Article

• The EMBO Journal (1998) 17, 4668 - 4679
• doi:10.1093/emboj/17.16.4668

The requirement for the p53 proline-rich functional domain for mediation of apoptosis is correlated with specific PIG3 gene transactivation and with transcriptional repression

Corinne Venot¹, Michel Maratrat¹, Christine Dureuil¹, Emmanuel Conseiller¹, Laurent Bracco¹ and Laurent Debussche¹

1. Centre de Recherche de Vitry-Alfortville, Rhône-Poulenc Rorer, 13 quai Jules Guesde, 94403 Vitry sur Seine Cedex, France

Correspondence to:

Laurent Debussche, E-mail: laurent.debussche@rp-rorer.fr

Received 4 March 1998; Accepted 19 June 1998; Revised 18 June 1998

• Keywords:

  • apoptosis,
  • p53,
  • PXXP motif,
  • repression,
  • sequence-specific transactivation

Introduction

p53 mutations are associated with a poor prognosis and drug resistance in human cancers, and the frequent mutation of p53 in a wide spectrum of human cancers suggests that p53 inactivation is a crucial and often obligatory step during oncogenesis (Hollstein et al., 1991, 1994; Donehower and Bradley, 1993; Gottlieb and Oren, 1996). The wild-type p53 protein, p53 WT, is a nuclear phosphoprotein and a transcription factor. It is capable of both transactivating through the binding to specific DNA-regulatory sequences (el-Deiry et al., 1992; Funk et al., 1992), and repressing transcription of many cellular and viral promoters that do not contain binding sequences, mainly promoters whose initiation is dependent on the presence of a TATA box (Ginsberg et al., 1991; Kley et al., 1992; Seto et al., 1992; Jackson et al., 1993; Mack et al., 1993; Subler et al., 1994). The importance of sequence-specific transactivation (SST) of genes by p53 is underscored by the fact that the vast majority of p53 mutations derived from tumors map within the sequence-specific DNA-binding domain (Hollstein et al., 1991; Pavletich et al., 1993; Cho et al., 1994). p53 can mediate either growth arrest or apoptosis, depending on the physiological circumstances (reviewed in Bates and Vousden, 1996; Gottlieb and Oren, 1996; Ko and Prives, 1996; Hansen and Oren, 1997; Levine, 1997).

The underlying mechanism of p53-dependent growth arrest is mediated by p21^WAF1/cip1, a p53-inducible cyclin-dependent kinase inhibitor (CDKI) (el-Deiry et al., 1993, 1994; Harper et al., 1993; Xiong et al., 1993). The role of p53 in the induction of apoptosis seems much more complex. Although abrogation of p21^WAF1/cip1 expression results in complete loss of p53-induced cell cycle arrest in human tumor cells (Waldman et al., 1995), the development of p21^WAF1/cip1-deficient mice has revealed that this cell cycle inhibitor is not the major effector through which p53 helps to maintain the non-transformed phenotype of normal cells (Brugarolas et al., 1995; Deng et al., 1995). It is also clear that p21^WAF1/cip1 cannot account for the apoptotic activity of p53 (Chen et al., 1996), although it exhibits suppression activity (el-Deiry et al., 1993). On the contrary, p21^WAF1/cip1 has been postulated to have an anti-apoptotic activity, presumably by causing G₁ arrest (Polyak et al., 1996).

Overexpression of p53 in cells clearly activates genes involved in apoptosis (reviewed in Ko and Prives, 1996; Hansen and Oren, 1997; Levine, 1997). p53 regulates BAX (Miyashita and Reed, 1995) and Fas/APO1 (Owen-Schaub et al., 1995), but neither is required for p53-dependent apoptosis in vivo (Knudson et al., 1995; Fuchs et al., 1997). By subtractive hybridization, several DNA damage-inducible p53-regulated genes were isolated: the IGF-BP3 gene, whose product blocks mitogenic signaling by insulin-like growth factor type 1 (IGF-1) (Buckbinder et al., 1995); the gene encoding the cathepsin-D protease that contributes to cytokine-mediated apoptosis (Wu et al., 1998); KILLER/DR5, encoding a member of the tumor necrosis factor receptor family that induces apoptosis when overexpressed (Wu et al., 1997); PAG608 which encodes a nuclear zinc finger protein (Israeli et al., 1997); and the human homolog of the Drosophila sina gene (Nemani et al., 1996). Recently, by using the SAGE technique (serial analysis of gene expression) to evaluate the patterns of gene expression following p53 expression, a series of p53-induced genes (PIG genes) have been identified that are predicted to encode proteins that could generate or respond to oxidative stress (Polyak et al., 1997). The PIG3 product is closely related to a plant NADPH quinone oxidoreductase implicated in apoptosis in plant meristems.

Despite this growing list of p53-regulated apoptotic genes, the extent to which SST contributes to apoptosis remains controversial. In some cases, p53-mediated SST is clearly required (Sabbatini et al., 1995b; Yonish-Rouash et al., 1995; Attardi et al., 1996; Haupt et al., 1996), and several tumor-derived p53 mutants which have kept transcriptional activation of genes responsible for G₁ arrest but not of BAX and IGF-BP3, are defective in inducing apoptosis (Friedlander et al., 1996a; Ludwig et al., 1996; Rowan et al., 1996). On the other hand, it has been established that p53-dependent apoptosis can proceed despite the inhibition of protein synthesis (Caelles et al., 1994; Wagner et al., 1994) and that SST-deficient p53 mutants can induce apoptosis in some tumor-derived cell lines (Yonish-Rouach et al., 1994; Haupt et al., 1995, 1996). In addition, it has been reported that WT1, E1B 19 kDa and Bcl-2, three proteins capable of preventing p53-mediated apoptosis, cannot inhibit SST by p53, whereas they can neutralize transcriptional repression by p53 (Shen and Shenk, 1994; Maheswaran et al., 1995; Sabbatini et al., 1995a). This strongly suggests that p53 might induce apoptosis, at least in part, by repression of transcription. In line with this idea, the SAGE experiments of Polyak et al. (1997) discovered a larger number of p53-repressed genes and, prior to that, the gene encoding the microtubule-associated protein MAP4 was shown by differential display to decrease in cells following induction of p53 WT (Murphy et al., 1996). Importantly, the decrease in MAP4 was inhibited by E1B 19 kDa and WT1 and seems to be important in the rapid progression of p53-induced apoptosis.

A novel human p53 functional domain necessary for efficient growth suppression but dispensable for transcriptional activation of p21^WAF1/cip1, MDM2 and BAX promoters has been identified (Walker and Levine, 1996). This domain lies between the N-terminal transactivation domain (amino acids 1–44) that contacts TATA box-binding protein (TBP)-asscociated factor (TAF) components of TFIID (Lu and Levine, 1995; Thut et al., 1995) and the central specific DNA-binding domain (amino acids 102–292) (Bargonetti et al., 1993; Pavletich et al., 1993; Cho et al., 1994). It consists of a proline-rich domain which contains five repeats of the PXXP motif in human p53. Similar motifs have been shown to play a role in signal transduction via their SH3 domain binding activities (reviewed in Cohen et al., 1995; Pawson, 1995). The corresponding murine p53 polyproline domain has been shown to be a docking site in the transmission of Gas1-dependent anti-proliferative signals (Ruaro et al., 1997) and to be required to activate apoptosis but not growth arrest (Sakamuro et al., 1997).

Here we report that the proline-rich domain of human p53 is required for induction of apoptosis, transcriptional repression, reactive oxygen species (ROS) production and transactivation. A p53 mutant lacking the proline-rich domain cannot repress a series of promoters efficiently compared with p53 WT. In addition, it displays distinct transcriptional activities depending on the promoter context. It can activate the natural MDM2, WAF1 and BAX promoters efficiently but it is totally silent on the natural PIG3 promoter. This suggests that the proline-rich domain mediates p53-dependent apoptosis via transcriptional repression and the transactivation of specific apoptogenic genes. The lack of PIG3 SST is correlated with impaired production of ROS. By using an artificial reporter construct, we demonstrate that the 20 bp PIG3 promoter-derived p53-responsive element is by itself responsible for the absence of SST by the proline-rich deletion mutant. Gel retardation experiments using baculovirus-expressed proteins revealed no significant quantitative differences between p53 and the proline-rich deletion mutant on the PIG3 p53-responsive element, whereas similar experiments using proteins produced by expression plasmid transfection in human cancer cells indicated that the proline-rich domain is involved in a cellular activation of p53 DNA binding.

The human p53 proline-rich domain is required for apoptotic activity but dispensable for cell cycle inhibition

A p53 deletion mutant called p53 pro, identical to a previous construct (Walker and Levine, 1996), was generated by a PCR-based method to create an internal deletion of amino acids 62–91, removing all five of the PXXP motifs from the human p53 protein. This mutant cDNA was inserted into the expression vector pcDNA3 to express the mutant protein under the control of the cytomegalovirus promoter. In a G418-resistant colony formation assay, we confirmed that p53 pro has lost growth suppression activity, both in SAOS-2 (human osteosarcoma) and in H1299 (human non-small-cell lung carcinoma), two p53 -/- cell lines. It merely decreased colony formation by 2-fold, whereas the D281G mutant was completely defective and p53WT strongly reduced (10- to 20-fold) the number of drug-resistant colonies (data not shown). In this assay, growth suppression can be the result of either p53-dependent growth arrest or apoptosis.

To determine clearly whether the defect of p53 pro in growth suppression mainly results from a lack of apoptotic activity, we studied p53 pro in two different apoptotic assays (Table I; Figure 1A and B). First, p53 expression plasmids were microinjected in SAOS-2 cells and their effects were assessed by visualization of cells and TUNEL analysis, 16 or 36 h after microinjection. After 16 h, the number of cells that are detectable by immunostaining for p53 had not diminished whatever the expression plasmid microinjected, but many of the p53 WT-microinjected cells displayed classical signs of apoptosis (shrinking cytoplasm, blebbing nuclei and condensed chromatin) and stained positively by TUNEL analysis (Figure 1A and B). On the other hand, the p53 pro and D281G mutants gave only a background signal comparable with the LacZ control. After 36 h, 80% of the p53 WT-microinjected cells had disappeared, while p53 pro reproducibly produced a very weak residual apoptotic effect above the background. The same series of microinjection experiments was repeated in H1299 cells and gave similar results (data not shown). Induction of apoptotis was also scored in an assay based on fluorescence-activated cell sorter (FACS) analysis upon transient transfection (Yonish-Rouach et al., 1994, Friedlander et al., 1996a). In H1299 cells, p53 WT induced apoptosis in a dose-dependent manner (Table I), accordingly to a previous report (Chen et al., 1996). Apoptosis was detectable from 0.1 g of transfected plasmid, but not below, and culminated largely before the highest plasmid dose used (Table I). p53 pro was inactive; however, at high plasmid concentrations, it reproducibly gives a residual specific apoptotic activity, confirming the microinjection results. We have verified by Western blot analysis (Figure 1C) that the protein levels of p53 WT and p53 pro were similar over the doses of plasmids introduced into cells.

Figure 1.

The proline-rich domain is required for apoptosis but is dispensable for growth arrest. (A) p53 WT and p53 pro expression plasmids were microinjected into the nuclei of SAOS-2 cells. Cells were immunolabeled for p53 expression (red staining) and for apoptosis (green staining) as described in Materials and methods. (B) Apoptosis of SAOS-2 cells after microinjection of lacZ- or p53-expressing plasmids. The percentage of TUNEL-positive cells among microinjected cells is presented as the average and standard deviation from three independent experiments. Above each bar is indicated the total number of remaining microinjected cells from these three experiments that expressed the appropriate transgene. (C) Western blot analysis of p53 WT and p53 pro after transfection of plasmid doses that correspond to those used in experiments presented in Table I. (D) H1299 cells were transiently transfected with p53 WT, p53 pro, D281G or p21^WAF1/CIP1 expression plasmids and analyzed by FACS after incubation with BrdU. Changes in the proportion of the total cell population (after transfection with p53 WT, p53 pro or p21^WAF1/CIP1) in the cell cycle phase (i.e. in G₁, S, G₂M) relative to the total cell population (after transfection with D281G) are shown.

View full figure (88 KB)

Table 1: Apoptosis of H1299 cells following transfection with mutant p53 expression plasmids

View full table

Taken together, these results eliminate the possibilty that lower expression of p53 pro would explain its impaired apoptotic phenotype. Similar experiments using high plasmid concentrations were carried out with SAOS-2 cells, which are not as efficiently transfectable as H1299 cells. The sub-G₁ population was nearly identical to the LacZ, D281G or p53 pro expression plasmids, while p53 WT increased this population 2- to 3-fold (data not shown).

The weak growth suppression phenotype of p53 pro most probably results from growth arrest. To verify this, cell cycle progression was studied by BrdU incorporation experiments coupled to FACS analysis after transient transfection in H1299 cells. Results presented in Figure 1D showed that p53 pro, albeit less efficiently than p53 WT and p21^WAF1/cip1, was able to increase G₁ and G₂/M populations.

The p53 proline-rich deletion mutant is strongly impaired in repression of full-length promoters but retains partial repression activity on TATA box-containing minimal promoters

Compared with some transcriptionally active p53 tumor-derived mutants (R175P, R181L, V143A) which have impaired apoptotic functions and cannot transactivate some apoptosis-related genes such as BAX and IGF-BP3 (Friedlander et al., 1996a; Ludwig et al., 1996; Rowan et al., 1996), p53 pro and the reported murine deletion mutant are unique p53 mutants in that they have been reported to mediate SST of both G₁ arrest genes and apoptotis-associated genes (Walker and Levine, 1996; Sakamuro et al., 1997). This suggests that the proline-rich domain plays a crucial role in other biochemical mechanisms involved in the apoptotic activity of p53 WT. There are several lines of evidence indicating that p53-mediated transcriptional repression mediates programed cell death (see Introduction). p53 pro was therefore compared with p53 WT for repression of various viral [SV40 early enhancer/promoter, Rous sarcoma virus long terminal repeat (RSV LTR)] and cellular (c-fos, multi-drug resistance) promoters (Kley et al., 1992; Dittmer et al., 1993; Jackson et al., 1993). The results presented in Figure 2A demonstrate that, as expected, p53 WT efficiently represses these promoters at transfected plasmid doses where apoptosis does not occur (Table I). In contrast, like the D281G tumor-derived p53 mutant, p53 pro has, in great part, lost repression activity at low plasmid doses (Figure 2A) and also at higher doses (data not shown). On the other hand, the repression activity was not lost to such a great extent either with the pUHC13.6 vector, in which basal transcription is driven by the TATA box-containing minimal region from the human cytomegalovirus promoter IE (Gossen and Bujard, 1992), or with the pGL2 control vector, in which the SV40 enhancer sequence is separated from promoter sequence (Figure 2B). Once again, p53 pro and D281G are virtually indistinguishable in these promoter repression assays.

Figure 2.

Repression activity of p53 pro in H1299 cells. (A) Various viral (upstream of the luciferase reporter) and cellular (upstream of the CAT reporter) promoters were transfected in the presence of p53 WT, pro and D281G expression plasmids. The fold-transactivation of the reporter plasmid was calculated over its basal level of expression. (B) pUHC13-6 and pGL2 controls (upstream of the luciferase reporter) were transfected with p53 WT, p53 pro or D281G expression plasmids.

View full figure (65 KB)

The p53 proline-rich deletion mutant can transactivate p21^WAF1/cip1, MDM2 and BAX promoters efficiently

The ability of p53 pro to mediate G₁ arrest was correlated with induction of endogenous p21^WAF1/cip1 and MDM2 proteins. Both proteins were detected at similar levels by Western blot analysis 20 h after transient transfection with p53 pro and p53 WT expression plasmids in H1299 cells (Figure 3A). The transactivation activities of p53 pro and p53 WT were also compared in co-transfection experiments in H1299 cells. p53 pro transactivated the natural WAF1 and MDM2 promoters to extents similar to p53 WT. However, there were some differences with p53 WT (Figure 3B). p53 pro did not squelch transcriptional activation at high concentrations on the WAF1 promoter. The loss of squelching activity is reminiscent of the loss of repression activity reported in the preceding paragraph. It has been verified that the levels of the two proteins are very similar at the various concentrations of plasmids transfected (Figure 3C). Similar results were obtained in SAOS-2 cells (data not shown). We also reinvestigated the ability of this mutant to transactivate the apoptosis-related gene, BAX, in transient transfection experiments in H1299 cells. Data presented in Figure 3B show that BAX promoter SST by p53 pro did not significantly differ from SST by p53 WT. The proline-rich domain was clearly dispensable for SST of these promoters.

Figure 3.

(A) p21^WAF1/CIP1 and MDM2 Western blot analysis. H1299 cells (10⁶) were transiently transfected with 5 g of empty (lane 1), p53 WT (lane 3) or p53 pro (lane 4) expression vectors. Cell lysates were analyzed for p53, p21^WAF1/CIP1 and MDM2 protein expression. Lane 2 corresponds to a purified p53 protein standard. (B) Transcriptional transactivation activities in H1299 cells. WAF1, MDM2 and BAX promoters (upstream of the luciferase reporter) were transiently transfected with 30, 100 or 300 ng of p53 WT or p53 pro expression plasmids. The fold transactivation of the reporter plasmid was calculated over its basal level of expression. (C) Western blot analysis of p53 WT and p53 pro after transfection with plasmid doses (30, 100 or 300 ng) that correspond to those used in the experiments in (B).

View full figure (74 KB)

p53 pro has completely lost the ability to produce reactive oxygen species and to transactivate the PIG3 gene

Among the recently discovered p53-inducible PIG genes, several can be considered to influence the avaibility of intracellular ROS and, consequently, to participate in p53-induced apoptotic processes. In a series of colorectal cancer cell lines, pharmacological experiments suggested that the redox enzyme encoded by PIG3 is necessary for this process, whereas PIG3 overexpression is not sufficient to induce apoptosis (Polyak et al., 1997). As shown in Figure 4A, p53 WT stimulated ROS production in H1299 cells, as it does in colorectal cancer cell lines, indicating that p53 might induce apoptosis in H1299 cells by a similar mechanism. ROS production was measured after p53 WT transfection using carboxymethyl difluorescein diacetate and flow cytometry. Interestingly, p53 pro did not have this effect (Figure 4A). In line with these results, RT–PCR analysis showed that endogenous PIG3 transactivation was triggered by p53 WT but not by p53 pro (Figure 4B). Study of the promoter region of the PIG3 gene revealed that it contains a functional 20 bp p53-responsive element (Polyak et al., 1997). We therefore studied SST of the PIG3 promoter by p53 WT and p53 pro. We used the reported 0.7 kb PIG3 promoter–luciferase reporter construct in co-transfection assays in H1299 cells. p53 WT strongly activated this promoter, without squelching, at the highest p53 WT concentration tested. As expected from the effect on the endogenous gene, p53 pro was totally inactive, even at very high expression plasmid concentrations (Figure 4C).

Figure 4.

(A) p53 WT but not p53 pro produces ROS in H1299 cells. Cells were transiently transfected with CD20 and p53 expression plasmids. FACS analysis was performed on positive CD20 cells (except for cells analysed at 1 h) and then the mean of carboxymethyl dichlorofluorescein diacetate fluorescence was calculated. As a positive control, ROS production was measured 5 h after treatment with 30 mM H₂O₂. (B) RT–PCR analysis of PIG3 transcripts in p53 transiently transfected H1299 cells. H1299 cells were transiently transfected with empty vector, D281G, p53 pro or p53 WT expression plasmids. One fragment that has the 423 bp expected size was amplified only in p53 WT-transfected cells using PIG3 oligonucleotides. As a control to ensure that the same amount of cDNA was used in all experiments, the cDNA encoding -actin was amplified with specific oligonucleotides. To control p53 mRNA expression, a fragment that has the 513 bp expected size was amplified using p53 oligonucleotides. (C) The proline-rich domain is required for PIG3 transactivation. The 0.7 kb PIG3 promoter (upstream of the luciferase reporter) was transiently transfected with 30, 100 or 300 ng of p53 WT and p53 pro expression plasmids. The fold-transactivation of the reporter plasmid was calculated over its basal level of expression.

View full figure (46 KB)

Comparisons of the in vitro binding capacities of p53 WT and the p53 proline-rich deletion mutant

The absence of SST on the PIG3 promoter was surprising, since the p53 core domain responsible for sequence-specific DNA binding is functional in p53 pro and can mediate p21^WAF1/cip1, MDM2 and BAX SST. Gel retardation assays were performed to determine whether specific binding to the PIG3 promoter-derived p53-binding site was affected by the proline-rich domain deletion. For these experiments, p53 WT, the D281G mutant and p53 pro were produced as nuclear extracts in Sf9 insect cells using recombinant baculoviruses under strictly identical infection conditions. For each nuclear extract, Western blot analysis using monoclonal antibodies directed against N-terminal (DO-1), central (PAb240) and C-terminal (PAb421) epitopes demonstrated the absence of detectable p53 degradation products (data not shown). Densitometric analysis of Coomassie Blue-stained SDS–PAGE gels showed that the p53 proteins represented 45% of the total protein. The absolute amounts of p53 were estimated both by densitometric analysis of Coomassie Blue-stained SDS–PAGE gels and by the Bradford assay, with bovine serum albumin (BSA) as a standard. Both methods gave similar results (data not shown). These extracts were incubated with ³³P end-labeled DNA probes containing the 20 bp PIG3-derived (Polyak et al., 1997), the 20 bp WAF1-derived (el-Deiry et al., 1993) or the 39 bp BAX-derived sequences (Miyashita and Reed, 1995). Monoclonal antibody PAb421 directed against p53 was also included in some samples to help stabilize p53–DNA interactions (Hupp et al., 1992). As shown in Figure 5A, for each of the three DNA elements, p53 pro (lanes 1, 3 and 5) produced a protein–DNA complex as efficiently as p53 WT (lanes 2, 4 and 6, the slightly faster migration is due to the molecular weight difference). As a control, D281G in the presence of PAb421 did not give a band shift with any sequence (lanes 9, 12 and 15). With p53 WT (lanes 8, 11 and 14) and p53 pro (lanes 7, 10 and 13), protein–DNA complexes were stabilized and supershifted by PAb421. These retardation gel experiments demonstrated that the 20 bp WAF1-derived sequence is a much more potent in vitro target DNA probe than the 20 bp PIG3-derived sequence, the 39 bp BAX-derived sequence being intermediate (Figure 5A). The hierarchy between WAF1 and BAX is consistent with a previous report (Friedlander et al., 1996a).

Figure 5.

(A) Gel retardation assays with end-labeled double-stranded oligonucleotides containing p53-binding sites. PIG3, BAX and WAF1 probes (2.4 nM) were incubated with p53 WT, p53 pro and D281G baculovirus-expressed proteins (p53 absolute concentration: 10 nM) in the absence or presence of PAb421. (B) p53 WT and p53 pro affinities for the PIG3 p53-binding site. The autoradiograms presented are representative of the series of assays carried out to calculate K_d values. The indicated amounts of p53 WT and p53 pro proteins were incubated with the PIG3 oligonucleotide (2.4 nM). (C) p53 pro is unable to transactivate a synthetic promoter containing the PIG3 p53-responsive element. pLuc-PIG3 and pLuc-WAF1 were transiently transfected with 30, 100 or 300 ng of p53 WT and p53 pro. The fold-transactivation of the luciferase reporter plasmid was calculated over its basal level of expression

View full figure (61 KB)

The affinity constants for the PIG3 element were calculated. Active protein concentrations in the respective nuclear extracts were first determined using the high affinity WAF1 element. The results were approximately equivalent (80%, data not shown) to the calculations of the absolute concentrations, provided that both proteins bound to the WAF1 element in the ratio of one p53 tetramer per DNA probe molecule (Balagurumoorthy et al., 1995). K_d values for both PAb421-stabilized proteins and the PIG3-responsive element were calculated by non-linear regression analysis from a series of gel retardation assays to yield 45 and 25 nM for p53 pro and p53 WT, respectively (Figure 5B). Both proteins thus exhibited similar and low affinities. However, it is noteworthy that activation by PAb421 produced band shifts with patterns slightly different between p53 pro and p53 WT.

Comparisons of WAF1 and PIG3 p53-responsive elements in the same promoter environment

A synthetic reporter gene construct called pLuc-PIG3, containing the 20 bp PIG3 promoter-derived p53-responsive element associated with a basal promoter element including the TATA element from the human HSP70 upstream from the luciferase gene, was constructed. Co-transfection experiments showed that this construct was transactivated by p53 WT, but not by p53 pro (Figure 5C). As a control, a strictly homologous synthetic promoter called pLuc-WAF1 and containing the 20 bp WAF1-derived p53 responsive element was constructed and tested. pLuc-WAF1 did not discriminate between p53 WT and p53 pro (Figure 5C). Taken together, these results indicate that the discrimination between p53 WT and p53 pro was mediated entirely by the 20 bp PIG3-derived responsive element and was not merely due to the absence of a typical TATA box or to any other specific feature of the 0.7 kb PIG3 promoter (Polyak et al. 1997). Moreover, the efficiency of both synthetic promoters seemed to be related to their affinity for p53.

A single chain antibody derived from PAb421 cannot restore PIG3 SST by p53 pro

The monoclonal antibody PAb421 which recognizes a p53 C-terminal epitope can enhance the DNA-binding activity of p53 WT in vitro (Hupp et al., 1992) and the transcriptional activity of p53 WT and of a subset of p53 mutants in cells upon microinjection (Abarzua et al., 1995; Hupp et al., 1995). We have tried to use a functional single chain antibody (scFv) derived from this antibody and called PAb421 scFv to restore PIG3 SST by p53 pro, since this scFv was shown to activate SST by the tumor-derived mutant R273H (C.Caron de Fromentel, N.Gruel, C.Venot, L.Debussche, E.Conseiller, C.Dureuil, J.-L. Teillaud, B.Tocqué and L.Bracco, submitted). An increase in SST was observed with p53 WT and with R273H on pLuc-WAF and PIG3 promoter constructs (Figure 6A). p53 pro was also sensitive to PAb421 scFv activation on the pLuc-WAF element. In contrast, such activation could not be detected on the PIG3 promoter.

Figure 6.

(A) PAb421 scFv cannot restore PIG3 SST by p53 pro. p53 expression plasmids (300 ng) and the relevant gene reporter constructs were transfected with or without 900 ng of PAb421 scFv expression plasmid. The percentage increase in transcriptional activity represents the ratio between fold-activations due to p53 with and without scFv PAb421. (B) The proline-rich domain is required for cellular activation of DNA binding to the PIG3 element. Cell-free extracts from p53 WT- or p53 pro-transfected H1299 cells were incubated with WAF1 or PIG3 oligonucleotides (2.4 nM) in the presence (+) or absence (-) of PAb421.

View full figure (54 KB)

The proline-rich domain is required for cellular activation of DNA binding to the PIG3 element

The discrepancy between in vitro DNA-binding properties (Figure 5A and B) and PIG3 SST inactivity (Figures 4C and 5C) led us to assume that in cells the proline-rich domain is required for a cellular stimulation of DNA binding to the PIG3 sequence. We thus examined the DNA-binding capacities of p53 WT and p53 pro expressed upon transfection in H1299 cells. Figure 6B revealed that p53 WT-containing H1299 cellular extracts bound much more efficiently to the PIG3 element than did p53 pro and that this DNA binding was strongly enhanced by PAb421 only with p53 WT. As a control, the same experiment was carried out in parallel with the WAF1 element. No such difference between p53 WT and p53 pro was observed. This led us to conclude that a DNA-binding activation mechanism requiring the proline-rich domain is absolutely necessary for the PIG3 element.

A new functional domain necessary for efficient growth suppression but not for SST has been discovered recently in the N-terminal domain of human p53 (Walker and Levine, 1996). This domain consists of five repeats of PXXP, a motif known to form a left-handed polyproline type II helix, which creates a binding site for SH3 domains (Yu et al., 1994). p53 from other species also exhibit related domains, to variable extents (Walker and Levine, 1996). In mouse, the functionality of this domain has been demonstrated (Sakamuro et al., 1997). The human and mouse PXXP domains are dispensable for SST, but are required for growth suppression. Murine p53 devoid of this domain is impaired in apoptosis but can mediate growth arrest. This study clearly establishes that the proline-rich domain of human p53 is required for apoptosis in both H1299 and SAOS-2 cells, in which SST by p53 is either absolutely necessary or dispensable for apoptosis, respectively (Haupt et al., 1996). Moreover, the proline-rich domain of human p53 is not required for growth arrest activity, confirming that G₁ arrest and apoptosis are separable p53 activities. Although the mechanism by which p53 mediates apoptosis is poorly understood, several studies have demonstrated that different p53 biochemical activities are required to induce apoptosis, among which repression and SST of apoptosis-related genes play a crucial role (see Introduction). We show that the absence of this proline-rich domain severely compromised both of these apoptosis-related activities of p53 in the lung carcinoma cell line H1299.

Repression by p53 may accelerate the progression of apoptosis (Murphy et al., 1996). Study of the transactivation double-mutant L22Q, W23S suggests that repression may not be essential, since this mutant can induce some apoptosis in some cell lines, including H1299, even though it is impaired for repression (Haupt et al., 1995; Chen et al., 1996; Roemer and Mueller-Lantzsch, 1996). In contrast, that p53 pro is impaired for both apoptosis and repression function strengthens the idea of a critical role for repression in apoptosis by p53. The mechanism by which p53 represses promoters is not clear. Deletion analysis and use of the L22Q, W23S double mutant have implicated the TBP and TAFs as targets for this activity (reviewed in Gottlieb and Oren 1996; Ko and Prives, 1996). It is noteworthy that many p53 tumor-derived mutants still interact with TBP and TAFs but have lost promoter-repression activity (reviewed in Zambetti and Levine, 1993; Gottlieb and Oren, 1996; Ko and Prives, 1996), showing that interactions with TBP and TAFs are necessary but not sufficient. Our finding that the proline-rich domain is also necessary adds an unexpected complication. Our data show that the proline-rich deletion and mutation in the DNA-binding core domain led to the same phenotype, i.e. absence of repression of full-length promoters but partial repression of minimal promoters or of a promoter in which enhancer sequence has been displaced. It is therefore tempting to suggest that this partial repression would reflect a residual squelching activity presumably due to interaction with TBP and TAFs, whereas repression of full-length promoters by p53 involves a more complex mechanism than simple squelching, which requires the wild-type conformation and the proline-rich domain, in addition to interactions with factors such as TBP and TAFs.

This study confirms that the proline-rich domain is dispensable for SST of growth arrest and BAX genes (Walker and Levine, 1996; Sakamuro et al., 1997). This is not in disagreement with the requirement for this domain for mediation of apoptosis, since increased BAX expression is not detected during p53-mediated apoptosis in every cell type, especially in SAOS-2 and H1299 cells (Allday et al., 1995; Canman et al., 1995; Ludwig et al., 1996; Rowan et al., 1996). However, we have demonstrated that the proline-rich domain is required for ROS production and for endogenous PIG3 gene transactivation. The absence of PIG3 SST by the p53 pro mutant observed both with the 0.7 kb promoter and with a synthetic promoter containing the p53-responsive element of PIG3 associated with a TATA box demonstrated that in vivo the 20 bp PIG3-derived sequence alone discriminates between p53 pro and p53 WT. Gel retardation assays did not reveal significant differences in K_d values between p53 WT and p53 pro for the binding to PIG3, as well as to WAF1 and BAX p53-binding sequences. Besides, one has to bear in mind that the p53 in vitro affinity for the PIG3 sequence is very low, compared with other p53 target sequences. If we accept the idea of a threshold of affinity below which SST could not occur, this would imply that in cells the proline-rich domain would be required for activation of DNA binding on low affinity p53-responsive elements such as that of PIG3. This DNA-binding activation necessary for PIG3 SST could result from a conformational change. It would not be the first example of such a role played by a p53 structural domain (Hupp et al., 1992). Gel retardation experiments using cell-free extracts from p53-transfected H1299 cells revealed that such a proline-rich domain-mediated DNA-binding stimulation does exist for the PIG3 promoter. By using the scFv technology, we also demonstrated that loss of DNA-binding activation through the proline-rich domain cannot be compensated by the other described activation mechanism, which involves the p53 C-terminal regulatory domain (Hupp et al., 1992, 1995; Abarzua et al., 1995). That antibodies directed against epitopes close to proline-rich domains have been shown to modulate DNA binding lends strong support to the idea that this domain would be a docking site for an activating factor(s) (Wolkowicz et al., 1995; Friedlander et al., 1996b).

This study extends conclusions from previous reports which have suggested the existence of discrete classes of p53-responsive genes. Evidence for such classes came from the study of specific tumor-derived mutants (Friedlander et al., 1996a; Ludwig et al., 1996, and references therein). This work clearly shows that a p53 mutated outside the specific DNA-binding core is also able to discriminate between p53-responsive genes and that this discrimination is not necessarily correlated with quantitative alterations of in vitro DNA-binding capacities. Alternatively, the role of phosphorylation in the differential stimulation of the binding to various DNA sites has been documented (Wang and Prives, 1995; Lohrum and Scheidtmann, 1996). Proline-rich domain could be also implicated in the control of p53 phosphorylation status.

DNA damage induces p53 overexpression which then results in either apoptosis or cell cycle arrest. The molecular basis of the choice between G₁ arrest and apoptosis, in other words, life and death, is enigmatic. In colorectal cancer cell lines, this choice has been shown to be determined by at least two factors: protection from apoptosis by p21^WAF1/cip1, and as yet unidentified trans-acting factors that can overcome this protection (Polyak et al., 1996). In some cell types, mainly hematopoetic cells, several reports demonstrate that cytokines are influential in the death/life decision by p53 (reviewed in Bates and Vousden, 1996; Gottlieb and Oren, 1996; Ko and Prives, 1996; Hansen and Oren, 1997). What might be the molecular mechanism utilized by the proline-rich domain to participate in SST of apoptotis-related genes such as PIG3 and repression of promoters by p53? We can propose that the proline-rich domain is a docking site for SH3 proteins which would regulate p53-dependent apoptosis by altering these two p53 biochemical activities critical for p53-dependent apoptosis. Identifying such hypothetical SH3-bearing proteins and deciphering their regulatory functions would greatly help in solving the enigma of p53 death/life decision and to understand better p53 function in general. Mutations of critical prolines within the proline-rich functional domain and dominant-negative mutants containing the proline-rich domain have been shown to abolish p53-mediated transactivation-independent growth arrest induced by Gas1 (Ruaro et al., 1997). This lends strong support to the idea that this domain may be a docking site for regulatory SH3-bearing proteins.

Plasmids

p53 pro cDNA was generated by PCR as described (Walker and Levine, 1996) and cloned in the pcDNA3 vector (Invitrogen) between the HindIII and NotI sites. pcDNA3 expression constructs for p53 WT, R273H and D281G have been described previously (Conseiller et al., 1998) as have the human c-fos promoter (-710/+41) construct (Deschamps et al., 1985), the MDR promoter construct (Dittmer et al., 1993), the PUHC13-6 plasmid (Gossen and Bujard, 1992), the WWP-luc construct containing a 2 kb fragment from the WAF1 promoter (el-deiry et al., 1992), the 0.7 kb PIG3 promoter construct (Polyak et al., 1997), CD20 expression plasmid (Dubs-Poterszman et al., 1995) and the pGL2 control vector (Promega). Fragments of 0.4 kb containing p53-responsive elements from MDM2 (Juven et al., 1993) or BAX (Miyashita and Reed, 1995) genes were inserted upstream from the luciferase gene in pGL3-basic plasmid (Promega) (Conseiller et al., 1997). The human WAF1 cDNA clone was obtained by PCR following a previously described procedure (Parker et al., 1996) and inserted in the pcDNA3 vector. pLuc-PIG3 and pLuc-WAF1 were constructed as described (Funk et al., 1992) by inserting PIG3 and WAF1 double-stranded oligonucleotides described below upstream from a basal promoter element including the TATA element from the human HSP70 gene and the luciferase gene. RSV LTR–luciferase reporter gene vector was obtained by inserting luciferase cDNA from the pGL2 control vector (Promega) into pRC-RSV plasmid (Invitrogen).

Cells and transfections

H1299 and SAOS-2 cells (ATCC) were maintained at 37°C, 5% CO₂ in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal calf serum (FCS). For transfection, cells were seeded at 1.510⁵ cells per multiwell six culture testplate and transfected with 1.5 g of plasmid mixtures pre-incubated for 30 min with 5 l of lipofectamine reagent (Gibco-BRL, Gaithersburg, MD). Selection of drug-resistant colonies was performed as follows: 24 h after transfection, cells were seeded in 10 cm plates, cultured in 400 g/ml G418-containing medium for 2–3 weeks and then colored with fuchsin.

Gene reporter assays

For each transfection, 0.3 g of reporter plasmid was used and, 48 h after transfection, cells were rinsed with phosphate-buffered saline (PBS) and reporter gene assays were carried out. Each experiment was repeated at least three times to calculate the mean and standard deviation.

For the luciferase assay, cells were resuspended in cell lysis buffer (Promega) and incubated for 20 min at room temperature. Samples were centrifuged and the luciferase activity of the cleared supernatant was determined in the presence of luciferin (Promega) and ATP. For the CAT assay, cells were resuspended in 150 l of 0.25 M Tris–HCl pH 8, lysed by freezing three times in dry ice/ethanol, clarified by centrifugation, and the soluble material assayed for CAT activity by incubation for 1 h at 37°C in 0.18 M Tris–HCl pH 8, 0.4 mM acetyl-coenzyme A, 23 M cloramphenicol, D-threo-(dichloroacetyl-1,2-14C) (200 nCi) (Amersham Corp.). CAT activity was quantified by counting the acetylated chloramphenicol forms in an Instantimager (Packard Instruments).

Western blot analysis and antibodies

Cells (10⁶) were collected 24 h after transfection and lysed for 15 min at 4°C with 50 l of RIPA buffer and centrifuged at 15 000 r.p.m. for 15 min. The supernatants were collected, loaded onto 10 or 14% SDS–PAGE gels and blotted onto PVDF membranes (New England Nuclear, Boston, MA). WAF1 and MDM2 were detected with rabbit polyclonal antibodies together with an anti-rabbit, horseradish peroxidase (HRP)-conjugated secondary antibody. p53 WT and p53 pro were detected with DO-1 monoclonal antibody together with an anti-mouse HRP-conjugated secondary antibody. Proteins were visualized by chemiluminescent detection (ECL) (Amersham). DO-1, PAb240 and PAb421 antibodies were purchased from Oncogene Sciences, and anti-LacZ monoclonal antibody from Monosan, The Netherlands.

Flow cytometry

Each experiment was repeated at least three times to calculate the mean and standard deviation for FACS analysis and apoptotic detection. At 48 h after transient transfection, adherent and detached cells were combined. Cells were fixed for 30 min with paraformaldehyde at room temperature, washed twice with PBS (Gibco-BRL), permeabilized for 10 min with PBS, 0.1% Triton X-100, washed twice in PBS, 0.1% Tween-20, incubated for 1 h with PBS, 0.1% Tween-20 and 1 g DO1 (or anti-LacZ), washed twice with PBS, 0.1% Tween-20, incubated for 1 h with GAM–FITC (Immunotech, Marseille, France), washed twice with PBS, 0.1% Tween-20 and incubated for 1 h with 5 g of propidium iodide and 1 mg of boiled RNase (DNase-free) before FACS analysis on a FACS Epics Elite ESP II (Coulter, Miami, FL).

For cell cycle analysis, 30 min prior to harvesting with trypsin-EDTA, 30 M BrdU was added to culture media. After rinsing with PBS, cells were fixed overnight in 1% paraformaldehyde, then incubated at room temperature for 1 h in a pepsin solution (0.15% pepsin, 0.9% NaCl, 1 M HCl, 1% Triton X-100) on a rotisserie. After rinsing three times with PBS, 0.5% Tween-20, cells were incubated with mouse monoclonal anti-BrdU (Becton Dickinson) in PBS, 2% BSA, 0.5% Tween-20 for 1 h, rinsed twice with PBS, 0.5% Tween-20, incubated for 1 h with GAM–DTAF (Immunotech, Marseille, France), rinsed twice and resuspended in 1 ml of PBS containing 1 mg of boiled RNase and 10 g of propidium iodide. A total of 10⁴ cells were then analyzed on a FACS Epics Elite ESP II (Coulter, Miami, FL) for the quantification of S phase and DNA content.

For measurement of ROS production, H1299 cells were transiently transfected with 0.5 g of CD20 and 1 g of p53 WT, p53 pro or D281G expression plasmids, and ROS production was measured by using a method adapted from a previous report (Polyak et al., 1997). Adherent cells were harvested by using PBS-EDTA 1, 16 or 40 h after transfection, and incubated with 10 M carboxymethyl dichlorofluorescein diacetate. Cells were immunostained on ice with anti-CD20 biotin (Coulter) and strepavidin Cy-chrome (Pharmingen). FACS analysis was performed on positive CD20 cells (except for cells analysed for 1 h) and then the mean fluorescence was calculated.

RT–PCR analysis

A total of 10⁶ H1299 cells were transiently transfected with 6 g of empty vector, D281G, p53 pro or p53 WT expression plasmids and, 16 h after transfection, total RNA was extracted with RNA NOW solution (Biogentex). Then 5 g of total RNA was reverse transcribed by using a cDNA synthesis kit (Boehringer Mannheim) and 20% of the cDNA product was subjected to PCR with three different pairs of primers: PIG3 oligonucleotides, 5'-CCGGGGGAGGGTGAAGTC-3'/5'-TCCAGCCATCCGGGTGAGTT-3'; p53 oligonucleotides, 5'-CCATGGCCATCTACAAGCAG-3'/5'-AGGGTGAAATATTCTCC-3'; and -actin oligonucleotides, 5'-GTGGGCCGCCCTAGGCACCA-3'/ 5'-CGGTTGGCCTTAGGGTTCAGGGGGG-3'. Forty percent of the PCR product was loaded on a 1.5% agarose gel.

Gel retardation assays

Duplex substrates were prepared and end-labeled as described (Conseiller et al., 1998) from two complementary oligonucleotides containing: the WAF1 promoter-derived 20mer p53 DNA-binding site (el-Deiry et al., 1992) with 5' BamHI–NotI- and 3' SmaI-compatible ends, 5'-GATCGCGGCCGCGAACATGTCCCAACA-3' and 5'-GGGCAACATGTTGGGACATGTTCGCGGCCGC-3'; the BAX promoter-derived 39mer p53 DNA-binding site site (Miyashita and Reed, 1995) with 5' BamHI–NotI- and 3' SmaI-compatible ends, 5'-GATCGCGGCCGCTCACAAGTTAGAGACAAGCCTGGGCGTGGGCTA
TATTCCC-3' and 5'-GGGAATATAGCCCACGCCCAGGCTTGTCTCTAACTTGTGAGCG
GCCGC-3'; the PIG3 promoter-derived 20mer p53 DNA-binding site (Polyak et al., 1997) with 5' BamHI–NotI- and 3' SmaI-compatible ends, 5'-GATCGCGGCCGCAGCTTGCCCACCC
ATGCTCCAGCTTGCCCACCC
ATGCTCCC-3' and 5'-GGGAGCATGGGTGGGCAAGCTGGAGCATGGGTGGGCAAGCTGC
GGCCGC-3'.

A 25 l reaction volume containing DNA-binding buffer (20 mM Tris–HCl pH 7.5, 0.1 M NaCl, 5 mM MgCl₂, 0.05 mM ZnCl₂, 5 mM dithiothreitol, 0.1 mg/ml BSA, 10% glycerol, 1% IGEPAL, 2 g/ml E-64, 2 g/ml aprotinin, 2 g/ml leupeptin and 2 g/ml pepstatin) was mixed with end-labeled duplex substrate (2.4 nM), 1.2 M AP2 (Promega) as DNA competitor and various amounts of baculovirus-infected Sf9 nuclear extracts or 20 l of cell-free extracts from p53-transfected H1299 cells in the presence or absence of 300 ng of PAb421 monoclonal antibody. After 1 h incubation on ice, reaction products were analyzed by electrophoresis as described (Conseiller et al., 1998). Recombinant baculoviruses for expression of p53 WT, D281G or p53pro were generated by using the Baculogold kit (Pharmingen) after insertion of relevant cDNA into the baculovirus transfer vector pVL1392 (PharMingen). Sf9 nuclear extracts were prepared following a previously described procedure (Delphin et al., 1994) and aliquots were stored in the presence of 5% glycerol at -80°C and used only once. At 24 h after transfection, H1299 cells (210⁶) were lysed on ice in 100 l of DNA-binding buffer for 30 min, centrifuged to remove insoluble material and used immediately.

Microinjection

Cells were plated at 50% density on glass coverslips and allowed to adhere overnight. Before microinjection, HEPES buffer (Sigma cell culture) was added to the medium (40 mM final concentration). p53 expression plasmids at 1 mg/ml were then microinjected into the nuclei of cells using an Eppendorf microinjector and micromanipulator. After 16 or 36 h, cells were fixed in 4% paraformaldehyde for 15 min, washed with PBS, permeabilized with 0.2% Triton X-100 for 10 min and washed again with PBS. Blocking solution (Power Block, BioGenex) was added to cells for 30 min. Cells were incubated with DO-1 (or anti-LacZ) monoclonal antibody for 1 h at room temperature, washed twice with the blocking solution, incubated with rhodamine-conjugated rabbit anti-mouse Fab'2 antibody (Immunotech, Marseille, France) for 1 h at room-temperature, washed twice with the blocking solution, incubated for 1 h at 37°C with the in situ cell death detection kit (Boehringer Mannheim), washed several times and mounted on glass slides with Mowiol before microscopic observation and counting.

We gratefully acknowledge A.Levine and H.Bujard for providing MDR-CAT plasmid and pUHC13-6 plasmid, respectively, as well as B.Vogelstein and K.Polyak for providing WWP-luc and 0.7 kb PIG3 promoter constructs.

Abarzua P, LoSardo JE, Gubler ML and Neri A (1995) Microinjection of monoclonal PAb421 into human SW480 colorectal carcinoma cells restores the transcription activation function to mutant p53. Cancer Res, 55, 3490–3494. | PubMed | ISI | ChemPort |

Allday MJ, Inman GJ, Crawford DH and Farrell PJ (1995) DNA damage in human B cells can induce apoptosis, proceeding from G1/S when p53 is transactivation competent and G2/M when it is transactivation defective. EMBO J, 14, 4994–5005. | PubMed | ISI | ChemPort |

Attardi LD, Lowe SW, Brugarolas J and Jacks T (1996) Transcriptional activation by p53, but not induction of the p21 gene, is essential for oncogene-mediated apoptosis. EMBO J, 15, 3693–3701. | PubMed | ISI | ChemPort |

Balagurumoorthy P, Sakamoto H, Lewis MS, Zambrano N, Clore GM, Gronenborn AM, Appella E and Harrington RE (1995) Four p53 DNA-binding domain peptides bind natural p53-response elements and bend the DNA. Proc Natl Acad Sci USA, 92, 8591–8595. | Article | PubMed | ChemPort |

Bargonetti J, Manfredi JJ, Chen X, Marshak DR and Prives C (1993) A proteolytic fragment from the central region of p53 has marked sequence-specific DNA-binding activity when generated from wild-type but not from oncogenic mutant p53 protein. Genes Dev, 7, 2565–2574. | PubMed | ISI | ChemPort |

Bates S and Vousden KH (1996) p53 in signaling checkpoint arrest or apoptosis. Curr Opin Genet Dev, 6, 8–12.

Brugarolas J, Chandrasekaran C, Gordon JI, Beach D, Jacks T and Hannon GJ (1995) Radiation-induced cell cycle arrest compromised by p21 deficiency. Nature, 377, 552–557. | Article | PubMed | ISI | ChemPort |

Buckbinder L, Talbott R, Velasco-Miguel S, Takenaka I, Faha B, Seizinger BR and Kley N (1995) Induction of the growth inhibitor IGF-binding protein 3 by p53. Nature, 377, 646–649. | Article | PubMed | ISI | ChemPort |

Caelles C, Helmberg A and Karin M (1994) p53-dependent apoptosis in the absence of transcriptional activation of p53-target genes. Nature, 370, 220–223. | Article | PubMed | ISI | ChemPort |

Canman CE, Gilmer TM, Coutts SB and Kastan MB (1995) Growth factor modulation of p53-mediated growth arrest versus apoptosis. Genes Dev, 9, 600–611. | Article | PubMed | ISI | ChemPort |

Chen X, Ko LJ and Prives C (1996) p53 levels, functional domains, and DNA damage determine the extent of the apoptotic response of the tumor cells. Genes Dev, 10, 2438–2451. | Article | PubMed | ISI | ChemPort |

Cho Y, Gorina S, Jeffrey PD and Pavletich NP (1994) Crystal structure of a p53 tumor suppressor–DNA complex: understanding tumorigenic mutations. Science, 265, 346–355. | Article | PubMed | ISI | ChemPort |

Cohen GB, Ren R and Baltimore D (1995) Modular binding domains in signal transduction proteins. Cell, 80, 237–248. | Article | PubMed | ISI | ChemPort |

Conseiller E, Debussche L, Landais L, Venot C, Maratrat M, Sierra V, Tocque B and Bracco L (1998) CTS1: a p53-derived chimeric tumor suppressor gene with enhanced in vitro apoptotic properties. J Clin Invest, 101, 120–127. | PubMed | ISI | ChemPort |

Delphin C, Cahen P, Lawrence JJ and Baudier J (1994) Characterization of baculovirus recombinant wild-type p53. Dimerization of p53 is required for high-affinity DNA binding and cysteine oxidation inhibits p53 DNA binding. Eur J Biochem, 223, 683–692. | Article | PubMed | ISI | ChemPort |

Deng C, Zhang P, Harper JW, Elledge SJ and Leder P (1995) Mice lacking p21CIP1/WAF1 undergo normal development, but are defective in G₁ checkpoint control. Cell, 82, 675–684. | Article | PubMed | ISI | ChemPort |

Deschamps J, Meijlink F and Verma IM (1985) Identification of a transcriptional enhancer element upstream from the proto-oncogene fos. Science, 230, 1174–1177. | PubMed | ISI | ChemPort |

Dittmer D, Pati S, Zambetti G, Chu S, Teresky AK, Moore M, Finlay C and Levine AJ (1993) Gain of function mutations in p53. Nature Genet, 4, 42–46. | Article

Donehower LA and Bradley A (1993) The tumor suppressor p53. Biochim Biophys Acta, 1155, 181–205. | Article | PubMed | ISI | ChemPort |

Dubs-Poterszman MC, Tocqué B and Wasylyk B (1995) MDM2 transformation in the absence of p53 and abgrogation of the p107 G₁ cell-cycle arrest. Oncogene, 11, 2445–2449. | PubMed | ChemPort |

el-Deiry WS, Kern SE, Pietenpol JA, Kinzler KW and Vogelstein B (1992) Definition of a consensus binding site for p53. Nature Genet, 1, 45–49. | Article

el-Deiry WS et al. (1993) WAF1, a potential mediator of p53 tumor suppression. Cell, 75, 817–825. | Article | PubMed | ChemPort |

el-Deiry WS et al. (1994) WAF1/CIP1 is induced in p53-mediated G₁ arrest and apoptosis. Cancer Res, 54, 1169–1174. | PubMed | ChemPort |

Friedlander P, Haupt Y, Prives C and Oren M (1996a) A mutant p53 that discriminates between p53-responsive genes cannot induce apoptosis. Mol Cell Biol, 16, 4961–4971. | PubMed | ISI | ChemPort |

Friedlander P, Legros Y, Soussi T and Prives C (1996b) Regulation of mutant p53 temperature-sensitive DNA binding. J Biol Chem, 271, 25468–25478. | Article | PubMed | ISI | ChemPort |

Fuchs EJ, McKenna KA and Bedi A (1997) p53-dependent DNA damage-induced apoptosis requires Fas/APO-1-independent activation of CPP32beta. Cancer Res, 57, 2550–2554. | PubMed | ISI | ChemPort |

Funk WD, Pak DT, Karas RH, Wright WE and Shay JW (1992) A transcriptionally active DNA-binding site for human p53 protein complexes. Mol Cell Biol, 12, 2866–2871. | PubMed | ISI | ChemPort |

Ginsberg D, Mechta F, Yaniv M and Oren M (1991) Wild-type p53 can down-modulate the activity of various promoters. Proc Natl Acad Sci USA, 88, 9979–9983. | Article | PubMed | ChemPort |

Gossen M and Bujard H (1992) Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA, 89, 5547–5551. | Article | PubMed | ChemPort |

Gottlieb E and Oren M (1996) p53 in growth control and neoplasia. Biochim Biophys Acta, 1287, 77–102. | Article | PubMed | ISI | ChemPort |

Hansen R and Oren M (1997) p53; from inductive signal to cellular effect. Curr Opin Genet Dev, 7, 46–51. | Article | PubMed | ISI | ChemPort |

Harper JW, Adami GR, Wei N, Keyomarsi K and Elledge SJ (1993) The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell, 75, 805–816. | Article | PubMed | ISI | ChemPort |

Haupt Y, Rowan S, Shaulian E, Vousden KH and Oren M (1995) Induction of apoptosis in HeLa cells by trans-activation-deficient p53. Genes Dev, 9, 2170–2183. | Article | PubMed | ISI | ChemPort |

Haupt Y, Barak Y and Oren M (1996) Cell type-specific inhibition of p53-mediated apoptosis by mdm2. EMBO J, 15, 1596–1606. | PubMed | ISI | ChemPort |

Hollstein M, Sidransky D, Vogelstein B and Harris CC (1991) p53 mutations in human cancers. Science, 253, 49–53. | Article | PubMed | ISI | ChemPort |

Hollstein M et al. (1994) Database of p53 gene somatic mutations in human tumors and cell lines. Nucleic Acids Res, 22, 3551–3555. | PubMed | ISI | ChemPort |

Hupp TR, Meek DW, Midgley CA and Lane DP (1992) Regulation of the specific DNA binding function of p53. Cell, 71, 875–886. | Article | PubMed | ISI | ChemPort |

Hupp TR, Sparks A and Lane DP (1995) Small peptides activate the latent sequence-specific DNA binding function of p53. Cell, 83, 237–245. | Article | PubMed | ISI | ChemPort |

Israeli D, Tessler E, Haupt Y, Elkeles A, Wilder S, Amson R, Telerman A and Oren M (1997) A novel p53-inducible gene, PAG608, encodes a nuclear zinc finger protein whose overexpression promotes apoptosis. EMBO J, 16, 4384–4392. | Article | PubMed | ISI | ChemPort |

Jackson P, Bos E and Braithwaite AW (1993) Wild-type mouse p53 down-regulates transcription from different virus enhancer/promoters. Oncogene, 8, 589–597. | PubMed | ISI | ChemPort |

Juven T, Barak Y, Zauberman A, George DL and Oren M (1993) Wild type p53 can mediate sequence-specific transactivation of an internal promoter within the mdm2 gene. Oncogene, 8, 3411–3416. | PubMed | ISI | ChemPort |

Kley N, Chung RY, Fay S, Loeffler JP and Seizinger BR (1992) Repression of the basal c-fos promoter by wild-type p53. Nucleic Acids Res, 20, 4083–4087. | Article | PubMed | ISI | ChemPort |

Knudson CM, Tung KS, Tourtellotte WG, Brown GA and Korsmeyer SJ (1995) Bax-deficient mice with lymphoid hyperplasia and male germ cell death. Science, 270, 96–99. | Article | PubMed | ISI | ChemPort |

Ko LJ and Prives C (1996) p53: puzzle and paradigm. Genes Dev, 10, 1054–1072. | Article | PubMed | ISI | ChemPort |

Levine AJ (1997) p53, the cellular gatekeeper for growth and division. Cell, 88, 323–331. | Article | PubMed | ISI | ChemPort |

Lohrum M and Scheidtmann KH (1996) Differential effects of phosphorylation of rat p53 on transactivation of promoters derived from different p53 responsive genes. Oncogene, 13, 2527–2539. | PubMed | ISI | ChemPort |

Lu H and Levine AJ (1995) Human TAFII31 protein is a transcriptional coactivator of the p53 protein. Proc Natl Acad Sci USA, 92, 5154–5158. | Article | PubMed | ChemPort |

Ludwig RL, Bates S and Vousden KH (1996) Differential activation of target cellular promoters by p53 mutants with impaired apoptotic function. Mol Cell Biol, 16, 4952–4960. | PubMed | ISI | ChemPort |

Mack DH, Vartikar J, Pipas JM and Laimins LA (1993) Specific repression of TATA-mediated but not initiator-mediated transcription by wild-type p53. Nature, 363, 281–283. | Article | PubMed | ISI | ChemPort |

Maheswaran S, Englert C, Bennett P, Heinrich G and Haber DA (1995) The WT1 gene product stabilizes p53 and inhibits p53-mediated apoptosis. Genes Dev, 9, 2143–2156. | Article | PubMed | ISI | ChemPort |

Miyashita T and Reed JC (1995) Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell, 80, 293–299. | Article | PubMed | ISI | ChemPort |

Murphy M, Hinman A and Levine AJ (1996) Wild-type p53 negatively regulates the expression of a microtubule-associated protein. Genes Dev, 10, 2971–2980. | Article | PubMed | ISI | ChemPort |

Nemani M et al. (1996) Activation of the human homologue of the Drosophila sina gene in apoptosis and tumor suppression. Proc Natl Acad Sci USA, 93, 9039–9042. | Article | PubMed | ChemPort |

Owen-Schaub LB et al. (1995) Wild-type human p53 and a temperature-sensitive mutant induce Fas/APO-1 expression. Mol Cell Biol, 15, 3032–3040. | PubMed | ChemPort |

Parker F, Maurier F, Delumeau I, Duchesne M, Faucher D, Debussche L, Dugue A, Schweighoffer F and Tocque B (1996) A Ras-GTPase-activating protein SH3-domain-binding protein. Mol Cell Biol, 16, 2561–2569. | PubMed | ISI | ChemPort |

Pavletich NP, Chambers KA and Pabo CO (1993) The DNA-binding domain of p53 contains the four conserved regions and the major mutation hot spots. Genes Dev, 7, 2556–2564. | Article | PubMed | ISI | ChemPort |

Pawson T (1995) Protein modules and signalling networks. Nature, 373, 573–580. | Article | PubMed | ISI | ChemPort |

Polyak K, Waldman T, He TC, Kinzler KW and Vogelstein B (1996) Genetic determinants of p53-induced apoptosis and growth arrest. Genes Dev, 10, 1945–1952. | Article | PubMed | ISI | ChemPort |

Polyak K, Xia Y, Zweier JL, Kinzler KW and Vogelstein B (1997) A model for p53-induced apoptosis. Nature, 389, 300–305. | Article | PubMed | ISI | ChemPort |

Roemer K and Mueller-Lantzsch N (1996) p53 transactivation domain mutant Q22, S23 is impaired for repression of promoters and mediation of apoptosis. Oncogene, 12, 2069–2079. | PubMed | ISI | ChemPort |

Rowan S, Ludwig RL, Haupt Y, Bates S, Lu X, Oren M and Vousden KH (1996) Specific loss of apoptotic but not cell-cycle arrest function in a human tumor derived p53 mutant. EMBO J, 15, 827–838. | PubMed | ISI | ChemPort |

Ruaro EM, Collavin L, DelSal G, Haffner R, Oren M, Levine AJ and Schneider C (1997) A proline-rich motif in p53 is required for transactivation-independent growth arrest as induced by Gas1. Proc Natl Acad Sci USA, 94, 4675–4680. | Article | PubMed | ChemPort |

Sabbatini P, Chiou SK, Rao L and White E (1995a) Modulation of p53-mediated transcriptional repression and apoptosis by the adenovirus E1B 19K protein. Mol Cell Biol, 15, 1060–1070. | PubMed | ISI | ChemPort |

Sabbatini P, Lin J, Levine AJ and White E (1995b) Essential role for p53-mediated transcription in E1A-induced apoptosis. Genes Dev, 9, 2184–2192. | Article | PubMed | ISI | ChemPort |

Sakamuro D, Sabbatini P, White E and Prendergast GC (1997) The polyproline region of p53 is required to activate apoptosis but not growth arrest. Oncogene, 15, 887–898. | Article | PubMed | ISI | ChemPort |

Seto E, Usheva A, Zambetti GP, Momand J, Horikoshi N, Weinmann R, Levine AJ and Shenk T (1992) Wild-type p53 binds to the TATA-binding protein and represses transcription. Proc Natl Acad Sci USA, 89, 12028–12032. | Article | PubMed | ChemPort |

Shen Y and Shenk T (1994) Relief of p53-mediated transcriptional repression by the adenovirus E1B 19-kDa protein or the cellular Bcl-2 protein. Proc Natl Acad Sci USA, 91, 8940–8944. | Article | PubMed | ChemPort |

Subler MA, Martin DW and Deb S (1994) Overlapping domains on the p53 protein regulate its transcriptional activation and repression functions. Oncogene, 9, 1351–1359. | PubMed | ISI | ChemPort |

Thut CJ, Chen JL, Klemm R and Tjian R (1995) p53 transcriptional activation mediated by coactivators TAFII40 and TAFII60. Science, 267, 100–104. | Article | PubMed | ISI | ChemPort |

Wagner AJ, Kokontis JM and Hay N (1994) Myc-mediated apoptosis requires wild-type p53 in a manner independent of cell cycle arrest and the ability of p53 to induce p21waf1/cip1. Genes Dev, 8, 2817–2830. | Article | PubMed | ISI | ChemPort |

Waldman T, Kinzler KW and Vogelstein B (1995) p21 is necessary for the p53-mediated G₁ arrest in human cancer cells. Cancer Res, 55, 5187–5190. | PubMed | ISI | ChemPort |

Walker KK and Levine AJ (1996) Identification of a novel p53 functional domain that is necessary for efficient growth suppression. Proc Natl Acad Sci USA, 93, 15335–15340. | Article | PubMed | ChemPort |

Wang Y and Prives C (1995) Increased and altered DNA binding of human p53 by S and G2/M but not G₁ cyclin-dependent kinases. Nature, 376, 88–91. | Article | PubMed | ISI | ChemPort |

Wolkowicz R, Elkind NB, Ronen D and Rotter V (1995) The DNA binding activity of wild type p53 is modulated by blocking its various antigenic epitopes. Oncogene, 10, 1167–1174. | PubMed | ISI | ChemPort |

Wu GS et al. (1997) Killer/DR5 is a DNA damage-inducible p53-regulated death receptor gene. Nature Genet, 17, 141–143. | Article

Wu GS, Saftig P, Peters C and El-Deiry WS (1998) Potential role for cathepsin D in p53-dependent tumor suppression and chemosensitivity. Oncogene, 16, 2177–2184. | Article | PubMed | ISI | ChemPort |

Xiong Y, Hannon GJ, Zhang H, Casso D, Kobayashi R and Beach D (1993) p21 is a universal inhibitor of cyclin kinases. Nature, 366, 701–704. | Article | PubMed | ISI | ChemPort |

Yonish-Rouach E, Borde J, Gotteland M, Mishal Z, Viron A and May E (1994) Induction of apoptosis by transiently transfected metabolically stable wt p53 transformed cell lines. Cell Death Differ, 1, 39–47.

Yonish-Rouach E, Deguin V, Zaitchouk T, Breugnot C, Mishal Z, Jenkins JR and May E (1995) Transcriptional activation plays a role in the induction of apoptosis by transiently transfected wild-type p53. Oncogene, 11, 2197–2205. | PubMed | ChemPort |

Yu H, Chen JK, Feng S, Dalgarno DC, Brauer AW and Schreiber SL (1994) Structural basis for the binding of proline-rich peptides to SH3 domains. Cell, 76, 933–945. | Article | PubMed | ISI | ChemPort |

Zambetti GP and Levine AJ (1993) A comparison of the biological activities of wild-type and mutant p53. FASEB J, 7, 855–865. | PubMed | ISI | ChemPort |

Main navigation

• Search EMBO Journal

  Search

• Advanced search

• The EMBO Journal

  • Home
  • Aims and scope
  • Current issue
  • Advance online publication
  • Web focuses
  • Archive:
  • Browse by issue
  • Browse by subject
  • Browse by category
  • Free online sample issue
  • Press releases

• Authors and Referees

  • Editorial process
  • Guide for authors
  • Submit an article
  • Guide for referees
  • Editors and Editorial Board
  • Contact editorial office

• Customer Service

  • Subscribe
  • Order sample copy
  • Purchase articles
  • Reprints and permissions
  • Contact NPG
  • Advertising