Article

• The EMBO Journal (1997) 16, 6947 - 6955
• doi:10.1093/emboj/16.23.6947

A novel outer membrane lipoprotein, LolB (HemM), involved in the LolA (p20)-dependent localization of lipoproteins to the outer membrane of Escherichia coli

Shin-ichi Matsuyama¹, Naoko Yokota¹ and Hajime Tokuda¹

1. Institute of Molecular and Cellular Biosciences, University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113, Japan

Correspondence to:

Hajime Tokuda, E-mail: atokuda@hongo.ecc.u-tokyo.ac.jp

Received 13 August 1997; Revised 16 September 1997

• Keywords:

  • Escherichia coli,
  • lipoprotein,
  • LolA (p20),
  • LolB (HemM),
  • outer membrane

Introduction

Lipid-modified proteins are present in cells of organisms from bacteria to eukaryotes. Lipoproteins in bacteria (Pugsley, 1993) and small GTP-binding proteins such as Rab (Simons and Zerial, 1993) in eukaryotes have been studied extensively with respect to post-translational modification pathways, physiological importance and membrane targeting mechanisms. Cysteine residues at the N-terminus of lipoproteins and in the C-terminal region of Rab are modified with lipid, which functions as an anchor to the target membranes. The mislocalization of lipoprotein is lethal for Escherichia coli (Yakushi et al., 1997), and correct membrane targeting of Rab is thought to be critical for vesicular transport (Simons and Zerial, 1993).

More than 10 species of lipoproteins have so far been reported in E.coli (Hayashi and Wu, 1990). Some of them are localized exclusively in the outer membrane whereas others are specific to the inner membrane. Irrespective of the final localization, each lipoprotein is synthesized as a precursor with a signal peptide at the N-terminus and then translocated across the cytoplasmic (inner) membrane through a protein translocation machinery (Pugsley, 1993). Lipid modification and processing to mature lipoprotein take place in the inner membrane. Lipoprotein-specific signal peptidase II, which is sensitive to globomycin, cleaves the signal peptide after the cysteine residue has been modified with diglyceride (Hussain et al., 1980; Tokunaga et al., 1982; Sankaran and Wu, 1994). Further fatty acylation of the cysteine residue then takes place to complete the processing.

The membrane specificity of lipoprotein localization is determined by the residue next to the modified cysteine residue (Yamaguchi et al., 1988). Lipoproteins possessing aspartic acid at this position are localized in the inner membrane, whereas those possessing amino acids other than aspartic acid are destined for the outer membrane. We previously reported the discovery of a periplasmic factor which recognizes the lipoprotein sorting signal (Matsuyama et al., 1995). This protein (p20) is encoded by a gene located at 20.4 min on the E.coli chromosome. The gene was named lplA, but we later found that lplA had been used for the lipoate–protein ligase gene, which is located at 99.6 min on the linkage map (Morris et al., 1994). Since the p20 homolog of Haemophilus influenzae was named lolA (SWISS PROT; P45263), the gene encoding p20 of E.coli has been renamed lolA.

When lipoprotein possessing either the outer or inner membrane sorting signal was expressed in spheroplasts in the presence and absence of purified LolA, the outer membrane-directed lipoprotein was released into the spheroplast medium in a LolA-dependent manner (Matsuyama et al., 1995). On the other hand, the inner membrane-directed lipoprotein remained in the inner membrane of spheroplasts regardless of the presence or absence of LolA. The major outer membrane lipoprotein (Lpp) released into the spheroplast medium was found to exist in a 1:1 complex with LolA. These results indicated that the LolA-dependent release of the outer membrane-directed lipoprotein is a critical step in lipoprotein sorting. Furthermore, when the Lpp–LolA complex was incubated with the inner and outer membranes, Lpp was incorporated specifically into the outer membrane. The incorporated Lpp exists as a trimer, as does in vivo incorporated Lpp (Choi et al., 1986). Since both the inner leaflet of the outer membrane and the outer leaflet of the inner membrane consist of phospholipids, the outer membrane-specific incorporation of Lpp strongly suggested the presence of an outer membrane factor involved in the Lpp incorporation.

We report here the discovery of a novel outer membrane lipoprotein, LolB, which is a receptor for the Lpp–LolA complex and plays an essential role in the outer membrane-specific incorporation of Lpp. Thus, two factors, LolA and LolB, functioning in the release and incorporation of lipoproteins, respectively, have now been characterized. LolB was found to be the product of hemM, which has been suggested to be important for 5-aminolevulinic acid synthesis (Ikemi et al., 1992). However, the results shown here indicate that this is highly unlikely.

Involvement of an outer membrane protein in the localization of Lpp to the outer membrane

The outer membrane, digested or not digested with trypsin, was incubated with [³⁵S]Lpp, which had been labeled in spheroplasts and released into the spheroplast medium as a complex with LolA (Matsuyama et al., 1995), and then precipitated by centrifugation. Almost all Lpp molecules were recovered in the precipitate after 20 min incubation with the trypsin-undigested outer membrane (Figure 1). The trypsin digestion strongly inhibited the Lpp incorporation into the outer membrane, indicating that a proteinaceous factor in the outer membrane participates in the incorporation of Lpp.

Figure 1.

Inhibition of the outer membrane incorporation of Lpp by trypsin. (A) The outer membrane (400 g) prepared from Q13 was treated with trypsin (50 g/ml) in 400 l of 50 mM K phosphate (pH 7.5) with or without 45 l of 1 mg/ml soybean trypsin inhibitor at 4°C for 30 min. The same amount of soybean trypsin inhibitor was added to the samples which had been trypsin treated without soybean trypsin inhibitor. Incubation was continued for a further 5 min. The outer membrane was recovered by centrifugation at 100 000 g for 30 min and resuspended in 40 l of 50 mM K phosphate (pH 7.5) containing 100 g/ml soybean trypsin inhibitor. The spheroplast medium (1.2 ml) containing the [³⁵S]Lpp–LolA complex was incubated with 24 l of the outer membrane at 30°C. Aliquots (200 l) were removed at the indicated times and treated with 6 M urea at 4°C to terminate the incorporation reaction. After centrifugation at 200 000 g for 30 min, the precipitates were analyzed by SDS–PAGE, followed by fluorography. The amount of the input Lpp is shown in the right lane. (B) The amount of Lpp incorporated into the outer membrane was determined by densitometrically scanning the fluorogram in (A) and plotted by taking the amount of the input Lpp as 100%. Open and closed circles represent samples treated with trypsin in the absence and presence of soybean trypsin inhibitor, respectively.

View full figure (58 KB)

When the [³⁵S]Lpp–LolA complex was incubated with proteoliposomes reconstituted from E.coli phospholipids and solubilized outer membrane proteins, Lpp was recovered with the reconstituted proteoliposomes on centrifugation (Figure 2). On the other hand, when outer membrane proteins were not reconstituted, Lpp remained in the supernatant. To purify the factor, outer membrane proteins solubilized with 2% octylglucoside were subjected to anion-exchange column chromatography. Proteoliposomes reconstituted with the flow-through fraction from this chromatography were found to contain Lpp incorporation activity (data not shown). This fraction was fractionated further by cation-exchange column chromatography (Figure 3A). The proteins in each fraction were analyzed by SDS–PAGE (Figure 3B), and then reconstituted into proteoliposomes. [³⁵S]Lpp was incorporated into proteoliposomes when the eluates after fraction 17 were used for the reconstitution (Figure 3C). The elution profile of the incorporation activity coincided with that of a 23 kDa protein band (Figure 3B). This protein, designated LolB, was characterized further as a candidate for the outer membrane factor involved in Lpp incorporation.

Figure 2.

Solubilization and reconstitution of the Lpp incorporation activity. Proteoliposomes were reconstituted with solubilized outer membrane proteins as described in Materials and methods. The spheroplast medium (200 l) containing the [³⁵S]Lpp–LolA complex was incubated with 50 l of proteoliposomes (right two lanes) or liposomes containing no protein (left two lanes) at 30°C for 30 min, and then the reaction mixture was fractionated into the supernatant (sup) and precipitate (ppt) by centrifugation at 200 000 g for 1 h. Samples were analyzed by SDS–PAGE and fluorography. The position of Lpp is indicated.

View full figure (26 KB)

Figure 3.

Identification of an outer membrane protein involved in the incorporation of Lpp. (A) Solubilized outer membrane fractions, which passed through a MonoQ column and contained the Lpp incorporation activity, were fractionated further on a MonoS column as described in Materials and methods. The column was developed with a linear gradient of NaCl. Fractions of 2 ml were collected and the absorbance at 280 nm was recorded. (B) The indicated fractions in (A) were analyzed by SDS–PAGE followed by staining with Coomassie brilliant blue. The position of a 23 kDa protein is indicated. The positions of molecular weight marker proteins are shown on the right. (C) Proteoliposomes reconstituted from aliquots (80 l) of the indicated fractions were incubated with the spheroplast medium containing the [³⁵S]Lpp–LolA complex at 30°C for 30 min. Proteoliposomes were recovered by centrifugation at 200 000 g for 1 h, and then analyzed by SDS–PAGE and fluorography.

View full figure (76 KB)

LolB is the product of hemM and possesses Lpp incorporation activity

Amino acid sequencing of LolB was unsuccessful, suggesting the modification of its N-terminus. We therefore digested LolB with a limited amount of V8 protease and obtained two peptide fragments. The N-terminal sequences of these fragments coincided with partial sequences of HemM (Figure 4A), which has been suggested to be involved in the synthesis of 5-aminolevulinic acid, an intermediate of porphyrin biosynthesis (Ikemi et al., 1992).

Figure 4.

Characterization of HemM (LolB) as the Lpp incorporation factor. (A) The amino acid sequence deduced from the nucleotide sequence of the hemM gene (Ikemi et al., 1992) is shown. The amino acid sequences determined with proteolytic fragments of LolB are underlined. A possible signal peptide is boxed by a dotted line. A sequence similar to the lipoprotein box is indicated by a solid lined box, below which the consensus sequence is shown. Charged residues in the signal peptide are also indicated. (B) The hemM gene was overexpressed, and its product, LolB (HemM), was purified as described in Materials and methods. Fractions containing LolB at each purification step were analyzed by SDS–PAGE, followed by staining with Coomassie brilliant blue. The samples analyzed were: whole cell (lane 1), total membrane (lane 2), outer membrane (lane 3), MonoQ fraction (lane 4) and MonoS fraction (lane 5). The migration positions of the molecular weight marker proteins are indicated on the left. The position of LolB is also indicated. (C) An antibody was raised against highly purified LolB as described in Materials and methods. The in vitro incorporation of Lpp into the outer membrane prepared from MC4100 was examined with the [³⁵S]Lpp–LolA complex in the presence of various amounts of the anti-LolB () or anti-OmpA () IgGs. The Lpp incorporation was analyzed by fluorography (inset) as described in the legend to Figure 1, and the results were plotted as a function of the IgG concentration, taking the amount of Lpp incorporated in the absence of an IgG as 100%. (D) Proteoliposomes reconstituted with various amounts of purified LolB () or solubilized outer membrane proteins () were incubated with the [³⁵S]Lpp–LolA complex at 30°C for 30 min. The Lpp incorporation into the proteoliposomes was analyzed by fluorography as described in the legend to Figure 2. The amount of incorporated Lpp was expressed as a function of the LolB content in the reconstituted proteoliposomes, taking the maximum value as 100%.

View full figure (100 KB)

To determine whether or not the hemM gene encodes LolB, we constructed pMAN650, which carries hemM under the control of the tac promoter–lac operator, and lacI^q. When the hemM gene was overexpressed in E.coli JM83 harboring pMAN650, on addition of isopropyl--D-thiogalactopyranoside (IPTG) a 23 kDa protein was overproduced. This protein was purified to homogeneity (Figure 4B) and used to raise an antibody. In vitro Lpp incorporation into the outer membrane was then examined in the presence of this antibody or an anti-OmpA antibody (Figure 4C). The antibody raised against the hemM gene product, but not the anti-OmpA antibody, strongly inhibited the Lpp incorporation, indicating that LolB involved in the Lpp incorporation is a product of hemM. Furthermore, when proteoliposomes reconstituted from various amounts of purified LolB were used for the in vitro Lpp incorporation, the amount of Lpp incorporated into proteoliposomes increased with an increase in the amount of reconstituted LolB (Figure 4D). Proteoliposomes were also reconstituted with solubilized outer membrane proteins. The amounts of Lpp incorporated into these proteoliposomes were plotted as a function of the amount of reconstituted LolB, which was determined by quantitative immunoblotting (Figure 4D). LolB, whether it was purified or not, exhibited essentially the same incorporation activity, indicating that only LolB among the outer membrane proteins is important for the Lpp incorporation.

LolB is a novel outer membrane lipoprotein

HemM has been assumed to function in the cytosol (Ikemi et al., 1992), whereas LolB was purified from the solubilized outer membrane proteins. The subcellular localization of LolB was examined by means of immunoblotting with the anti-LolB antibody (Figure 5A). LolB (HemM) was localized exclusively in the outer membrane, suggesting that LolB is a secretory protein synthesized as a precursor with a signal peptide at its N-terminus and then processed to the mature form. Indeed, we found a possible signal peptide in the deduced amino acid sequence of HemM (Figure 4A). Moreover, the lipoprotein box, a consensus sequence around the signal peptide cleavage site of lipoproteins (Hayashi and Wu, 1990), was found (Figure 4A).

Figure 5.

LolB is a novel outer membrane lipoprotein. (A) MC4100 cells (WC) were disrupted by sonication, and then fractionated into soluble (CP) and total membrane (TM) fractions. The total membrane fraction was subjected to sucrose density gradient centrifugation to separate the inner (IM) and outer (OM) membranes. An equivalent amount of each fraction was analyzed by SDS–PAGE, followed by immunoblotting with the anti-LolB antibody. (B) IQ85 (secYts) harboring pMAN650 and IQ86 (wild-type) harboring pMAN650 were grown at 30°C to 210⁸ cells/ml in M63 minimal medium supplemented with 10 g/ml thiamine, 2% glycerol and 20 g/ml each of 18 amino acids other than methionine and cysteine. Prior to labeling, the culture was incubated at 41°C for 2 h. After incubation with 1 mM IPTG for 5 min, 1 ml of culture was labeled with 10 Ci of Tran³⁵S-label (1000 Ci/mmol) at 41°C for 1 min in the presence (+) or absence (-) of globomycin (GLM), and then chased for 1 min. Samples were immunoprecipitated with the anti-LolB, anti-OmpA and anti-Lpp antibodies, and then analyzed by SDS–PAGE and fluorography as described previously (Matsuyama et al., 1995). The mature (m), precursor (p) and modified precursor (mp) forms are indicated. (C) IQ86 harboring pMAN650 was grown at 37°C in M63 minimal medium in the presence (lanes 2–4) or absence (lane 1) of IPTG for 5 min. Each culture (5 ml) was labeled with 50 Ci of [9,10 (n)-³H]palmitic acid (60 Ci/mmol, Amersham) for 30 min (lanes 1–3) or with Tran³⁵S-label at 37°C for 2 min (lane 4). The labeled cells were analyzed by SDS–PAGE and fluorography (lanes 1 and 2). The samples in lanes 3 and 4 were analyzed after immunoprecipitation of solubilized cellular proteins with the anti-LolB antibody. The positions of LolB, Lpp and lipopolysaccharide (LPS) are indicated.

View full figure (39 KB)

To examine the processing of LolB, E.coli IQ85 (secYts) and its parental strain, IQ86, were transformed with pMAN650 carrying the tac–lolB gene, and then labeled with Tran³⁵S-label in the presence of IPTG at 41°C, a non-permissive temperature for IQ85. The precursor form of LolB, as well as those of OmpA and Lpp, was accumulated in IQ85 (Figure 5B, lane 1), indicating that LolB is a secretory protein possessing a signal peptide. When the labeling of IQ86 was carried out in the presence of globomycin (Hussain et al., 1980), a specific inhibitor of signal peptidase II, a protein band migrating slightly more slowly than that of the LolB precursor in IQ85 was detected, as in the case of Lpp (Figure 5B, lane 3). These bands most probably represent precursor proteins modified with fatty acids (Hussain et al., 1980). In contrast, the processing of proOmpA catalyzed by signal peptidase I (Date and Wickner, 1981) was insensitive to globomycin. Furthermore, when IQ86 was labeled with [³H]palmitic acid, IPTG-dependent incorporation of palmitic acid into the 23 kDa band was observed (Figure 5C, lanes 1 and 2). This material was immunoprecipitated with the anti-LolB antibody (Figure 5C, lane 3), and migrated to the same position as ³⁵S-labeled LolB (Figure 5C, lane 4). Taking all the results together, we concluded that LolB is a novel outer membrane lipoprotein. Furthermore, these results also indicate that the involvement of HemM in 5-aminolevulinic acid synthesis is unlikely or, at most, indirect.

Depletion of LolB is lethal for E.coli

To determine the in vivo role of LolB, a mutant strain, SM602, in which the lolB gene on the chromosome is placed under the control of the lac promoter–operator, was constructed. The lolB (hemM) gene and the immediately downstream gene (orf2) constitute an operon, and the disruption of either gene was reported to be unsuccessful (Post et al., 1993). To render the expression of orf2 independent of IPTG, pMAN655 carrying the P_BAD-orf2 gene was constructed and transformed into SM602. When SM602 harboring pMAN655 was grown in the presence of IPTG and then transferred to fresh medium without IPTG, growth of the cells was soon arrested (Figure 6A). Arabinose was always present for expression of orf2, which has been reported to be essential (Post et al., 1993). Immunoblotting with the anti-LolB antibody revealed that LolB was undetectable in the cells when growth was arrested (data not shown). These results indicate that lolB is an essential gene for E.coli.

Figure 6.

Effects of LolB depletion on growth and in vitro membrane incorporation of Lpp. (A) SM602 harboring pMAN655 was grown in L-broth supplemented with 0.05% L-arabinose and 1 mM IPTG at 37°C. At time zero, the cells were washed twice with L-broth, and then transferred to fresh medium containing arabinose with or without IPTG. Growth was followed by monitoring the optical density at 660 nm. (B) The cells were harvested from a portion of the 2 h culture shown in (A) and used to prepare total membrane fractions containing or not containing LolB. The specified amounts of the total membrane fractions were incubated with the [³⁵S]Lpp–LolA complex at 30°C for 30 min. The Lpp incorporation was analyzed by fluorography. (C) The amount of Lpp incorporated was expressed as a function of the amount of membrane, taking the maximum value as 100%.

View full figure (49 KB)

The membrane fractions prepared from the mutant grown in the presence and absence of IPTG were used to examine the in vitro incorporation of Lpp. The LolB depletion significantly inhibited the incorporation of Lpp into the membrane (Figure 6B and C). The outer membrane lipoproteins Pal and NlpB also required LolB for incorporation into the membrane (data not shown), suggesting that the localization of outer membrane lipoproteins generally requires LolB.

Molecular interaction between the Lpp–LolA complex and LolB

The results mentioned above indicate that Lpp released into the periplasm on formation of the complex with LolA is incorporated into the outer membrane upon interaction with LolB, which exists in the outer membrane. Our attempt to analyze the interaction between LolB and the Lpp–LolA complex in the presence of octylglucoside, which was added to solubilize LolB, was unsuccessful since the Lpp–LolA complex was unstable in octylglucoside (data not shown). We therefore engineered the lolB gene to obtain a water-soluble LolB derivative by replacing the N-terminal cysteine of the mature region with alanine and the signal peptide with that of OmpF. The N-terminal cysteine residue is essential for the fatty acid modification of lipoproteins (Braun, 1975). When a LolB derivative, named mLolB, was overproduced, mature mLolB was found in the periplasm in a soluble form. Furthermore, size exclusion chromatography revealed that mLolB exists as a monomer (data not shown). The overproduction only slightly inhibited growth. The mLolB protein was partially purified and used to examine the interaction with the Lpp–LolA complex.

The non-radioactive Lpp–LolA complex was formed by incubating spheroplasts with a large amount of LolA. The spheroplast medium containing the Lpp–LolA complex was then incubated with or without a near equimolar amount of mLolB at 37°C. The reaction mixture was then subjected to immunoprecipitation with the anti-Lpp antibody, and the precipitate was analyzed by SDS–PAGE, followed by immunoblotting with the anti-Lpp, anti-LolA and anti-LolB antibodies (Figure 7). When the Lpp–LolA complex incubated without mLolB was immunoprecipitated with the anti-Lpp antibody, LolA and Lpp were co-immunoprecipitated (lane 1). The mLolB protein alone was not precipitated with the anti-Lpp antibody (lane 2). In marked contrast, when the Lpp–LolA complex was incubated with mLolB, the anti-Lpp antibody co-immunoprecipitated mLolB instead of LolA (lane 3). These results indicate that Lpp is transferred from LolA to mLolB, and thus forms a Lpp–mLolB complex. Since the overproduction of mLolB only slightly inhibited growth, the affinity of mLolB for Lpp seems to be lower than that of intact LolB.

Figure 7.

Transfer of Lpp from LolA to LolB. Spheroplasts of MC4100 cells (210⁹) were incubated in 1.8 ml of L-broth containing 180 g of LolA and 0.25 M sucrose at 30°C for 1 h. The spheroplast medium (600 l) containing the non-radioactive Lpp–LolA complex was obtained by centrifugation and incubated with 600 l of 100 g/ml of the partially purified mLolB in 25 mM Tris–HCl (pH 8.0), 0.25 M sucrose at 37°C for 45 min. After centrifugation at 16 000 g for 5 min, the supernatant was incubated at room temperature for 1.5 h with 100 g of the anti-Lpp IgG, which had been purified on a protein A–Sepharose column, and then centrifuged at 100 000 g for 10 min. The supernatant was mixed with protein A–Sepharose resin and then stirred for 30 min. The resin was collected, washed alternately with 25 mM Tris–HCl (pH 8.0) and 25 mM Tris–HCl (pH 8.0), 0.5 M NaCl several times, and then treated with the sample buffer for SDS–PAGE at 100°C. Samples were analyzed by SDS–PAGE and immunoblotting. The blot was divided into three parts, with visualization with the anti-Lpp, anti-LolA and anti-LolB antibodies, respectively.

View full figure (28 KB)

We showed in a previous study that LolA functions as a periplasmic carrier protein for lipoproteins possessing the outer membrane sorting signal (Matsuyama et al., 1995). LolA releases the outer membrane lipoproteins from the inner membrane by forming a soluble complex and then carries them to the outer membrane, where their incorporation takes place. In this study, we investigated the determinant for the outer membrane-specific incorporation of lipoproteins, and found that LolB, a new outer membrane lipoprotein, plays a critical role in the lipoprotein incorporation. The following evidence supports our conclusion: (i) the anti-LolB antibody inhibited the outer membrane incorporation of Lpp; (ii) Lpp was incorporated into proteoliposomes reconstituted from purified LolB and phospholipids; and (iii) the LolB-deficient outer membrane did not exhibit incorporation activity.

Lipopolysaccharide (LPS) is localized in the outer leaflet of the outer membrane, and plays an important role in the assembly of outer membrane proteins such as OmpF, LamB and PhoE (Mizushima, 1987). When we purified LolB from the solubilized outer membrane fraction, we found that LPS was adsorbed to a MonoQ column whereas LolB was not. Consequently, the purified LolB fraction used for the reconstitution experiment did not contain LPS. Therefore, LPS plays little part in the incorporation of outer membrane lipoproteins.

How does LolB mediate the outer membrane localization of lipoproteins? We observed Lpp–mLolB complex formation after incubation of the Lpp–LolA complex with mLolB. This indicates that Lpp is transferred from LolA to mLolB. The Lpp–mLolB complex most probably represents an intermediate of the outer membrane localization. The number of outer membrane lipoprotein molecules in one E.coli cell exceeds 10⁵ (Braun, 1975); on the other hand, that of LolB (data not shown), as well as that of LolA (Matsuyama et al., 1995), was estimated, by means of quantitative immunoblotting, to be 150–300. Therefore, to complete the outer membrane localization, Lpp must be transferred further from LolB to the outer membrane. We speculate that both LolA and LolB function catalytically to cycle the localization of the outer membrane-directed lipoproteins (Figure 8). Since mLolB was localized in the periplasm as a soluble monomer, the protein moiety of LolB seems to be exposed to the periplasm, thereby interacting with the Lpp–LolA complex in the periplasm, while the lipid moiety anchors LolB to the outer membrane. The mechanism underlying the final step of localization, which leads to the lipoprotein anchoring, remains to be clarified.

Figure 8.

Outer membrane localization of E.coli lipoproteins. IM, inner membrane; OM, outer membrane; LP, outer membrane-directed lipoprotein. For details, see text.

View full figure (52 KB)

Our preliminary experiments suggested that the release of LolB from the inner membrane is also dependent on LolA (N.Yokota, S.Matsuyama and H.Tokuda, unpublished observation). LolB is therefore likely to form a soluble complex with LolA, presumably at its modified N-terminal region. Indeed, mLolB lacking the modified N-terminal region existed in the periplasm as a monomer. On the other hand, the N-terminal region of LolB was not required for the interaction with Lpp since mLolB formed a complex with Lpp upon interaction with the Lpp–LolA complex. The Lpp–mLolB complex was soluble, as is the Lpp–LolA complex (Matsuyama et al., 1995), suggesting that the lipid-modified N-terminal region of Lpp in both complexes is shielded from the aqueous environment by LolA or LolB (Figure 8). However, no apparent homology was found between the amino acid sequences of LolA and LolB. The regions of LolA and LolB involved in the Lpp interaction therefore remain to be clarified. The details of the molecular interaction involving Lpp, LolA and LolB are currently under examination.

The phospholipid composition affects various membrane functions, for example protein translocation across the E.coli cytoplasmic membrane (de Kruijff, 1994; Rietveld et al., 1995). Acidic phospholipids are required specifically for the translocation (Lill et al., 1990; de Kruijff, 1994). LolB reconstituted into liposomes consisting of phosphatidylethanolamine and phosphatidylcholine was as active as that reconstituted into liposomes consisting of E.coli phospholipids (data not shown), suggesting that acidic phospholipids are not essential for the LolB function. Lpp incorporated into the outer membrane in vitro was resistant to 6 M urea treatment, as was the case in vivo (Matsuyama et al., 1995). On the other hand, the urea treatment significantly reduced the amount of proteoliposomes recovered by centrifugation. Therefore, it is not completely clear whether Lpp recovered with proteoliposomes is anchored directly to the membrane or simply associated with LolB.

We found that LolA was required for the release of Lpp, Pal, NlpB and LolB. The outer membrane incorporation of these lipoproteins, other than of LolB, took place in a LolB-dependent manner. LolA and LolB therefore seem to be involved in the outer membrane localization of most lipoproteins in E.coli. It is not clear at present how LolB is localized to the outer membrane after the LolA-dependent release.

HemM (LolB) homologs have been found in several bacteria, although none of them has been characterized with regard to function. The identities of the HemM homologs of Salmonella typhimurium (Post et al., 1993), Haemophilus influenzae (SWISS PROT; P45270) and Pseudomonas aeruginosa (Hungerer et al., 1995) with E.coli LolB are 92, 25 and 24%, respectively. Furthermore, a LolA homolog was found in H.influenzae (SWISS PROT; P45263). These observations indicate that LolA and LolB are generally involved in the localization of outer membrane lipoproteins in Gram-negative bacteria. It is noteworthy that five tryptophan residues of E.coli LolB are conserved in all HemM homologs, suggesting that these tryptophan residues are important for the function of LolB.

The hemM gene has been suggested by genetic analysis to be involved in the synthesis of 5-aminolevulinic acid (Ikemi et al., 1992). It was later found that hemA, but not hemM, is involved directly in 5-aminolevulinic acid synthesis (Chen et al., 1994; Hungerer et al., 1995), although co-expression of the two genes caused more efficient synthesis of 5-aminolevulinic acid (Chen et al., 1994). The hemA and hemM genes are 213 bp apart from each other and are transcribed divergently from the region between the two genes (Post et al., 1993). This region contains a promoter and a possible regulatory element for each gene. It is therefore likely that hemM expression affects the expression of hemA, and vice versa. Since LolB, a product of hemM, is an outer membrane lipoprotein, direct involvement of LolB in 5-aminolevulinic acid synthesis is highly unlikely. It was reported very recently that 5-aminolevulinic acid synthesis is increased by hemA overexpression whereas co-expression of hemA and hemM does not cause a further increase (Verderber et al., 1997).

There seems to be a striking mechanistic resemblance between the localization of lipid-modified proteins in E.coli and eukaryotes. For instance, Rab proteins are transported to the target membrane as a soluble complex with a Rab GDP dissociation inhibitor, Rab GDI (Sasaki et al., 1990; Ullrich et al., 1994). Rab is then anchored to the target membrane in an energy-independent manner, most likely through its lipid moiety (Stenmark et al., 1994). A proteinaceous factor in the target membrane was suggested recently to play roles in the recognition of the Rab–Rab GDI complex and the localization of Rab (Dirac-Sverjstrup et al., 1997)

Bacterial strains

The E.coli K-12 strains MC4100 [lacU169, araD, rpsL, relA, thiA, fibB] (Casadaban, 1976), Q13 [Hfr, pnp13, tyr, met, RNaseI^-] (Reiner, 1969), FS1576 [C600 thr, leu, thi, lac, thy, recD1009] (Stahl et al., 1986; Ogura et al., 1989), IQ86 [MC4100 zhd-33::Tn10 rpsE] (Shiba et al., 1984) and IQ85 [IQ86 secYts24] (Shiba et al., 1984) were used in this work.

Construction of plasmids

A phage clone, 247 (15A7), in the Kohara library (Kohara et al., 1987) was used to clone the hemM (lolB) gene as reported previously (Ikemi et al., 1992). Based on the reported nucleotide sequence around the hemM (lolB) gene (Post et al., 1993), a 1.7 kb NheI–HindIII DNA fragment was isolated from the DNA. This fragment, which contains the hemM (lolB)-orf2 operon but not its promoter region, was inserted into the XbaI–HindIII site of pTTQ18 (Amersham) carrying the tac promoter–lac operator and the lacI^q gene to construct pMAN650.

A 1.8 kb SalI–PvuII fragment containing the orf2 gene was isolated from the DNA and then inserted into the SalI–SmaI site of pMAN885 (Yakushi et al., 1997) carrying the P_BAD promoter and the araC gene to construct pMAN655.

A 6.2 kb KpnI fragment carrying the 5'- and 3'-flanking regions of hemM (lolB) was obtained from the DNA and then inserted into the KpnI site on pUC19 (Yanisch-Perron et al., 1985) to construct pMAN651. Synthetic DNA linkers d(5'CTAGGCCCCTAGGCCTCGAGCACTAGTCCCCCC3') and d(3'CGGGGATCCGGAGCTCGTGATCAGGGGGGGATC5') were inserted into the NheI site, which is located within the promoter region of the hemM (lolB)-orf2 operon, on pMAN651 to construct pMAN652. pSY343 (Yasuda and Takagi, 1983) was digested with HindIII, treated with T4 DNA polymerase and then digested with XhoI to obtain a 1.5 kb DNA fragment carrying the kan gene. pUC19 was digested with PvuII to obtain a 0.32 kb DNA fragment carrying lacPO. The two fragments were ligated with the large XhoI–XbaI fragment of pSP72 (Pierce) to construct pMAN653. A 1.8 kb XhoI–XbaI fragment of pMAN653 carrying the kan gene and lacPO in opposite directions was inserted into the XhoI–SpeI site on pMAN652 to construct pMAN654, which was used to construct a lac–lolB mutant.

To construct a water-soluble LolB (HemM) derivative, mLolB, an oligonucleotide (48mer) containing the signal cleavage region of lolB (hemM) was synthesized. The sequence at the cleavage site, 5'-CTGCCTGT-3', was changed to 5'-CTGCAGCT-3' to create a PstI site (underlined), and to introduce a CysAla mutation at position 1 (italicized). The synthetic oligonucleotide was incubated with 5.8 kb KpnI–SalI and 5.2 kb ScaI–ApaI fragments of pMAN650, followed by treatment with Klenow enzyme and T4 DNA ligase to form a heteroduplex. After transformation into MC4100, a plasmid, pYKT101, possessing the new PstI site was selected. To replace the signal peptide of mLolB with that of OmpF, a 6.1 kb KpnI–PstI fragment of pYKT101 was ligated with a pair of synthetic oligonucleotides (84mer), which are complementary to each other, possess KpnI and PstI sites at each end and encode the signal peptide of OmpF. The plasmid, pYKT102, thus constructed encodes mLolB with the OmpF signal peptide plus the N-terminal alanine of the mature region of OmpF and the product of orf2 under the control of the tac promoter.

In vitro membrane incorporation of Lpp

Spheroplast medium containing the [³⁵S]Lpp–LolA complex was prepared as described previously (Matsuyama et al., 1995). Briefly, a spheroplast suspension containing 1.610⁹/ml spheroplasts of the MC4100 strain was mixed with purified LolA (final concentration 9.5 g/ml) on ice. Labeling of the spheroplasts was initiated by the addition of M63 medium (2.4 vols) containing 0.25 M sucrose and 10 Ci/ml Tran³⁵S-label (1000 Ci/mmol, ICN) at 30°C. After 3 min, the labeling was chased for 3 min with 12 mM non-radioactive methionine and cysteine. The labeled culture was chilled and then centrifuged at 16 000 g for 2 min to obtain the spheroplast medium containing the [³⁵S]Lpp–LolA complex. Membrane incorporation of Lpp was examined by incubating the spheroplast medium with 0.4 mg/ml total membranes, 0.2 mg/ml outer membrane or a specified amount of proteoliposomes. The incorporation of Lpp into the membrane was determined by SDS–PAGE and fluorography after centrifugation.

Reconstitution of proteoliposomes possessing Lpp incorporation activity

Proteoliposomes were reconstituted by the octylglucoside dilution method, which has been used for reconstitution of the protein translocation machinery (Akimaru et al., 1991). The outer membrane (1 mg protein/ml) was solubilized with 2% octylglucoside in 50 mM K phosphate (pH 7.5), 1 mM EDTA at 4°C for 10 min. After centrifugation at 100 000 g for 30 min, 100 l of the supernatant was mixed with 12.5 l of 100 mg/ml E.coli phospholipids in 2% octylglucoside, and then kept on ice for 10 min. The mixture was diluted rapidly with 40 vols of 50 mM K phosphate (pH 7.5), and then stirred at room temperature for 5 min. Proteoliposomes collected by centrifugation at 160 000 g for 2 h were resuspended in 50 l of 50 mM K phosphate (pH 7.5), frozen at -80°C, thawed at room temperature, and then sonicated briefly. The proteoliposomes thus reconstituted were assayed for the in vitro incorporation of Lpp.

Purification and amino acid sequencing of LolB

MC4100 cells (wet weight, 40 g) were resuspended in 200 ml of 50 mM K phosphate (pH 7.5) and then disrupted by passage through an Aminco French pressure cell twice at 1000 kg/cm². The total membrane fraction was recovered by centrifugation at 100 000 g for 1 h, and then subjected to sucrose density gradient centrifugation. The outer membrane fraction (300 mg of protein) was collected and solubilized with 30 ml of 2% octylglucoside, 25 mM Tris–HCl (pH 8.8), 1 mM EDTA at 4°C for 10 min. After centrifugation at 100 000 g for 30 min, the supernatant (6 ml) was applied to a column of an anion exchanger, MonoQ (110 cm, Pharmacia) which had been equilibrated with 2% octylglucoside, 25 mM Tris–HCl (pH 8.8). The column was then eluted at the flow rate of 4 ml/min with a linear gradient of NaCl (0–0.5 M). Aliquots of each fraction were reconstituted into proteoliposomes and assayed for Lpp incorporation. The chromatography was repeated five times, and the flow-through fractions containing most of the activity were combined, dialyzed against 25 mM Na acetate (pH 5.0), 2% octylglucoside, and fractionated further by cation-exchange chromatography on a column of MonoS (110 cm, Pharmacia) which had been equilibrated with 25 mM Na acetate (pH 5.0), 2% octylglucoside. The column was eluted with the same buffer at the flow rate of 4 ml/min with a linear gradient of NaCl (0–0.5 M). The Lpp incorporation activity was examined after reconstitution of proteoliposomes with each fraction.

The fraction exhibiting incorporation activity was analyzed by SDS–PAGE, followed by staining with Coomassie brilliant blue. A 23 kDa protein band exhibiting the activity was cut out from the gel, and the protein was extracted from the crushed gel by incubation with 50 mM Tris–HCl (pH 7.5), 0.5% SDS at room temperature for 12 h. After removal of the crushed gel, acetone was added to the solution. The precipitate containing 20 g of the 23 kDa protein, LolB, was collected by centrifugation, dissolved in 30 l of the SDS–PAGE sample buffer containing 0.8 g of V8 protease, and then immediately analyzed by SDS–PAGE on a 19% acrylamide gel. Proteolytic peptides in the gel were transferred to a PVDF membrane (Millipore) and then stained with Coomassie brilliant blue. The peptide bands migrating to positions corresponding to molecular masses of 10 and 6 kDa were cut out and then subjected to amino acid sequencing with a Beckman protein sequencing system LF3600D.

Overproduction and purification of LolB

An outer membrane fraction (300 mg protein) was prepared from 40 g (wet weight) of JM83 harboring pMAN650, which was grown in the presence of 1 mM IPTG for 2 h to overproduce LolB. The outer membrane fraction containing the overproduced LolB was solubilized with 25 mM Tris–HCl (pH 8.8), 2% octylglucoside. LolB was purified from the solubilized fraction by means of ion-exchange column chromatography on MonoQ and MonoS, as described above. The purified LolB (1.5 mg) was stored at -80°C until use.

Preparation of an anti-LolB antibody

Although LolB purified from the LolB-overproducing strain by column chromatography did not exhibit impurities on SDS–PAGE, an anti-LolB antibody was raised in rabbits against further purified LolB, which was electroeluted from the SDS gel.

Construction of a lac–lolB mutant

A 8.0 kb KpnI fragment carrying the lac–lolB gene, the kan gene and the 5'- and 3'-flanking regions of lolB was isolated from pMAN654. FS1576, a recD mutant, was transformed with the KpnI fragment and then kanamycin-resistant transformants were selected on L-broth plates containing 1 mM IPTG as described (Stahl et al., 1986; Ogura et al., 1989). The three transformants thus isolated required IPTG for both growth and LolB synthesis. One of them, SM602, was used in this study.

Partial purification of a soluble LolB derivative (mLolB)

A periplasmic fraction was prepared from 8.7 g (wet weight) of MC4100 harboring pYKT102, which was grown in the presence of 1 mM IPTG, as described previously (Matsuyama et al., 1995). The periplasmic fraction (180 ml) was concentrated with an Amicon concentrator, and then dialyzed against 25 mM Na acetate (pH 5.0). The concentrated fraction (50 ml) was applied to a MonoS column (110 cm, Pharmacia), which had been equilibrated with 25 mM Na acetate (pH 5.0). The column was then eluted at the flow rate of 4 ml/min with a linear gradient of NaCl (0–0.4 M). The amount of mLolB in each fraction was determined by densitometric scanning of an SDS gel stained with Coomassie brilliant blue. The fraction which contained mLolB at the highest purity (60%) was used.

We wish to thank Dr K.Ito, Kyoto University, for E.coli IQ85 and IQ86, Dr Y.Kohara, National Institute of Genetics, for the clones, and Dr T.Ogura, Kumamoto University, for E.coli FS1576. We also wish to thank Miss S.Nishikawa for her secretarial support. This work was supported by grants from the Ministry of Education, Science, Sports and Culture of Japan (Nos 07308069 and 07458148).

Akimaru J, Matsuyama S, Tokuda H and Mizushima S (1991) Reconstitution of a protein translocation system containing purified SecY, SecE and SecA from Escherichia coli. Proc Natl Acad Sci USA, 88, 6545–6549. | Article | PubMed | ChemPort |

Braun V (1975) Covalent lipoprotein from the outer membrane of Escherichia coli. Biochim Biophys Acta, 415, 335–377. | Article | PubMed | ISI | ChemPort |

Casadaban MJ (1976) Transposition and fusion of the lac genes to selected promoters in Escherichia coli using bacteriophage lambda and mu. J Mol Biol, 104, 541–555. | Article | PubMed | ISI | ChemPort |

Chen W, Russell CS, Murooka Y and Cosloy SD (1994) 5-Aminolevulinic acid synthesis in Escherichia coli requires expression of hemA. J Bacteriol, 176, 2743–2746. | PubMed | ISI | ChemPort |

Choi D-S, Yamada H, Mizuno T and Mizushima S (1986) Trimeric structure and localization of the major lipoprotein in the cell surface of Escherichia coli. J Biol Chem, 261, 8953–8957. | PubMed | ISI | ChemPort |

Date T and Wickner W (1981) Isolation of the Escherichia coli leader peptidase gene and effects of leader peptidase overproduction in vivo. Proc Natl Acad Sci USA, 78, 6106–6110. | Article | PubMed | ChemPort |

De Kruijff B (1994) Anionic phospholipids and protein translocation. FEBS Lett, 346, 78–82. | Article | PubMed | ChemPort |

Dirac-Sverjstrup AB, Sumizawa T and Pfeffer SR (1997) Identification of a GDI displacement factor that releases endosome Rab GTPases from Rab-GDI. EMBO J, 16, 465–472. | Article | PubMed

Hayashi S and Wu HC (1990) Lipoproteins in bacteria. J Bioenerg Biomembr, 22, 451–471. | Article | PubMed | ISI | ChemPort |

Hungerer C, Troup B, Römling U and Jahn D (1995) Regulation of the hemA gene during 5-aminolevulinic acid formation in Pseudomonos aeruginosa. J Bacteriol, 177, 1435–1443. | PubMed | ISI | ChemPort |

Hussain M, Ichihara S and Mizushima S (1980) Accumulation of glyceride-containing precursor of the outer membrane lipoprotein in the cytoplasmic membrane of Escherichia coli treated with globomycin. J Biol Chem, 255, 3707–3712. | PubMed | ISI | ChemPort |

Ikemi M, Murakami K, Hashimoto M and Murooka Y (1992) Cloning and characterization of genes involved in the biosynthesis of -aminolevulinic acid in Escherichia coli. Gene, 121, 127–132. | Article | PubMed | ISI | ChemPort |

Kohara Y, Akiyama K and Isono K (1987) The physical map of the whole E.coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell, 50, 495–508. | Article | PubMed | ISI | ChemPort |

Lill R, Dowhan W and Wickner W (1990) The ATPase activity of SecA is regulated by acidic phospholipids, SecY, and the leader and mature domains of precursor proteins. Cell, 60, 271–280. | Article | PubMed | ISI | ChemPort |

Matsuyama S, Tajima T and Tokuda H (1995) A novel periplasmic carrier protein involved in the sorting and transport of Escherichia coli lipoproteins destined for the outer membrane. EMBO J, 14, 3365–3372. | PubMed | ISI | ChemPort |

Mizushima S (1987) Assembly of membrane protein. In Inouye,M. (ed.), Bacterial Outer Membranes as Model Systems. John Wiley and Sons, Inc., New York, pp. 163–185.

Morris TW, Reed KE and Cronan JEJr (1994) Identification of the gene encoding lipoate-protein ligase A of Escherichia coli: molecular cloning and characterization of the lplA gene and gene product. J Biol Chem, 269, 16091–16100. | PubMed | ISI | ChemPort |

Ogura T, Bouloc P, Niki H, D'Ari R, Hiraga S and Jaffe A (1989) Penicillin-binding protein 2 is essential in wild-type Escherichia coli but not in lov or cya mutants. J Bacteriol, 171, 3025–3030. | PubMed | ISI | ChemPort |

Post DA, Hove-Jensen B and Switzer RL (1993) Characterization of the hemA–prs region of the Escherichia coli and Salmonella typhimurium chromosomes: identification of two open reading frames and implications for prs expression. J Gen Microbiol, 139, 259–266. | PubMed | ISI | ChemPort |

Pugsley AP (1993) The complete general secretory pathway in gram-negative bacteria. Microbiol Rev, 57, 50–108. | PubMed | ISI | ChemPort |

Reiner AM (1969) Isolation and mapping of polynucleotide phosphorylase mutants of Escherichia coli. J Bacteriol, 97, 1431–1436. | PubMed | ISI | ChemPort |

Rietveld AG, Koorengevel MC and de Kruijff B (1995) Non-bilayer lipids are required for efficient protein transport across the plasma membrane of Escherichia coli. EMBO J, 14, 5506–5513. | PubMed | ISI | ChemPort |

Sankaran K and Wu HC (1994) Lipid modification of bacterial prolipoprotein: transfer of diacylglyceryl moiety from phosphatidylglycerol. J Biol Chem, 269, 19701–19706. | PubMed | ISI | ChemPort |

Sasaki T, Kikuchi A, Araki S, Hata Y, Isomura M, Kuroda S and Takai Y (1990) Purification and characterization from bovine brain cytosol of a protein that inhibits the dissociation of GDP from and the subsequent binding of GTP to smg p25, a ras p21-like GTP-binding protein. J Biol Chem, 265, 2333–2337. | PubMed | ISI | ChemPort |

Shiba K, Ito K, Yura T and Cerretti DP (1984) A defined mutation in the protein export gene within the spc ribosomal protein operon of Escherichia coli: isolation and construction of a new temperature-sensitive secY mutant. EMBO J, 3, 631–635. | PubMed | ISI | ChemPort |

Simons K and Zerial M (1993) Rab proteins and the road maps for intracellular transport. Neuron, 11, 789–799. | Article | PubMed | ISI | ChemPort |

Stahl FW, Kobayashi I, Thaler D and Stahl MM (1986) Direction of travel of RecBC recombinase through bacteriophage lambda DNA. Genetics, 113, 215–227. | PubMed | ISI | ChemPort |

Stenmark H, Parton RG, Steele-Mortimer O, Lütcke A, Gruenberg J and Zerial M (1994) Inhibition of rab5 GTPase activity stimulates membrane fusion in endocytosis. EMBO J, 13, 1287–1296. | PubMed | ISI | ChemPort |

Tokunaga M, Tokunaga H and Wu HC (1982) Posttranslational modification and processing of Escherichia coli prolipoprotein in vitro. Proc Natl Acad Sci USA, 79, 2255–2595. | Article | PubMed | ChemPort |

Ullrich O, Horiuchi H, Bucci C and Zerial M (1994) Membrane association of Rab5 mediated by GDP-dissociation inhibitor and accompanied by GDP/GTP exchange. Nature, 368, 157–160. | Article | PubMed | ISI | ChemPort |

Verderber E, Lucast LJ, van Dehy JA, Cozart P, Etter JB and Best EA (1997) Role of the hemA gene product and -aminolevulinic acid in regulation of Escherichia coli heme synthesis. J Bacteriol, 179, 4583–4590. | PubMed | ISI | ChemPort |

Yakushi T, Tajima T, Matsuyama S and Tokuda H (1997) Lethality of the covalent linkage between mislocalized major outer membrane lipoprotein and the peptidoglycan of Escherichia coli. J Bacteriol, 179, 2857–2862. | PubMed | ISI | ChemPort |

Yamaguchi K, Yu F and Inouye M (1988) A single amino acid determinant of the membrane localization of lipoproteins in E.coli. Cell, 53, 423–432. | Article | PubMed | ISI | ChemPort |

Yanisch-Perron C, Vieira J and Messing J (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene, 33, 103–119. | Article | PubMed | ChemPort |

Yasuda S and Takagi T (1983) Overproduction of Escherichia coli replication proteins by the use of runaway-replication plasmids. J Bacteriol, 154, 1153–1161. | PubMed | ISI | ChemPort |

Main navigation

• Search EMBO Journal

  Search

• Advanced search

• The EMBO Journal

  • Home
  • Aims and scope
  • Current issue
  • Advance online publication
  • Web focuses
  • Archive:
  • Browse by issue
  • Browse by subject
  • Browse by category
  • Free online sample issue
  • Press releases

• Authors and Referees

  • Editorial process
  • Guide for authors
  • Submit an article
  • Guide for referees
  • Editors and Editorial Board
  • Contact editorial office

• Customer Service

  • Subscribe
  • Order sample copy
  • Purchase articles
  • Reprints and permissions
  • Contact NPG
  • Advertising