 1989b; Sutherland et al., 1992). After expression at 21°C overnight, 80% of the fusion protein was found to be in the soluble fraction. SDS–PAGE analysis of the fractions from the chitin column showed the full-length McrB_L at 53 kDa, McrB_s at 34 kDa and a protein migrating with an apparent M_r of 60 kDa (Figure 2A). The 60 and 34 kDa proteins were analyzed by N-terminal peptide sequencing. The 60 kDa protein was found to be the molecular chaperon GroEL. The 34 kDa McrB_s protein was confirmed to start 161 amino acids downstream from the N-terminus of McrB_L, at the same position as shown previously (Zheng et al., 1992).

Figure 2.

(A) Purification of McrB_L using the IMPACT I system. From each fraction, a sample was taken and analyzed by SDS–PAGE followed by staining with Coomassie Blue. Lanes are: M, broad range protein marker (NEB); L, load of clarified crude extract from induced cells; FT, flow through; W, wash; E1–E5, fractions eluted from the column after overnight incubation; and R, proteins remaining bound to the column. (B) Purification of McrB_L using the gel filtration column Sephacryl S-200. All samples are analyzed by SDS–PAGE and stained with Coomassie Blue. Lanes are: M, broad range protein marker (NEB); L, the pooled and concentrated load on the sizing column; peak 1, samples taken from the first peak; and peak 2, samples taken from the second peak from the column.

View full figure (39 KB)

To remove GroEL and McrB_s from McrB_L, the eluate from the chitin column was purified further on a gel filtration column. The result of this separation is shown in Figure 2B. The protein preparation obtained was nearly pure as judged from the Coomassie Blue-stained gel, but contained trace amounts of McrB_s. We usually obtained 5–6 mg protein/l of culture using this two-column purification method. To verify that the IMPACT purification method did not alter the properties of the enzyme, the DNA cleavage efficiency of our preparation was compared with an McrB_L preparation purified using conventional methods (gift from F.J.Stewart, NEB) and found to be identical.

To analyze the role of the McrB_s protein, a fragment from the mcrB gene coding for the C-terminal amino acids 162–459 was cloned into the IMPACT vector. A soluble protein of the expected size was obtained, expressed and purified as described for McrB_L. As with the full-length protein construct, co-purification of GroEL was observed. After separation on the gel filtration column, the McrB_s preparation was apparently homogeneous as judged from a Coomassie-stained gel. Usually 7–8 mg protein/l of culture was obtained. The McrC protein used in all experiments was a gift from F.J.Stewart (NEB) purified essentially as described by Sutherland et al. (1992).

DNA cleavage efficiency is dependent on the molar ratios of the mcrBC gene products

McrB_L and McrC are the only gene products from the mcrBC genes required for in vitro DNA cleavage activity (Sutherland et al., 1992). Earlier work suggested that a molar ratio of 5 McrB_L molecules to one McrC molecule was optimal for DNA cleavage in vitro (E.A.Raleigh, F.J.Stewart and E.Sutherland, unpublished data). However, maximal stimulation of the GTPase activity of McrB_L by McrC was obtained with equimolar ratios of the two proteins (Pieper et al., 1997). To examine this issue further, we measured the efficiency of the DNA cleavage reaction at different molar ratios of the two proteins. Figure 3A shows the effect of McrB_L concentration on the course of the cleavage reaction. DNA cleavage was slow if McrC (100 nM) was in a molar excess over McrB_L (curves from 19–79 nM McrB_L). At a molar ratio of 3 McrB_L molecules to one McrC molecule, the reaction rate reached a maximum. At higher McrB_L concentrations (635 and 1270 nM), the reaction rate decreased, showing the inhibitory effect of excess McrB_L. Similar experiments were performed using a higher (200 nM) and a lower (60 nM) McrC concentration. The initial reaction velocity data from these experiments are summarized in Figure 3B. In all cases, the reaction was less efficient if McrC was in excess over McrB_L. Also, at high McrB_L concentrations, the efficiency decreased. Inhibition by McrB_L was less strong if more McrC was included in the reaction. At the highest McrC concentration used (200 nM), the maximal cleavage rate obtained was lower as compared with reactions with 100 and 60 nM McrC. Presumably this was due to inhibition by McrB_L as discussed below. In summary, a ratio of 3–5 McrB_L per molecule of McrC is required for optimal DNA cleavage efficiency. An excess of either protein inhibited the cleavage reaction.

Figure 3.

(A) DNA cleavage at different McrB_L concentrations. Samples containing () 1270 nM, () 635 nM, () 317 nM, () 158 nM, () 79 nM, () 39 nM or () 19 nM McrB_L, 100 nM McrC and 4 nM pMC63/M.FnuDII/PvuII were pre-incubated at 37°C for 15 s and the reaction started by addition of 1 mM GTP. For each concentration, 10 l aliquots were removed at 0, 1, 1.5, 2, 2.5, 3, 3.5 and 5 min time points, and cleavage products were analyzed on a 1% (w/v) agarose gel. The percentage of substrate DNA converted to product is plotted as a function of time. (B) The initial velocities of the DNA cleavage reaction (V₀) were determined at () 200 nM, () 100 nM and () 60 nM McrC and using the same McrB_L concentrations as in (A). Initial velocities were measured and plotted as a function of McrB_L concentration.

View full figure (61 KB)

Inhibition of the McrBC-mediated DNA cleavage reaction by McrB_s

It has been suggested that McrB_s might play a regulatory role in the McrBC-mediated restriction of DNA (Ross et al., 1989a; Beary et al., 1997; D.Dila and E.A.Raleigh, unpublished data). McrB_s alone or in the presence of McrC was not able to cleave DNA, confirming that full-length McrB_L is required for this reaction (data not shown). To understand further the role of McrB_s, the DNA cleavage activity of McrBC (using 125 nM McrB_L and 60 nM McrC) was measured in the presence of increasing amounts of McrB_s. Figure 4 shows the effect of McrB_s on the course of the DNA cleavage reaction. The reaction was inhibited in a concentration-dependent manner and was almost completely abolished at 1 M McrB_S.

Figure 4.

Inhibition of the McrBC-mediated DNA cleavage by McrB_s. McrB_L (125 nM) was pre-mixed with () 31.2 nM, () 62.5 nM, () 125 nM, () 250 nM, () 500 nM or () 1 M of McrB_s in the presence of 4 nM pMC63/M.FnuDII/PvuII and 1 mM GTP. The reaction was started by including 60 nM McrC in the reaction. For each concentration of McrB_s, 10 l aliquots were removed at 0, 10, 20, 30, 40, 50, 60, 70 and 100 min, and cleavage products were analyzed on a 1% (w/v) agarose gel. The percentage of DNA substrate converted to product is plotted as a function of time.

View full figure (60 KB)

There are several possible ways in which McrB_s could inhibit the McrBC cleavage reaction. McrB_s could interfere by competing with McrB_L for DNA-binding sites, by sequestering McrC or by forming non-functional complexes with McrB_L (Ross et al., 1989a; Beary et al., 1997). We have addressed these possibilities by pre-incubating McrB_s with McrB_L or McrC and measuring the effect on the DNA cleavage reaction. As shown in Figure 5, there was a stronger inhibitory effect when McrB_s was pre-incubated with McrC than with McrB_L. These data are consistent with the model whereby McrB_s inhibits the reaction by binding to and sequestering McrC. In addition, this inhibitory effect was only observed when McrB_s and McrC were pre-incubated in the presence of GTP (Figure 6). This experiment demonstrates that the interaction between the two proteins is GTP dependent. To verify that this result was not due to instability of McrB_s in the absence of GTP, this experiment was repeated using different pre-incubation times. However, a similar extent of inhibition was obtained after short (5 min) and long (30 min) pre-incubation times, excluding instability of McrB_s in the absence of GTP (data not shown).

Figure 5.

(A) McrB_s inhibits the reaction by sequestering McrC. Increasing amounts of McrB_s were pre-incubated for 15 min at 21°C with 60 nM McrC in the presence of 4 nM pMC63/M.FnuDII/PvuII and 1 mM GTP. The reaction was started by adding 125 nM McrB. The concentrations of McrB_s from left to right were 2, 1, 0.5, 0.25, 0.125, 0.0625 and 0.0312 M. (B) The same amounts of McrB_s as used in (A) were pre-incubated for 15 min at 21°C with 125 nM McrB_L, 1 mM GTP and 4 nM pMC63/M.FnuDII/PvuII. The reaction was started by adding 60 nM McrC. After 15 min at 37°C, the reaction products were analyzed on a 1% (w/v) agarose gel. The positive control (+) was performed by pre-incubating 60 nM McrC under the same conditions as above and starting the reaction with 125 nM McrB_L. The negative control (-) contains 125 nM McrB_L but no McrC. The DNA size standard is a 1 kb plus ladder with sizes of 4, 3, 2, 1.6, 1, 0.85, 0.65 and 0.5 kb (Gibco-BRL).

View full figure (48 KB)

Figure 6.

GTP dependence of the McrB_s interaction with McrC. Concentrations of 1250, 125, 62.5 and 31.25 nM McrB_s were pre-incubated for 15 min at 21°C with 60 nM McrC in the absence (lanes 1–4) or presence (lanes 5–8) of 1 mM GTP and 4 nM pMC63/M.FnuDII/PvuII. The DNA cleavage reaction was started by addition of 125 nM McrB_L and in the left side of the figure with 1 mM GTP. After incubation for 15 min at 37°C, the reactions were stopped by adding stop buffer and then analyzed on a 1% (w/v) agarose gel. The positive control (lane 9) was performed by pre-incubating 60 nM McrC under the same conditions as above and starting the reaction with 125 nM McrB_L. The negative control (lane 10) contains only 125 nM McrB_L. The DNA size standard is a 1 kb plus ladder (Gibco-BRL).

View full figure (58 KB)

Activation of DNA cleavage by McrB_s

Inhibition of the production of McrB_sin vivo leads to a decrease in McrBC activity (Beary et al., 1997). The authors suggested that McrB_s may sequester excess McrC, thus modulating the level of McrBC activity, and that the decrease of restriction may be due to unfavorable molar ratios of McrB_L to McrC in the cell. Our results (Figure 3B) demonstrated that if either McrB_L or McrC are in excess, the rate of the cleavage reaction is suboptimal. Under such conditions, the addition of McrB_s might increase the efficiency of the reaction by sequestering a fraction of McrC. This would result in a more favorable ratio of McrB_L and McrC for the formation of cleavage-competent complexes. To test this hypothesis, 158 nM McrB_L was mixed with 200 nM McrC, a ratio that yielded suboptimal cleavage efficiencies in previous experiments (Figure 3B). The reaction velocity was measured in the absence and presence of 125 nM McrB_s. As shown in Figure 7, it was found under these conditions that McrB_s increased the rate of DNA cleavage by 50%.

Figure 7.

Activation of the McrBC reaction by McrB_s. The experiment was performed as described in the legend of Figure 3A, except that the protein concentrations were 158 nM McrB_L and 200 nM McrC. The DNA cleavage rate was measured in the absence of McrB_s () and after including 125 nM McrB_s (). The order of addition of the proteins was McrB_L, McrB_s and then McrC. The reaction was started by addition of 1 mM GTP.

View full figure (43 KB)

Recent investigations in a number of laboratories have begun to elucidate the biochemical mechanism of mcrBC restriction. McrB_L, McrC, GTP and Mg²⁺ are required for in vitro DNA cleavage activity (Sutherland et al., 1992). The data presented here demonstrate that the DNA cleavage rate depends on both the relative and absolute amounts of McrB_L and McrC. The optimal ratio of 3–5 McrB_L per McrC suggests that DNA cleavage occurs by a multisubunit complex. The assembly of this complex is modulated by McrB_s. If either of the three proteins was in excess, the reaction was inhibited. Inhibition by excess McrB_L could be due to DNA substrate sequesteration since McrB_L alone can bind to the methylated target sites (Krüger et al., 1995; Gast et al., 1997; F.J.Stewart and E.A.Raleigh, in preparation).

Increased amounts of McrC, above the optimal ratio, inhibited DNA cleavage. Inhibition of restriction was also observed in vivo upon overexpression of McrC (Beary et al., 1997). This occurs presumably by formation of complexes with McrB_L which lack the correct stoichiometry and are therefore non-functional for DNA cleavage. Previous studies had shown that GTP hydrolysis by McrB_L is stimulated by McrC (Pieper et al., 1997). In these experiments, a 1:1 ratio of McrB_L and McrC yielded maximal levels of GTP hydrolysis. It is possible that the activities of different functional complexes are monitored by the DNA cleavage and the GTPase assays. It is also possible that GTP binding and/or hydrolysis mediates McrB–McrC interaction and thus is maximal at a 1:1 ratio.

In agreement with previous results in vivo, McrB_s can both inhibit or activate the reaction (Figures 4 and 7). A probable interpretation of these results is that when the ratio of McrB_L to McrC is optimal, McrB_s has an inhibitory effect on restriction due to sequestration of the McrC subunit (Figure 5). This would decrease the concentration of cleavage-competent McrB_L–McrC complexes. Alternatively, when the McrC subunit is in excess, McrB_s has an activating effect presumably by sequestering excess McrC, that otherwise would inhibit the formation of cleavage-competent complexes. Thus McrB_s can be an activator or inhibitor depending on the molar ratios of McrB_L and McrC.

The optimal ratio of 3–5 McrB_L for each McrC molecule in the reaction suggests that inhibition by McrB_s might occur through subunit poisoning of an oligomeric complex. Several models could explain how McrB_s interferes with the assembly of that complex. Inhibition by McrB_s could occur by (i) sequestering McrB_L in non-functional complexes, (ii) sequestering the McrC subunit or (iii) binding to and blocking the DNA-binding sites. Since the cleavage-competent complex requires 3–5 McrB_L molecules, it is conceivable that inhibition by McrB_s occurs by poisoning this complex as proposed in model 1. This would be expected if McrB_s binds to McrB_L, so that assembly of a functional McrB_L oligomer is impaired. Pre-incubation of McrB_s with McrB_L or McrC demonstrated that inhibition occurs by binding to McrC (Figure 5) as proposed in model 2. Since McrB_L has the N-terminal DNA-binding domain, it presumably assembles preferentially on the DNA. Even though McrB_s might form complexes with McrB_L in solution, those might be deficient in DNA binding and may not interfere with the DNA cleavage reaction. The third model is disfavored by evidence that DNA recognition is mediated by the N-terminal domain of McrB_L which is largely missing in McrB_s (Gast et al., 1997). However, the truncation in McrB_s (missing the N-terminal amino acids 1–161) is shorter than the 1–190 amino acids N-terminal fragment used by Gast et al. (1997) to monitor DNA binding, so it cannot be completely ruled out that McrB_s retains some ability to bind and block the sites on the DNA. However, preliminary DNA-binding experiments with McrB_s did not detect binding activity (data not shown).

Since the molar ratios of the three proteins are crucial for McrBC activity, an important question is at which ratios they exist in the cell. Expression data from two independent laboratories using different vector constructs, expression and detection methods showed similar amounts of McrB_L and McrB_s (Ross and Braymer, 1987; Ross et al., 1989a; Dila et al., 1990). Maxicell analysis detected a relative ratio of 3:3:1 for McrB_L, McrB_s and McrC, respectively (Ross et al., 1989a). This ratio suggests that under native conditions McrB_s is required to maintain an optimal ratio between McrB_L and McrC. This view is supported by in vivo experiments, showing that reducing the level of McrB_s leads to a decrease of McrBC activity (Beary et al., 1997).

Several host factors, mainly proteases and chaperones, have been implicated in post-translational gene regulation. Recent in vivo experiments have shown that establishment of the restriction systems EcoKI and EcoAI in a new host is dependent on the presence of the host genes clpX and clpP (Makovets et al., 1998). It is thought that the ClpXP protease, or one of the components of this complex, can transiently delay the formation of the restriction-competent complex. A similar role in regulation of McrBC restriction could be provided by the molecular chaperone GroEL which we found to co-purify with McrB_L (Figure 2) and McrB_s. Treatment with UV light, a stress condition which induces GroEL expression (Krueger and Walker, 1984), leads to McrBC restriction alleviation (Dharmalingam and Goldberg, 1980; Kelleher and Raleigh, 1994). It is known that the association of GroEL with unfolded proteins can prevent unproductive aggregation or that GroEL can enhance assembly of multisubunit complexes. The interaction of GroEL with McrB_L or McrB_sin vivo could be a means to regulate McrBC restriction by transiently sequestering one of the subunits. However, the biological significance of GroEL–McrB_L or GroEL–McrB_s interaction can be questioned since its co-purification is a common problem of overexpressed proteins.

Regulation by a McrB_s is reminiscent of the regulation of Tn5 transposition. The transposase (Tnp) is regulated by an N-terminal deletion variant Inh, lacking the first 55 amino acids (de la Cruz et al., 1993). Inhibition by Inh is proposed to occur by formation of mixed oligomers with Tnp. Other examples in which a truncated variant of the protein interferes with the functional assembly of the oligomeric wild-type protein have been reported (Roman et al., 1991; Treacy et al., 1992). The McrBC system offers a striking demonstration of how an internal translation product may modulate the efficiency of the reaction either by inhibiting or increasing the cleavage rate depending on the ratio of the three mcrBC gene products. Thus, McrB_s provides the system with a rather sophisticated means for regulation.

Construction of the purification vectors

The mcrB gene was amplified by PCR from pER273 (Sutherland et al., 1992). The forward primer, 5'-TAATACGACTCACTATAGGGG-3' (NEB 1248), is complementary to the T7 RNA polymerase promotor on pER273. Alternatively, for the construction of the McrB_s purification vector, the forward primer was 5' CGGCCACATATGTCAAAAACTGAATC 3' containing an NdeI site (underlined). The reverse primer, 5'-CGGGGCTCTTCCGCACCCTGAGTCCCCTAATAATTTGTTGG-3' contains a SapI site (underlined) and the sequence of the last the last eight amino acids of the mcrB gene (italics). This primer introduces an additional glycine codon at the end of the mcrB sequence. PCR mixtures contained 1 Vent DNA polymerase buffer (NEB) adjusted to 3 mM MgSO₄, 0.25 mM each dNTP, 100 ng of plasmid pER273, 0.4 M primers and 2 U of Vent DNA polymerase (NEB) in a 100 l reaction. Amplification was carried out using a Perkin-Elmer Cetus 480 thermal cycler at 95°C for 60 s and then five cycles of 95°C for 60 s, 52°C for 60 s, and 72°C for 120 s. The final step was incubation at 72°C for another 5 min.

Gel purifications of DNA were performed using conventional agarose electrophoresis and GeneClean methods (Bio101 Inc., La Jolla, CA). The vector pBGYB, expressing the McrB–intein fusion protein, and the vector pSBGYB, expressing the McrB_s–intein fusion protein, were constructed as follows: the amplified fragments were digested with NdeI and SapI as indicated by the manufacturer (NEB), repurified and ligated overnight at 16°C into NdeI–SapI-digested and gel-purified pMYB140 (NEB). All constructs were verified by sequencing both strands.

Expression and purification of the McrB proteins on the chitin column

Expression and purification procedures were the same for all fusion constructs. For McrB_L, the vector pBGYB was transformed into the E.coli strain ER 2267, plated on LB agar plates containing the appropriate antibiotic and grown overnight at 37°C. A freshly transformed colony was transferred into 10 ml of LB broth containing 100 g/ml ampicillin and grown overnight at 37°C to saturation. This overnight culture was used to inoculate 1 l of LB broth containing 100 g/ml ampicillin and grown at 37°C to an OD₆₀₀ of 0.5. The culture was then transferred to a 21°C air shaker and induced with 0.4 mM isopropyl--D-thiogalactopyranoside for 16 h. The cells were harvested and the pellet was resuspended in 50 ml of 4°C cold column buffer [20 mM Tris–HCl, pH 7.5 (21°C), 500 mM NaCl] and broken by sonication. All subsequent steps were carried out at 4°C. After centrifugation at 25 000 g for 30 min, the cleared supernatant was loaded at a flow rate of 0.5 ml/min on a pre-equilibrated 5 ml chitin column. The column was washed with 20 column volumes of column buffer at a flow rate of 2 ml/min. Afterwards, the column was flushed with three column volumes of cleavage buffer [20 mM Tris–HCl, pH 7.5 (21°C), 500 mM NaCl, 30 mM dithiothreitol (DTT)]. The flow was stopped and the column remained at 4°C overnight. Fractions (5 ml) containing McrB_L were collected by washing the column with column buffer. To assess the efficiency of cleavage from the affinity tag, a sample of the resin was taken and boiled in SDS loading buffer. All fractions were analyzed by SDS–PAGE (Laemmli, 1970).

Fractions containing McrB_L from the chitin column were pooled and concentrated to 5 ml in a Centriprep-10 concentrator (Amicon Inc., Beverly, MA). The concentrate was loaded on a calibrated HiPrep Sephacryl S-200 (26/60) column (Pharmacia Biotech) equilibrated in 20 mM Tris–HCl, pH 7.5 (21°C), 500 mM NaCl, 1 mM DTT. The column was run at a flow rate of 0.5 ml/min, and 2 ml fractions were collected and monitored by UV absorbance. After elution, the protein-containing fractions were analyzed by SDS–PAGE (Laemmli, 1970). Fractions containing McrB_L were pooled and dialyzed against 10 mM Tris–HCl, pH 7.5 (21°C), 200 mM NaCl, 0.1 mM Na₂EDTA, 1 mM DTT and 50% glycerol. Relative protein concentrations were determined using the Bradford method with a bovine serum albumin (BSA) standard (Bio-Rad Inc., CA) or for McrB_L and McrB_s using molar extinction coefficients of 73 980 and 39 475/M/cm respectively, calculated according to the method of Pace et al. (1995). Both methods produced similar results. All preparations were stored at -20°C until further use.

DNA cleavage assays

The DNA substrate used in all experiments, pMC63, was that used previously by Stewart and Raleigh (1998). Briefly, this 1935 bp plasmid contains two BstUI sites (CGCG) which can be methylated by M.FnuDII to generate ^m5CGCG. The methylated cytosine is preceded by a guanine residue to generate the McrBC-susceptible GmC. The two GmC sites are separated by 63 nucleotides. The methylation reactions were performed in M.FnuDII buffer (NEB) containing 10 pMC63, 16 U of M.FnuDII (NEB) and 320 M S-adenosylmethionine in a 100 l reaction. The reaction was incubated at 37°C for 3 h. The methylation status was examined by digesting the plasmid with BstUI, which cannot cleave the methylated sequence. When protection against BstUI was complete, pMC63/M.FnuDII was ethanol precipitated, washed and resuspended in 50 l containing 1 buffer 2 (NEB) and 20 U of PvuII. Incubation for 1 h at 37°C to linearize the plasmid was followed by phenol:chloroform extraction and ethanol precipitation. McrBC activity was usually measured in 100 l of 1 buffer 2 (NEB) supplemented with 100 g/ml BSA, 1 mM GTP, 500 ng (4 nM) of pMC63/M.FnuDII/PvuII and McrB_L, McrB_s and McrC concentrations as indicated in the text. At the indicated time points, 10 l samples were removed and the reactions terminated on ice by addition of 2 l of stop buffer (10 mM Tris–HCl, 120 mM EDTA, 30% glycerol and 0.25% bromphenol blue). The extent of cleavage was quantified by agarose electrophoresis in 1 TBE containing 0.25 g/ml ethidium bromide, followed by photography of the UV-illuminated gel. Pictures were saved as TIFF files and the images were analyzed by densitometry using the software NIH Image 1.61. The amounts of uncut substrate and the larger cleavage product were quantified by measuring the areas under the peaks. The extent of relative cleavage was calculated considering that the larger cleavage product contains 63.4% of the full-length substrate (D.Panne, unpublished results). The data were fitted to exponential or linear functions by non-linear regression in PRISM software (GraphPad, San Diego, CA).

We thank F.J.Stewart (NEB) for providing purified McrC, a preparation of McrB_L and the vector pMC63. Maria P.MacWilliams is gratefully acknowledged for reading the manuscript. This work was supported by NEB and the Swiss National Science Foundation.

Beary TP, Braymer HD and Achberger EC (1997) Evidence of participation of McrBs in McrBC restriction in Escherichia coli K–12. J Bacteriol, 179, 7768–7775. | PubMed | ISI | ChemPort |

Bickle TA and Krüger DH (1993) Biology of DNA restriction. Microbiol Rev, 57, 434–450. | PubMed | ISI | ChemPort |

de la Cruz NB, Weinreich MD, Wiegand TW, Krebs MP and Reznikoff WS (1993) Characterization of the Tn5 transposase and inhibitor proteins: a model for the inhibition of transposition. J Bacteriol, 175, 6932–6938. | PubMed | ChemPort |

Dharmalingam K and Goldberg EB (1980) Restriction in vivo. V. Induction of SOS functions in Escherichia coli by restricted T4 phage DNA and alleviation of restriction by SOS functions. Mol Gen Genet, 178, 51–58. | Article | PubMed | ISI | ChemPort |

Dila D, Sutherland E, Moran L, Slatko B and Raleigh EA (1990) Genetic and sequence organization of the mcrBC locus of Escherichia coli K-12. J Bacteriol, 172, 4888–4900. | PubMed | ISI | ChemPort |

Gast FU, Brinkmann T, Pieper U, Krüger T, Noyer-Weidner M and Pingoud A (1997) The recognition of methylated DNA by the GTP-dependent restriction endonuclease McrBC resides in the N-terminal domain of McrB. Biol Chem, 378, 975–982. | PubMed | ISI | ChemPort |

Heitman J and Model P (1987) Site-specific methylases induce the SOS DNA repair response in Escherichia coli. J Bacteriol, 169, 3243–3250. | PubMed | ISI | ChemPort |

Kelleher JE and Raleigh EA (1994) Response to UV damage by four Escherichia coli K-12 restriction systems. J Bacteriol, 176, 5888–5896. | PubMed | ISI | ChemPort |

Krueger JH and Walker GC (1984) groEL and dnaK genes of Escherichia coli are induced by UV irradiation and nalidixic acid in an htpR+-dependent fashion. Proc Natl Acad Sci USA, 81, 1499–1503. | Article | PubMed | ChemPort |

Krüger T, Grund C, Wild C and Noyer-Weidner M (1992) Characterization of the mcrBC region of Escherichia coli K12 wild-type and mutant strains. Gene, 114, 1–12. | Article | PubMed | ISI

Krüger T, Wild C and Noyer-Weidner M (1995) McrB: a prokaryotic protein specifically recognizing DNA containing modified cytosine residues. EMBO J, 14, 2661–2669. | PubMed | ISI |

Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685. | Article | PubMed | ISI | ChemPort |

Makovets S, Titheradge AJB and Murray NE (1998) ClpX and ClpP are essential for the efficient acquisition of genes specifying type IA and IB restriction systems. Mol Microbiol, 28, 25–35. | Article | PubMed | ISI | ChemPort |

Noyer-Weidner M, Diaz R and Reiners L (1986) Cytosine-specific DNA modification interferes with plasmid establishment in Escherichia coli K12: involvement of rglB. Mol Gen Genet, 205, 469–475. | Article | PubMed | ChemPort |

Pace CN, Vajdos F, Fee L, Grimsley G and Gray T (1995) How to measure and predict the molar absorption coefficient of a protein. Protein Sci, 4, 2411–2423. | PubMed | ISI | ChemPort |

Pieper U, Brinkmann T, Krüger T, Noyer WM and Pingoud A (1997) Characterization of the interaction between the restriction endonuclease McrBC from E.coli and its cofactor GTP. J Mol Biol, 272, 190–199. | Article | PubMed | ISI | ChemPort |

Raleigh EA and Wilson G (1986) Escherichia coli K-12 restricts DNA containing 5-methylcytosine. Proc Natl Acad Sci USA, 83, 9070–9074. | Article | PubMed | ChemPort |

Roman C, Cohn L and Calame K (1991) A dominant negative form of transcription activator mTFE3 created by differential splicing. Science, 254, 94–97. | Article | PubMed | ISI | ChemPort |

Ross TK and Braymer HD (1987) Localization of a genetic region involved in McrB restriction by Escherichia coli K-12. J Bacteriol, 169, 1757–1759. | PubMed | ISI | ChemPort |

Ross TK, Achberger EC and Braymer HD (1987) Characterization of the Escherichia coli modified cytosine restriction (mcrB) gene. Gene, 61, 277–289. | Article | PubMed | ISI | ChemPort |

Ross TK, Achberger EC and Braymer HD (1989a) Nucleotide sequence of the McrB region of Escherichia coli K-12 and evidence for two independent translational initiation sites at the mcrB locus. J Bacteriol, 171, 1974–1981. | ISI | ChemPort |

Ross TK, Achberger EC and Braymer HD (1989b) Identification of a second polypeptide required for McrB restriction of 5-methylcytosine-containing DNA in Escherichia coli K12. Mol Gen Genet, 216, 402–407. | Article | ISI | ChemPort |

Stewart FJ and Raleigh EA (1998) Dependence of McrBC cleavage on distance between recognition elements. Biol Chem, 379, 611–616. | PubMed | ISI | ChemPort |

Sutherland E, Coe L and Raleigh EA (1992) McrBC: a multisubunit GTP-dependent restriction endonuclease. J Mol Biol, 225, 327–358. | Article | PubMed | ISI | ChemPort |

Treacy MN, Neilson LI, Turner EE, He X and Rosenfeld MG (1992) Twin of I-POU: a two amino acid difference in the I-POU homeodomain distinguishes an activator from an inhibitor of transcription. Cell, 68, 491–505. | Article | PubMed | ISI | ChemPort |

Waite-Rees PA, Keating CJ, Moran LS, Slatko BE, Hornstra LJ and Benner JS (1991) Characterization and expression of the Escherichia coli Mrr restriction system. J Bacteriol, 173, 5207–5219. | PubMed | ChemPort |

Zheng L, Wang X and Braymer DH (1992) Purification and N-terminal amino acid sequences of two polypeptides encoded by the mcrB gene from Escherichia coli. Gene, 112, 97–100. | Article | PubMed | ISI | ChemPort |

Main navigation

• Search EMBO Journal

  Search

• Advanced search

• The EMBO Journal

  • Home
  • Aims and scope
  • Current issue
  • Advance online publication
  • Web focuses
  • Archive:
  • Browse by issue
  • Browse by subject
  • Browse by category
  • Free online sample issue
  • Press releases

• Authors and Referees

  • Editorial process
  • Guide for authors
  • Submit an article
  • Guide for referees
  • Editors and Editorial Board
  • Contact editorial office

• Customer Service

  • Subscribe
  • Order sample copy
  • Purchase articles
  • Reprints and permissions
  • Contact NPG
  • Advertising