Article

  • The EMBO Journal (1997) 16, 6018 - 6033
  • doi:10.1093/emboj/16.19.6018

ATM-dependent telomere loss in aging human diploid fibroblasts and DNA damage lead to the post-translational activation of p53 protein involving poly(ADP-ribose) polymerase

Homayoun Vaziri1, Michael D. West2, Richard C. Allsopp2, Timothy S. Davison1, Yu-Sung Wu1, Cheryl H. Arrowsmith1, Guy G. Poirier3 and Samuel Benchimol1

  1. Ontario Cancer Institute and the Department of Medical Biophysics, University of Toronto, 610 University Avenue, Toronto, Ontario, Canada M5G 2M9
  2. Geron Corporation, 230 Constitution Drive, Menlo Park, CA 94025, USA
  3. Poly(ADP-ribose) Metabolism Group, CHUL Research Centre, 9700, 2705, Boulevard Laurier, Québec, Canada G1V 4G2

Received 31 January 1997; Revised 20 June 1997


Telomere loss has been proposed as a mechanism for counting cell divisions during aging in normal somatic cells. How such a mitotic clock initiates the intracellular signalling events that culminate in G1 cell cycle arrest and senescence to restrict the lifespan of normal human cells is not known. We investigated the possibility that critically short telomere length activates a DNA damage response pathway involving p53 and p21WAF1 in aging cells. We show that the DNA binding and transcriptional activity of p53 protein increases with cell age in the absence of any marked increase in the level of p53 protein, and that p21WAF1 promoter activity in senescent cells is dependent on both p53 and the transcriptional co-activator p300. Moreover, we detected increased specific activity of p53 protein in AT fibroblasts, which exhibit accelerated telomere loss and undergo premature senescence, compared with normal fibroblasts. We investigated the possibility that poly(ADP-ribose) polymerase is involved in the post-translational activation of p53 protein in aging cells. We show that p53 protein can associate with PARP and inhibition of PARP activity leads to abrogation of p21 and mdm2 expression in response to DNA damage. Moreover, inhibition of PARP activity leads to extension of cellular lifespan. In contrast, hyperoxia, an activator of PARP, is associated with accelerated telomere loss, activation of p53 and premature senescence. We propose that p53 is post-translationally activated not only in response to DNA damage but also in response to the critical shortening of telomeres that occurs during cellular aging.


  • Keywords:

    • ATM,
    • p53,
    • p21WAF1,
    • PARP,
    • telomeres

Introduction

Top

Normal human diploid fibroblasts (HDFs) are mortal and undergo a limited number of population doublings in culture (Hayflick and Moorhead, 1961), after which they enter a viable but non-proliferative phase known as senescence. Senescent cells arrest primarily in the G1 phase of the cell cycle (Sherwood et al., 1988). This proliferative block can be overcome upon expression of the SV40 large T antigen or the HPV-16 E6/E7 proteins, resulting in an extension of cellular lifespan (Shay et al., 1993). SV40 large T antigen is known to bind the p53 tumor suppressor protein and to interfere with its DNA binding and transcriptional activation function. HPV-16 E6 protein also binds p53 protein and promotes its degradation by the ubiquitin-dependent proteolytic pathway. Hence, both proteins disrupt the function of p53, suggesting that p53 protein likely serves as a key regulator of cellular senescence. Consistent with this idea are the findings that spontaneous loss of p53 alleles in HDFs is associated with extension of cellular lifespan (Rogan et al., 1995) and that expression of certain dominant negative p53 alleles can extend the cellular lifespan of human (Bond et al., 1994; Gollahon and Shay, 1996) and rat fibroblasts (Rovinski and Benchimol, 1988).

Aging in HDFs (Harley et al., 1990; Lindsey et al., 1991; Allsopp et al., 1992) and in human hematopoietic cells (Hastie et al., 1990; Vaziri et al., 1993, 1994; Metcalfe et al., 1996) is accompanied by the progressive loss of telomeric DNA. Expression of the enzyme telomerase in immortal cells provides one mechanism for the prevention of telomere shortening (Morin, 1989; Counter et al., 1992; Kim et al., 1994). Persistent loss of telomeres in the absence of telomerase could lead to a critically short telomere length, cell cycle arrest and senescence (Allsopp and Harley, 1995). However, it is unclear how shortened telomeres give rise to the anti-proliferative signals that result in senescence. One clue was provided by Benn (1976) and Sherwood et al. (1988), who reported an increase in the incidence of dicentric chromosomes in aging cell populations. Dicentric chromosomes are likely the result of recombination occurring at the shortened and exposed telomeric ends of chromosomes. We suggested previously that dicentric chromosomes, upon breakage at mitosis, might activate a p53-dependent DNA damage pathway leading to cell cycle arrest (Vaziri and Benchimol, 1996). Several lines of evidence are consistent with this model. First, the p21WAF1 gene, which encodes an inhibitor of cyclin-dependent kinases (CDK) (Harper et al., 1993; Dulic et al., 1994), is transcriptionally regulated by p53 (El-Deiry et al., 1993) and is over-expressed in senescent cells (Noda et al., 1994). Overexpression of a transfected p21WAF1 gene in recipient cells results in G1 cell cycle arrest (Yang et al., 1995). Second, exposure of HDFs to gamma-irradiation leads to a p53-dependent, prolonged G1 arrest and induction of p21WAF1 expression that is reminiscent of senescence (Di Leonardo et al., 1994). Third, DNA binding experiments indicate that binding of p53 protein to the p53-responsive element present on the ribosomal gene cluster (RGC) DNA fragment increases in senescent cells (Atadja et al., 1995). Together, these results suggest that p53 protein may be activated during cell aging to promote transcription of the p21WAF1 gene. p21WAF1 expression, however, is known to be regulated through p53-dependent and p53-independent pathways (Michieli et al., 1994; Datto et al., 1995). In this study we have investigated further the role of p53 and p21WAF1 in cell aging and demonstrate that the DNA binding activity of p53 protein on the p53-responsive element present in the human p21WAF1 promoter increases during cell aging. In addition, we show that p21WAF1 expression at senescence is dependent on p53 as well as on the transcriptional co-activator p300.

A number of genes encode proteins that may be capable of sensing DNA damage. ATM and poly(ADP-ribose) polymerase (PARP) represent two such proteins and both have been implicated in the p53-dependent DNA damage response pathway (Kastan et al., 1992; Lu and Lane, 1993; Wesierska et al., 1996). HDFs from individuals with ataxia telangiectasia (AT), an autosomal recessive disease characterized by sensitivity to ionizing radiation, sterility, immune dysfunction, telangiectasia and premature aging, undergo premature senescence in culture (Shiloh et al., 1982). The gene that is defective in AT patients, called ATM, is related to the TEL1 gene of Saccharomyces cerevisiae and encodes a protein with similarity to the phosphatidylinositol 3-kinase family of proteins. Inactivation of TEL1 in S.cerevisiae leads to rapid telomere loss (Greenwell et al., 1995). Furthermore, fibroblasts from mice lacking ATM undergo premature senescence in culture (Xu and Baltimore, 1996). We demonstrate that telomeric DNA is rapidly lost in human AT fibroblasts and that this telomere shortening is associated with premature senescence and increased DNA binding activity of p53 protein. PARP is strongly activated by binding to DNA strand breaks produced by various DNA damaging agents, including hydrogen peroxide, and undergoes rapid automodification by synthesizing long branches of poly(ADP-ribose) (Lindahl et al., 1995). We report that PARP and p53 protein associate in vitro and in vivo. Hyperoxia, which is known to activate PARP (Zhang et al., 1994), leads to accelerated loss of telomeres, activation of p53 protein and premature senescence. Furthermore, inactivation of either p53 or PARP in HDFs leads to extension of cellular lifespan. Together, these data implicate ATM, PARP, p53 and p21WAF1 as key components in a telomere loss/DNA damage signaling pathway that is activated in human cells during cell aging.

DNA binding activity of p53 protein is altered during cellular aging

Nuclear injection of linearized plasmid DNA or circular DNA with a large gap is sufficient to induce p53-mediated growth arrest, a process that is known to depend on the DNA binding activity of p53 (Huang et al., 1996). Moreover, the generation of double-stranded DNA breaks in response to ionizing radiation has been shown to increase the DNA binding activity of p53 (Reed et al., 1995). If double-stranded breaks or large gaps in chromosomal DNA occur during the process of cellular aging in culture, one might expect to see increased DNA binding activity of p53 as a consequence of such DNA damage. Therefore, we examined the DNA binding activity of p53 protein using an electrophoretic mobility shift assay (EMSA) with a 32P-labeled double-stranded oligonucleotide containing the p53 consensus binding sequence (p53CON) (Funk et al., 1992) and nuclear extracts prepared from the human fibroblast strain MRC-5 at different population doublings (PDs). Inclusion of the p53-specific monoclonal antibody PAb421 in the binding reaction facilitated visualization of the p53–DNA complex. An increase in DNA binding activity of p53 protein was observed as MRC-5 cells approached senescence (Figure 1A and B). This observation was confirmed in two other human fibroblast strains, WI-38 and BJ (Figure 1C). Competition with an excess of unlabled p53CON oligonucleotide but not with an equivalent amount of unrelated oligonucleotide with a similar nucleotide composition to p53CON confirmed that binding was specific (Figure 1A). As a further control for specificity, binding to p53 was observed when an extract from the p53-overexpressing cell line SF1 was used (Figure 1A) but not when an extract prepared from p53-null cells was used (data not shown).

Figure 1.

Figure 1 :

DNA binding activity of p53 protein increases with cell age. (A) Nuclear extracts (5 mug) prepared from SF1 or MRC-5 cells were incubated with a 32P-labeled double-stranded oligonucleotide containing the p53 consensus binding sequence (p53CON) with (+) or without (-) the p53-specific monoclonal antibody PAb421 and analyzed by EMSA. SF1 cells which overexpress p53 protein were used as controls in lanes 1–4. MRC-5 cells at PD32 were used in lanes 8 and 10 and at PD47 in lanes 5–7 and 9. The binding reactions were supplemented with the human p53-specific monoclonal antibody PAb1801 (lane 3) or control IgG antibodies (lane 4). Lanes 5 and 6 contained cold competitor p53CON at 50-fold and 10-fold molar excess over the labeled p53CON substrate; lanes 7 and 8 contained a 50-fold excess of an unrelated, cold double-stranded mutated oligonucleotide with the same nucleotide composition as p53CON. Arrow 1 on the left indicates the position of the supershifted PAb421–p53 protein–DNA complex, arrow 2 is the p53 protein–DNA complex and arrow 3 is a non-specific band. (B) Nuclear extracts prepared from MRC-5 cells at different PDs were tested for p53 DNA binding activity; arrow 1 indicates the position of the PAb421–p53 protein–DNA complex. (C) DNA binding activity of p53 in nuclear extracts prepared from young and old WI-38 and BJ cells; arrow 1 indicates the position of the PAb421–p53 protein–DNA complex. (D) Western immunoblot analysis of p53 protein in young and old MRC-5 cells (top) and in young and old WI-38 cells (bottom). The p53-negative cell line Saos2 was included as a control. Total cell lysates (300 mug protein) were resolved by SDS–PAGE; p53 protein was detected by immunoblotting with PAb1801 and visualized by enhanced chemiluminescence. (Middle) p53 was immunoprecipitated with PAb421 from young and old MRC-5 cells prior to Western blotting. (E) The p53 DNA binding activity in young and old cells was determined by EMSA and normalized to the amount of p53 protein present in the nuclear extracts by Western blotting. (F) Nuclear extracts were prepared from MRC-5 cells at different population doublings on five separate occasions. Each mean value shown on the curve is based on five independent samples (5 mug protein) each measured for DNA binding activity at least once within the linear range of the DNA binding assay. Binding activity was determined by measuring the amount of radioactivity present in the PAb421 supershifted complex using a Molecular Dynamics PhosphorImager and ImageQuant software. DNA binding activity is expressed relative to that seen at the earliest time point (PD24–27). Error bars represent the SEM. Also shown is the frequency of dicentric chromosomes (bars), which increase during cell aging in culture. The data for the frequency of dicentric chromosomes in aging MRC-5 cells was obtained from Benn (1976). At the latest time point (PD50–60) no dicentric chromosome data were available.

View full figure (72 KB)

When the DNA binding activity was normalized to the amount of p53 protein present in extracts from young and old cells by Western blotting (Figure 1D), we found a 1.9-fold increase in the DNA binding activity of p53 in old MRC-5 cells (n = 2), a 5.5-fold increase in old WI-38 and a 1.5-fold increase in old BJ cells relative to their young counterparts (Figure 1E). Hence, the increase in DNA binding cannot be ascribed to elevated levels of p53 protein and could reflect an age-related post-translational change in p53 protein.

The frequency of dicentric chromosomes was shown previously to increase in aging MRC-5 cultures (Benn, 1976), possibly as the result of telomere shortening (Harley, 1991). In Figure 1F we superimpose our data showing age-related changes in the DNA binding activity of p53 protein with the frequency of dicentric chromosomes in aging MRC-5 cells. The DNA binding data was obtained from five independent experiments. The activity peaked in near senescent cultures as cellular proliferation declined and then decreased in cells that had reached senescence. The incidence of dicentric chromosomes near senescence peaks at the same time as the DNA binding activity of p53 (Figure 1F). It is of interest to note that extracts prepared from aging WI-38 cells, which have a higher incidence of dicentric chromosomes than MRC-5 cells (Benn, 1976), also exhibit a higher level of DNA binding by p53 after normalization for p53 protein content (Figure 1E). Since dicentric chromosomes undergo breakage and fusion cycles during mitosis, it is possible that the resulting DNA strand breaks activate the latent DNA binding activity of p53 protein. We suggest that senescence-associated DNA damage (Figure 1F), acting through p53, could initiate the events that lead to cellular senescence.

Since the increased DNA binding activity of p53 was measured in the presence of PAb421 antibodies, we considered the possibility that the DNA binding assay reflected greater accessibility of p53 protein to PAb421 antibodies, perhaps due to a conformational change and/or post-translation modification of p53 in old cells. While Western blotting revealed similar levels of p53 protein in young and old cells, immunoprecipitation analysis revealed increased levels of PAb421-reactive p53 protein in old cells (Figure 1D, middle). We turned, therefore, to studies of p21WAF1 expression and transcriptional reporter assays in which RNA expression, while dependent on the DNA binding activity of p53 in vivo, occurs independently of added PAb421 antibodies.

Involvement of p53 and p300 in the regulation of p21WAF1 promoter activity in aging human fibroblast strains

p21WAF1 mRNA levels were shown previously to increase as HDFs approached senescence (Noda et al., 1994). Analysis of p21 protein levels in MRC-5 cells by immunohistochemistry (Figure 2A and B) and in S1C cells by Western immunoblotting (Figure 2C) revealed an accumulation of p21 protein in near senescent cells. While p21 protein was localized primarily in the nucleus of young cells, both nuclear and cytoplasmic staining were seen in the older cells.

Figure 2.

Figure 2 :

p21 protein expression during cell aging. (A) Young and (B) near senescent MRC-5 cells were fixed and p21 protein was detected immunohistochemically using SC-187 monoclonal antibody and biotinylated HRP-conjugated secondary antibody. (C) p21 protein from S1C cell extracts (1 mg protein) was immunoprecipitated with SC-187 antibody and detected by immunoblotting and ECL using a rabbit polyclonal antibody against p21 (Pharmingen) and HRP-conjugated anti-rabbit antibodies. Lanes 1 and 2, near senescent (PD58) cultures of two clones transfected with HPV-16 E6; lanes 3 and 4, two near senescent cultures of S1C cells; lane 5, young S1C cells (PD25).

View full figure (83 KB)

To examine the involvement of p53 in regulating p21 levels in aging fibroblasts, clones of the human fibroblast strain S1C expressing HPV-16 E6 were generated and p21 protein levels were measured. S1C/E6 clones produced less p21 protein compared with non-transfected S1C cells at the same population doubling (Figure 2C). p21 protein expression, however, was not completely abolished in these cells, possibly due to residual p53 activity or the existence of a p53-independent pathway for p21WAF1 induction. It should be noted that S1C/E6 cells underwent senescence and did not exhibit a significant extension of their lifespan.

In order to examine the mechanism underlying transcriptional activation of the p21WAF1 gene in aging cells, transient expression studies were performed using a vector (p21P-luc) in which the human p21WAF1 promoter (2.4 kb fragment) containing a resident p53-responsive element was linked upstream of a luciferase reporter gene. A related reporter plasmid in which a 72 bp region encompassing the p53 consensus sequence was deleted from the p21WAF1 promoter (p21DeltaP-luc) was used in parallel. All measurements of luciferase activity were normalized with respect to plasmid copy number in the transfected cells, using a modified Hirt assay, to control for variations in transfection efficiency. Measurement of luciferase activity 72 h after transfection in young and old cells revealed approx3-fold higher levels of luciferase in cells transfected with the full-length promoter compared with cells transfected with the deleted promoter (Figure 3A). Hence, the 72 bp fragment of the p21WAF1 promoter that contains a p53-responsive element is required for maximal luciferase activity in both young and old cells. Luciferase activity was approx2-fold higher in old cells compared with young cells (Figure 3A and D). Elevated expression of luciferase in old cells was observed with both the full-length and truncated promoters, suggesting that induction of luciferase activity in old cells might involve sequences that lie outside the 72 bp fragment of the luciferase promoter. El-Deiry et al. (1993) identified a second p53 recognition element in the human p21WAF1 promoter that may be involved in this age-related induction. However, it remains possible that the age-related increase in p21 promoter activity involves a p53-independent pathway. To address this further, we examined the Box A promoter of the IGF-BP3 gene, which is reported to be a target for p53 (Buckbinder et al., 1995) and to be over-expressed in senescent HDFs (Goldstein et al., 1991). Luciferase expression directed by the IGF-BP3 promoter was 10 times higher in old MRC-5 cells compared with younger cells (Figure 3A). The SV40 promoter, which does not contain a p53 consensus binding site, provided a control for specificity in this series of transfection experiments and showed no age-related activation.

Figure 3.

Figure 3 :

Activation of the p21 promoter requires both p53 and p300. (A) Young and old MRC-5 cells were transfected with 5 mug reporter plasmid in which the luciferase coding sequence was placed downstream of the wild-type p21 promoter (p21P-luc), a mutant p21 promoter (p21DeltaP-luc), the IGF-BP3 promoter element bearing Box A, no promoter (vector) or the SV40/pGL3 control promoter. Luciferase activity was measured in triplicate, 72 h after transfection, using a luminometer and normalized for differences in plasmid copy number determined using a modified Hirt procedure as described in Materials and methods. The highest level of normalized luciferase activity was seen in old cells. This value was set at 100% and all other values are expressed proportionately. Error bars represent the SEM. (B) Young MRC-5 cells were stably transfected with wild-type or mutant p21 promoter–luciferase plasmids. After selection in G418 the resulting 25 mutant promoter clones and 20 wild-type promoter clones were pooled and luciferase activity was measured. (C) MRC-5 cells nearing senescence were co-transfected with the p21 promoter–luciferase reporter plasmid (p21P-luc) and one of various human p53 cDNA plasmids (2 mug) in which expression was controlled by the CMV promoter. Normalized values of luciferase activity were determined as described in (A) and are expressed in relative light units (RLU). (D) Young and old cells were co-transfected with 5 mug p21P-luc plasmid together with 10 mug of one of the following expression plasmids: pSV2-E6, pSV2-E7, pSV2-E6/E7 or control vector plasmid. Seventy-two hours after transfection, luciferase activity was measured as described in (A). (E) Cells nearing senescence were transfected with the p21P-luc plasmid together with plasmids expressing wild-type or mutant Ad E1A protein. dl1108 can bind p300 but fails to bind pRB or p107; dl1101 and dl1143 both fail to bind to p300 but do bind to pRB and p107. pLE2/520 expresses wild-type E1A protein. (F) The cell strain 2675T, derived from a Li–Fraumeni patient, bears a heterozygous p53 gene mutation. Upon prolonged passage in culture, these cells lose the wild-type p53 allele. The p53 gene status of these cells at PD41 and at PD65 was examined and found to be heterozygous (+/-) at the earlier passage with loss of heterozygosity (-/-) occurring at the later passage. Cells at PD41 and at PD65 were transfected with p21P-luc and luciferase activity was measured as described in Materials and methods.

View full figure (65 KB)

The ability of the 72 bp fragment containing the p53 consensus binding site to confer maximal activity on the p21WAF1 promoter was confirmed through the use of MRC-5 clones stably transfected with pSV2neo and either p21P-luc or p21DeltaP-luc. Luciferase activity in pooled, stable, G418R clones was 9-fold higher in cells that contained an intact p21WAF1 promoter compared with cells that contained the deleted promoter (Figure 3B).

To test directly the involvement of p53 protein in regulating the activity of the p21WAF1 promoter present in p21P-luc, we chose to disrupt endogenous p53 function in near senescent MRC-5 cells through transient over-expression of various dominant negative mutant p53 cDNAs. p21WAF1 promoter activity was significantly repressed upon expression of p53Ala143, p53His175 and p53Tyr275 polypeptides but not by wild-type p53 expression (Figure 3C).

An alternative means of disrupting endogenous p53 function involves expression of HPV-16 E6 protein, which is known to promote ubiquitin-dependent degradation of p53 protein. Accordingly, young and old cells were co-transfected with p21P-luc and one of either E6, E7 or a combination of E6 and E7. E6 reduced p21WAF1 promoter activity more profoundly in old cells than in young cells (Figure 3D). E7 had no significant effect on p21WAF1 promoter activity in young cells but a reproducible repression of p21WAF1 promoter activity was observed in old cells. The combination of E6 and E7 in old cells was no better than E6 alone in repressing luciferase expression. E7 protein is known to bind to a number of cellular proteins, including pRB, pRB-related proteins and the transcriptional adapter protein p300. To determine if any of these proteins is involved in regulating p21WAF1 promoter activity, we made use of several adenovirus E1A protein variants that have either lost the ability to bind pRB and pRB-related proteins yet retain the ability to bind p300 (dl1108) or lost the ability to bind p300 while retaining the ability to bind pRB and pRB-related proteins (dl1101 and dl1143) (Howe et al., 1990). Of the three E1A variants tested, only that encoded by dl1108 repressed the p21WAF1 promoter in old cells (Figure 3E). Wild-type E1A (pLE2/520) repressed the activity of the p21WAF1 promoter as effectively as p53Ala143. Wild-type E1A and the dl1108 variant also share the ability to induce DNA synthesis in quiescent fibroblasts (Howe et al., 1990). Together these data implicate both p300 (or other p300-related molecules) and p53 proteins in regulation of the p21WAF1 promoter in human fibroblasts.

Loss of a wild-type p53 allele leads to reduced p21WAF1 promoter activity and extension of cellular lifespan

Expression of SV40 large T antigen or HPV-16 E6/E7 proteins in human fibroblasts leads to an extension of cellular lifespan. These cells bypass the senescence checkpoint but eventually enter a second phase of arrest termed crisis that, unlike senescence, is associated with cell death. An elevation of p21WAF1 RNA levels has been observed in cells entering crisis, as well as in cells entering senescence (Rubelj and Pereira-Smith, 1994). Having shown that p53 protein is involved in the regulation of p21WAF1 gene transcription in aging fibroblasts, we next wished to determine if p53 played any role in induction of p21WAF1 mRNA at crisis. We made use of fibroblasts obtained from an individual with Li–Fraumeni syndrome. Fibroblasts from Li–Fraumeni patients commonly contain one wild-type p53 allele and one mutant, non-functional p53 allele. When placed in culture, these cells have been shown to bypass senescence (Bischoff et al., 1990) upon loss of the remaining wild-type p53 allele (Rogan et al., 1995). The 2675T strain carries a heterozygous mutation at codon 245 that converts glycine to aspartic acid (Srivastava et al., 1990; Mirzayans et al., 1995). The p53Asp245 protein is stable, displays an altered conformation and fails to bind DNA (Friend, 1994). The 2800T strain was obtained from a normal individual, however, it carries a heterozygous p53 mutation at codon 234 that replaces tyrosine with cysteine (Mirzayans et al., 1995). The p53Cys234 protein appears to have retained a normal conformation (Friend, 1994). We cultured the 2800T and 2675T strains and noticed that 2800T entered senescence after PD56, while 2675T continued to divide for a longer period of time prior to entering crisis after PD68. Analysis of the p53 gene revealed that the senescent 2800T cells remained heterozygous at the p53 locus, while 2675T lost the normal p53 allele at some point prior to entering crisis between PD41 and PD65. The 2675T cells remained in crisis for 230 days and no immortal (i.e. post-crisis) clones arose from this strain. 2675T cells at PD41 and PD65 were transfected with p21P-luc and luciferase was measured 72 h later. Luciferase activity was lower at PD65 than at PD41 (Figure 3F). These data indicate that complete loss of wild-type p53 gene expression in human fibroblasts is associated with a reduction in p21WAF1 promoter activity and with extension of cellular lifespan.

Short telomeres, premature senescence and increased DNA binding activity of p53 protein in AT strains

The ATM gene product has been proposed to lie upstream of p53 protein in the DNA damage response pathway that leads to cell cycle arrest at the G1/S boundary (Kastan et al., 1991; Lu and Lane, 1993). HDFs from individuals with ataxia telangiectasia display increased sensitivity to gamma-irradiation and certain strains undergo accelerated senescence in culture (Shiloh et al., 1982). In addition, disruption of the yeast TEL1 gene, which shows homology with the human ATM gene, results in accelerated loss of telomeric DNA (Greenwell et al., 1995). As a result of these findings, we wished to investigate further the connection between p53 function, aging and telomere loss in AT cells.

Fibroblasts were obtained from five AT patients and compared with fibroblasts from either their normal siblings or unrelated age-matched controls. For each cell strain we determined the number of population doublings that preceded senescence, mean terminal restriction fragment (TRF) length, the amount of p53 protein and the DNA binding activity of p53 protein. The results are presented in Figure 4. As expected, all the AT fibroblast strains reached senescence earlier than the normal strains. The mean TRF length, which reflects the length of telomeres, was shorter at the same PD in the AT strains 3487C and 1937B than in their sibling control 3492 and 3400 cells (Figure 4A and D). Of the remaining three AT strains, 3395B had a short TRF length and displayed premature senescence while 2052B and 2530 had longer telomeres (longer than controls) at early passage and continued to divide until they reached PD35 and PD38 respectively, at which time shortened telomeres were present (Figure 4D). This finding prompted us to compare the rate of telomere loss in AT strain 2530 with its age-matched normal control 3400. Accelerated telomere loss was observed in 2530 (267 bp/PD) compared with 3400 (60 bp/PD) cells. While these data strengthen the association between AT and the senescent phenotype, they indicate that involvement of the ATM gene in regulating telomere length and replicative senescence is likely to be complex.

Figure 4.

Figure 4 :

Analysis of replicative lifespan, telomeric DNA length and DNA binding activity of p53 protein in AT HDFs. (A) Genomic DNA from five normal (lanes 1–5) and five AT strains (lanes 6–10) were digested with HinfI/RsaI and telomeric DNA was detected using a gamma-32P-labeled (C3TA2)3 probe. The mean TRF length was determined from these data as described in Materials and methods and are indicated in (D). (B) (Bottom) EMSAs were performed with 5 mug nuclear extract from an AT strain (3487C) and its normal age-matched sibling (3492). Nuclear extracts were prepared at PD23 for both cell strains and were added to reactions containing end-labeled p53CON oligonucleotide and the p53-specific antibody PAb421. Lane 1, 3487C cell extract without antibody; lane 2, 3492 cell extract; lane 3, 3487C cell extract. (Top) A Western blot in which cell lysates (300 mug protein) were subjected to electrophoresis on a SDS–polyacrylamide gel, transferred to a nitrocellulose membrane and subsequently blotted with DO-1 antibody to detect p53 and a beta-tubulin control antibody. (C) Mean TRF length of AT strain 2530 was measured throughout its lifespan and compared with an age-matched normal control strain 3400. (D) Summary of data collected on normal and AT strains. Three AT strains had shorter telomeres and were entering senescence, while two AT strains with longer telomeres continued to proliferate further before entering premature senescence (indicated by PD max).

View full figure (86 KB)

In Figure 1 we showed that the DNA binding activity of p53 protein increased during cell aging in the absence of a marked increase in the steady-state level of p53 protein. Since certain AT strains have short telomeres and display accelerated aging in culture, we compared the DNA binding activity and steady-state level of p53 protein in the 3487C AT strain with its age-matched, normal sibling strain 3492 at the same population doubling. Enhanced DNA binding activity was evident in 3487C even though these AT cells contain less p53 protein than the normal sibling control 3492 (Figure 4B). These results indicate that the specific DNA binding activity of p53 protein is higher in the 3487C AT strain than in the normal sibling 3492 strain. Increased DNA binding activity was similarly observed in 1937B AT cells compared with the age-matched sibling control 3400 cells (data not shown). These data support the view that ATM is involved in the regulation of telomere length and that the DNA binding activity of p53 protein is post-translationally activated in aging cells.

Hyperoxia leads to accelerated telomere loss, functional activation of p53 protein and premature senescence

The cellular lifespan of human diploid fibroblasts can be affected by the oxygen concentration at which the cells are cultured. Cells have an extended lifespan under low oxygen conditions and a shortened lifespan under high oxygen (Chen et al., 1995; Saito et al., 1995). In addition, telomeres of HDFs grown under hyperoxia have been shown to undergo an accelerated rate of shortening (von Zglinicki et al., 1995). We wished to determine if the association between shortened telomeres, p53 activation and senescence could also be demonstrated in cells grown under hyperoxic conditions. WI-38 and BJ cells were cultured under normal oxygen (20%) or exposed to hyperoxia (40% oxygen). WI-38 and BJ cells were exposed to hyperoxia at PD27 and PD57 respectively and cultured under hyperoxic conditions for the duration of their lifespan. Both WI-38 and BJ cells lost telomeric DNA at an accelerated rate under hyperoxia and entered senescence prematurely (Figure 5A). BJ cells lost telomeric DNA at a rate of 66 bp/PD when grown at 20% O2 or at a rate of 486 bp/PD in hyperoxia (Figure 5A); WI-38 cells lost telomeric DNA at a rate of 70 bp/PD under normal oxygen or at a rate of 240 bp/PD in hyperoxia (data not shown). We then measured the relative level of p53 protein by Western blot analysis and the DNA binding activity of p53 by EMSA in cells grown under normal or hyperoxic conditions (Figure 5B and C). Normalization of the DNA binding values to the level of p53 protein revealed a 13-and a 2-fold increase in the specific DNA binding activity of p53 protein in WI-38 cells and BJ cells respectively upon exposure to hyperoxia. Consistent with this finding, the amount of p21 protein increased in hyperoxic cells to a level even higher than that seen in old cells (Figure 5B). Together these results indicate that hyperoxia leads to an accelerated loss of telomeric DNA beyond the level which can be explained by the end replication problem. The loss of telomeric DNA is associated with an increase in the specific activity of p53 protein, elevation of p21 protein expression and premature senescence.

Figure 5.

Figure 5 :

Hyperoxia leads to accelerated telomere loss, activation of p53 protein and premature senescence. (A) HinfI/RsaI-digested genomic DNA (1 mug) from WI-38 and BJ cells under normoxia and hyperoxia was resolved on a 0.5% agarose gel and subsequently probed with a gamma-32P-labeled (C3TA2)3 probe. Quantification of mean TRF length over the indicated PD range is shown for BJ cells under hyperoxia (dotted line and solid squares) and under normal oxygen (solid line and open circles). The rate of TRF loss observed under normal oxygen was 66 bp/PD (r = -0.82) and under hyperoxia, 486 bp/PD (r = -0.99). (B) Immunoblot analysis of p53 (DO-1) and p21 (SC-187) protein in young WI-38 cells under normal conditions and hyperoxic conditions and in old cells under normal conditions. (C) EMSA showing the increase in DNA binding activity of p53 in young and hyperoxic cells as described in Figure 1. Arrow 1 indicates the position of the supershifted band. (D) Quantification of DNA binding activity of p53 under normal and hyperoxic conditions. Values obtained by integration of the supershifted band (band 1) in Figure 5C and normalized to the values obtained from quantification of p53 protein in Figure 5B.

View full figure (60 KB)

Poly(ADP-ribose) polymerase and p53 protein interact in vitro and in vivo

The senescence-associated activation of p53 protein function seen in aging fibroblasts, AT fibroblasts and hyperoxic fibroblasts may be analogous to the post-translational activation of p53 protein that is observed in cells exposed to DNA damaging agents. Modifying enzymes that are activated in response to DNA damage, such as DNA-PK, SAPK and PARP, have been shown to modify p53 protein in vitro (Anderson, 1993; Wesierska et al., 1996) and, hence, represent potential physiological activators of p53 protein during aging or after DNA damage.

To investigate the interaction of p53 and PARP, purified full-length human p53 was mixed with purified full-length PARP (Huletsky et al., 1989). The mixture was subjected to immunoprecipitation with CM1 polyclonal antibody against p53, resolved by PAGE and processed for Western blotting to detect p53 (with a mixture of PAb7 and PAb240 antibodies) and bound PARP (C2-10 antibody). The immunoblot presented in Figure 6A shows that PARP co-immunoprecipitated with p53. In order to map the region of p53 that interacts with PARP, several truncated forms of p53 protein were prepared and mixed with full-length PARP for immunoprecipitation/Western blot analysis. As shown in Figure 6B, both an N-terminal p53 fragment (amino acids 1–72) and a C-terminal p53 fragment (311–393), but not the DNA binding domain of p53 (82–292), were able to interact with PARP. The binding with PARP was much stronger with the N-terminal fragment of p53.

Figure 6.

Figure 6 :

(A) Interaction of full-length human p53 with PARP in vitro. p53 (0.5 mug) and PARP were mixed, incubated and subsequently immunoprecipitated with CM1 antibody against p53 as described in Materials and methods. Immune complexes were subjected to immunoblotting with PAb7 and C2-10 to detect p53 and PARP respectively. (B) Full-length purified PARP was mixed with different purified fragments of p53 protein as indicated and subjected to immunoprecipitation and immunoblotting with PAb7, PAb240 and C2-10. DB, DNA binding domain, residues 82–292; N, residues 1–72; C, residues 311–393. (C) Interaction between PARP and p53 protein in vivo. Cell extracts were prepared from untreated or gamma-irradiated wild-type p53-expressing cells (OCI/AML-3) or p53-null cells (SKOV3), 1–2.5 h after treatment with a dose of 2 or 6 Gy. Proteins were immunoprecipitated with antibodies against p53 (PAb1801, PAb240 and PAb421), antibodies against PARP (318) or control IgG antibodies. Immunoprecipitated proteins were resolved by SDS–PAGE, transferred to nitrocellulose membranes and blotted with a mix of C2-10 and 318 antibodies specific for PARP (top) or with PAb7 antibodies directed against p53 (bottom). (D) Nuclear extracts were prepared in low pH buffer from young and old cells and mixed with 32P-labeled p53CON. The DNA binding reactions were supplemented with PAb421 antibodies or a mixture of PAb421 and 318 antibodies and analyzed on a native polyacrylamide gel (pH 6.8). (E) OCI/AML-3 cells were incubated in the presence of 200 muM IQ or in DMSO (control) for 1 h prior to gamma-irradiation (2 Gy). Twenty minutes after irradiation, a second equivalent dose of IQ was added to the cells that had received IQ earlier. At different times after irradiation cell extracts were prepared and samples containing 400 mug protein were subjected to sequential immunoblotting with the following antibodies: PAb1801 (p53), SC-187 (p21), 2A10 (mdm2) and anti-beta tubulin.

View full figure (70 KB)

To investigate this interaction in vivo, cell extracts were prepared from the wild-type p53-expressing human cell line OCI/AML-3 (Fu et al., 1996) and subjected to immunoprecipitation with antibodies against p53 (PAb1801, PAb240 or PAb421) or PARP (318). The immunoprecipitates were resolved by PAGE, proteins were transferred to nitrocellulose membranes and probed with a mixture of antibodies against PARP (C2-10 and 318) or p53 (PAb7). The results of this co-immunoprecipitation/Western blot analysis indicate that p53 protein and PARP form a complex in vivo. Three antibodies directed against different epitopes of p53 co-immunoprecipitated bound PARP (Figure 6C, top) in addition to p53 protein (Figure 6C, bottom). Moreover, in the reciprocal experiment antibodies against PARP co-immunoprecipitated bound p53. An extract prepared from the p53-null cell line SKOV3 served as a control. Although certain extracts used for this experiment were prepared from gamma-irradiated cells (2 or 6 Gy) in order to increase the amount of p53 protein and facilitate detection of complexes with PARP, the interaction between p53 and PARP was also seen in non-irradiated cells. Of the three p53 antibodies used, PAb1801 was the least effective in co-immunoprecipitating the bound PARP. One explanation for this observation is afforded by the peptide mapping experiments, which revealed that PARP bound tightly to the N-terminal fragment of p53. PAb1801 also binds to the N-terminus of p53 and could disrupt the interaction between PARP and p53. Alternatively the interaction between p53 and PARP may prevent access of PAb1801 to its binding site. Two other antibodies that recognize epitopes at the N-terminus of p53, DO-1 and DO-7, failed to co-immunoprecipitate PARP (data not shown).

The PARP–p53 interaction was investigated further using gel mobility shift experiments to assay for p53–DNA binding activity to the previously described p53 binding sequence p53CON. Nuclear extracts from young and old HDFs were incubated with p53CON. The binding reactions were supplemented with PAb421 or a mixture of PAb421 and 318 antibodies. The results presented in Figure 6D show that p53–DNA complexes can be recognized and supershifted with antibodies to p53 (band B) and that these supershifted complexes can be further shifted upon incubation with antibodies to PARP (band A). Inclusion of the PARP antibody alone in the binding reaction resulted in a supershifted band with a mobility very similar to that seen with the PAb421 antibody (data not shown). These results confirm the existence in vivo of a p53–PARP complex with DNA binding activity.

Inactivation of PARP leads to extinction of p21 and mdm2 expression in response to DNA damage

If the interaction with PARP regulates the activity of p53 protein in response to DNA damage, then it is possible that inhibition of PARP leads to abrogation of p53–DNA binding activity and of the expression of downstream targets of p53. Cells irradiated with 2 Gy showed an increase in the amount of p53 protein and an elevation in the level of p21 and mdm2 proteins (Figure 6E). However, prior treatment of the cells with the specific PARP inhibitor 1,5-dihydroxyisoquinoline (IQ), prevented the increase in expression of p21 and mdm2 after irradiation without affecting accumulation of p53 protein. Treatment with IQ also diminished and delayed the increased DNA binding activity that is normally seen after irradiation (data not shown). This indicates that mechanisms involved in accumulation of p53 protein in response to DNA damage are uncoupled from those affecting its activation.

Inactivation of PARP leads to an extension of lifespan in HDFs

The demonstration that p53 is involved in cellular senescence coupled with the observation that PARP, an enzyme which is strongly activated by binding to DNA single- or double-strand breaks, can associate with p53 protein in vivo raises the question of PARP involvement in modulating cellular lifespan. PARP may sense DNA damage directly and relay the signal to p53 protein, resulting in functional activation of p53. One prediction of this model is that in the presence of a PARP inhibitor p53 may not become activated and cells would have an extended lifespan. To test this model, HDFs were treated with inhibitors of PARP, namely 3-aminobenzamide (3AB), having an IC50 of 23 muM, and the more specific inhibitor IQ, having an IC50 of 0.39 muM (Banasik et al., 1992). We recognize the possibility that these two inhibitors may target NAD-dependent enzymes other than PARP. However, it has been shown previously that IQ has specificity for PARP in vivo and that it does not significantly change the NAD+ pool in vivo (Shah et al., 1996). 3AB-treated cells showed a significant extension of cellular lifespan, as did the IQ-treated cells (Figure 7). Removal of the PARP inhibitors led to restoration of normal lifespan and subsequent senescence (data not shown). Hence, functional inactivation of PARP or functional inactivation of p53 leads to a common phenotype, namely extension of cellular lifespan. This supports the idea that PARP and p53 are both components of a senescence-determining pathway.

Figure 7.

Figure 7 :

Extension of cellular lifespan by PARP inhibitors. WI-38 cells were grown in the presence of 100 mum IQ (A) or in the absence of IQ (B). Growth curves of WI-38 cells incubated in the presence of different concentrations of 3AB (C) or IQ (D).

View full figure (100 KB)

Discussion

Top

There is substantial evidence that cellular senescence is associated with elevated expression of the p21WAF1 gene and with a decrease in the size of telomeres. The p53 nuclear phosphoprotein has also been implicated in senescence, since it can activate expression of the p21WAF1 gene by binding to the p53-responsive element within the p21WAF1 promoter. Moreover, the DNA binding activity of p53 has been shown to increase in aging fibroblasts and disruption of p53 protein function has been reported to extend the proliferative lifespan of human fibroblasts. The data we present here extend these observations and demonstrate that binding of p53 to a physiologically relevant binding site in the p21WAF1 promoter increases in old cells. We show that expression of the p21WAF1 gene in aging fibroblasts is regulated by p53 and by the transcriptional co-activator p300, which was previously shown to regulate the p21WAF1 promoter independently of p53 (Missero et al., 1995). The increased p53-dependent transcriptional activity of the IGF-BP3 promoter in old cells (Figure 3A) also provides an explanation for the up-regulation of IGF-BP3 with cell age (Goldstein et al., 1991). In agreement with previous studies we find that the steady-state level of p53 protein does not change markedly as cells age in culture. These observations suggest that p53 protein is post-translationally activated in aging cells and that one of its functions is to control expression of p21WAF1.

We and others have detected higher levels of p53 protein in old cells compared with young cells when extracts were immunoprecipitated with PAb1801 or PAb421 antibodies prior to Western blotting (Kulju and Lehman, 1995; Vaziri and Benchimol, 1996). Immunoblotting without prior immunoprecipitation revealed similar levels of p53 protein in young and old cells. These observations suggest that p53 protein undergoes a change in conformation during cellular aging that exposes epitopes at the termini of the molecule. The altered conformation may have relevance with respect to the increased DNA binding (Figure 1) and transcriptional activity of p53 (Figure 3).

In AT cells that have short telomeres and consequently reach senescence after fewer population doublings we found that p53 protein had increased DNA binding activity compared with age-matched normal controls at the same population doubling. These data are consistent with the results obtained with aging normal fibroblasts and demonstrate an association between the DNA binding activity of p53 and cellular lifespan that is independent of p53 protein level.

Amongst the five AT fibroblast strains examined, we found heterogeneity with respect to telomere length. Three strains had short telomeres and senesced prematurely, while two strains with longer telomeres at the time of analysis displayed a higher proliferative capacity in culture. Nevertheless, these strains had an accelerated rate of telomere shortening and underwent premature senescence. These data are consistent with the idea that the ATM gene plays a role in determining cellular lifespan. However, the involvement of ATM in regulating telomere length is likely to be complex.

A number of studies have concluded that the p53-dependent DNA damage response is defective or attenuated in gamma-irradiated AT cells (Kastan et al., 1991; Lu and Lane, 1993). It may not be appropriate, however, to compare the activity of p53 protein in response to gamma-irradiation in AT and normal cells or even the radiosensitivity of AT cells with normal cells. AT cells have a shorter lifespan than normal cells and, hence, at the time of analysis these cells will have completed a far greater proportion of their total lifespan than normal cells. AT cells may be approaching the end of their proliferative lifespan, while normal cells at the same population doubling will still retain considerable proliferative potential. It has been shown, for example, that the radiation sensitivity of normal fibroblasts could change with age in culture (Holliday, 1991).

Hyperoxia results in premature senescence and an accelerated rate of telomere shortening that cannot be accounted for by the end replication problem associated with the inability to fully replicate DNA at the ends of chromosomes during each round of DNA replication. Premature senescence resulting from hyperoxia, like the premature senescence seen in AT fibroblasts, is associated with shortened telomeres and with the post-translational activation of p53 protein.

We provide several lines of evidence to show that p53 and PARP interact: (i) binding occurs in vitro using purified components; (ii) binding in vivo can be demonstrated by co-immunoprecipitation of PARP using three antibodies against distinct epitopes of p53 and by co-immunoprecipitation of p53 with an antibody against PARP; (iii) PARP can be detected on p53–DNA complexes by antibody supershift experiments. An association between p53 and PARP in vitro was recently reported (Wesierska et al., 1996). Chemical inhibition of PARP activity with IQ resulted in abrogation of the p53-mediated induction of p21 and mdm2 expression normally seen in gamma-irradiated cells. Our findings are consistent with the observation that the p53 response to DNA damage is defective in cells with PARP deficiency (Whitacre et al., 1995). These data indicate that the interaction between PARP and p53 is critical for p53 function in response to DNA damage signals. While p53 activity was disrupted by the inhibition of PARP activity, accumulation of p53 protein in response to irradiation was not greatly affected. This provides compelling evidence that accumulation and activation of p53 protein in response to irradiation represent separate events that can be completely uncoupled. PARP activity is required for p53 protein activation but is dispensable for p53 protein accumulation.

Since PARP is known to become activated in response to DNA damage, it is possible that PARP acts as a DNA damage sensor that relays the telomere loss signal to p53. To investigate the presumed involvement of PARP in senescence, we rendered cells deficient in PARP activity through the use of two chemical inhibitors, 3-AB and IQ. Both inhibitors were effective in extending cellular lifespan. We conclude that PARP is involved in cellular aging. Hence, inactivation of at least two proteins, p53 and PARP, leads to a similar phenotype, namely extension of cellular lifespan. These findings suggest a model in which PARP, in response to the DNA ends which accumulate in aging cells, possibly as a consequence of dicentric chromosome breakage, activates p53 protein (Figure 8).

Figure 8.

Figure 8 :

Model connecting telomere loss signal and senescence-associated growth arrest. Telomere loss as a consequence of an end replication problem or direct damage to telomeres by free oxygen radicals may initiate a series of events leading to formation of dicentric chromosomes, which upon subsequent breakage activate PARP and p53 protein. p53-dependent/independent transcriptional activation of genes such as p21 and IGF-BP3 leads to cessation of proliferation and the cell cycle arrest associated with senescence.

View full figure (47 KB)

The p53–PARP interaction may affect p53 protein function in at least two ways. First, it is possible that p53 is ADP-ribosylated by PARP in response to DNA damage or cellular aging. ADP-ribosylation may be the mechanism through which p53 protein is post-translationally activated in aging cells or in cells that have acquired DNA damage. Inhibition of poly(ADP-ribose) synthesis would prevent the activation of p53 and, hence, no mdm2 or p21 expression would be triggered. In a second, alternative model, PARP may regulate p53 function in the absence of enzymatic modification. PARP is known to bind tightly to DNA ends and strand breaks and requires automodification (i.e. ADP-ribosylation) for release from DNA. Binding of p53 to PARP at such sites will similarly sequester p53 and prevent it from acting as a transcriptional factor. The addition of an inhibitor of poly(ADP-ribose) synthesis will prevent the release of PARP and associated proteins such as p53 from the DNA ends. Under these conditions p53 would be incapable of promoting transcription. Further experiments are needed to determine which of these two models is correct. It will be important, for example, to determine if p53 protein is ADP-ribosylated in vivo.

Mice deficient in PARP activity have been generated (Wang et al., 1995). These mice are born healthy and fertile. However, proliferation of primary embryonic fibroblasts in culture was impaired and proliferation of thymocytes in vivo following gamma-irradiation was delayed. While the normal lifespan of these mice may seem to be at odds with the model presented in Figure 8, we believe that it is inappropriate to compare the lifespan of inbred mice having long telomeres in excess of 100 kb with that of human cells which have much shorter telomeres. It should be noted in this context that PARP activity is positively correlated with the lifespan of various species (Grube and Burkle, 1992). PARP activity may be dispensable in animals with a short lifespan.

In summary, our results provide a model for events which lead to activation of the genetic program of cellular aging and identify several key molecules involved in the p53 pathway for growth arrest. Knowledge of the molecular mechanisms involved in cell aging will be important for future drug design to extend the lifespan of normal cells and for the therapeutic intervention in and treatment of aging-associated diseases. Furthermore, these studies have relevance for the therapeutic eradication of immortal tumor cells through re-initiation of the senescence pathway.

Materials and methods

Top

Cell culture and transfection

Cells were grown at 37°C in a humidified atmosphere of 5% CO2 in air. All cells were cultured in alpha-minimal essential medium supplemented with 10% fetal bovine serum (FBS), except for AT strains, which were grown in 20% FBS. Subconfluent cultures were split 1:8 in early passage and 1:4 or 1:2 in mid to late passage, using 0.25% trypsin/EDTA. Phosphate buffered saline (PBS) contained no calcium or magnesium. The normal HDFs used in this study included MRC-5 (ATCC), WI-38 (ATCC), S1C (age 45 years), F1 (age 26 years), P4 (age 12 years), F28 (age 8 years) and BJ (fetal foreskin). The 3400 (age 11 years) and 3492 (age 7 years) cells were obtained from the Coriell Institute. The following AT strains were obtained from the Coriell Institute: 1937B (age 24 years), 3395B (age 13 years), 3487C (age 8 years), 2530 (age 8 years) and 2052B (age 15 years). The 2675T and 2800T fibroblasts strains were derived from members of a Li–Fraumeni syndrome family and were kindly provided by Dr M.C.Paterson (University of Alberta). OCI/AML-3 is a wild-type p53-expressing cell line established from the primary blasts of a patient with acute myelogenous leukemia (Fu et al., 1996). SF1 is an SV40-immortalized HDF cell line.

Cells were defined as being young if they had completed <30–40% of their lifespan and as being old if they had completed >85–90% of their lifespan. Senescence was defined as the inability to divide over a 3 week period. FACS analysis by propidium iodide staining and BrdU pulse labeling was used to confirm that old cells were arrested at the G1/S and G2/M boundaries as described previously (Sherwood et al., 1988).

Transfection experiments were carried out by electroporation (to generate stable clones) or by the DEAE–dextran method (Kriegler, 1991) using triplicate dishes per plasmid DNA for transient expression studies. For electroporation HDFs, when 70% confluent, were trypsinized, washed in PBS, collected and mixed with the appropriate plasmids, p21P-luc, p21DeltaP-luc or pSV2-E6 (20 mug), in combination with pSV2neo (2 mug). Cells were electroporated using a Bio-Rad gene pulser at 150–300 V, 960 muF. Cells were selected in medium containing 400 mug/ml G418 and clones were isolated using cloning rings.

For inhibition of PARP varying amounts of 3-AB (Sigma) (0, 10 or 100 muM or 1 mM) or IQ (Aldrich) (0, 0.01, 1 or 100 muM) were added to the cells, which were plated at a density of 105 cells/cm2 in 6-well plates.

Hyperoxic conditions

A tri-gas water-jacketed incubator from Forma Scientific (Model 3327) was used to culture cells under hyperoxia. BJ and WI-38 cells were exposed to hyperoxia (40% oxygen) at 50% confluency at PD57 and PD27 respectively. After several weeks in culture the BJ and WI-38 cells stopped dividing at PD60 and PD32 respectively. Control cells were maintained under normal oxygen conditions. Cells were grown in DMEM-M199 medium supplemented with 10% FBS and gentamicin (50 mg/l). Cells were re-fed weekly and split 1:2 upon achieving confluency.

Plasmid constructs

All plasmids were purified using Qiagen columns and quantified with a fluorometer (Turner Model 450) used within the linear range. A 2.4 kb DNA fragment derived from the endogenous human p21WAF1 promoter present in the plasmid wwp-luc (El-Deiry et al., 1993) was digested with HindIII and subcloned in the HindIII site of the pGL3-Basic vector (Promega) in the correct orientation, to generate p21P-luc. p21DeltaP-luc was constructed by digestion of p21P-luc with SacI, which cuts once within the p21WAF1 promoter at the extreme 5'-end and once within the polylinker of the vector, followed by re-ligation of the plasmid. The plasmids were sequenced and deletion of a 72 bp fragment in p21DeltaP-luc containing the p53 consensus binding site was confirmed. The pGL3-control vector expresses luciferase under control of the SV40 promoter. CMV-wtp53, p53Ala143 and p53Tyr275 are plasmids containing full-length p53 cDNA under control of the CMV promoter. pSV2-E6, pSV2-E7 and pSV2-E6/E7 contain genes derived from HPV-16 under control of the SV40 promoter (Watanabe et al., 1989). pLE2/520 expresses wild-type E1A; dl1101 and dl1143 express E1A deletion mutants competent for binding to pRB but unable to bind p300; dl1108 expresses a mutant E1A protein which binds to p300 but is unable to bind pRB (Barbeau et al., 1994).

Plasmid construction and purification of human p53 proteins

The nucleotide sequences encoding residues 1–72, 82–292 and 311–393 of wild-type human p53 were subcloned into the pET19b vector using standard techniques and their correct incorporation confirmed by sequencing. The resulting plasmids express 10 histidine residues followed by a linker containing an enterokinase cleavage site and a His-Met dipeptide immediately N-terminal to the p53 sequence. Escherichia coli BL21(DE3)-(pLys-S) harboring the desired plasmid were grown in 2 l batches of Luria broth at 37°C (p53:1–72 and p53:311–393) or 25°C (p53:82–292) and protein production was induced with 1 mM isopropylthiogalactose at an optical density (600 nm) of 0.6–0.7. Three hours post-induction cells were harvested by centrifugation at 6000 g for 30 min. His-tagged proteins were purified from cell extracts by Nickel affinity chromatography and dialyzed for 24 h at 4°C against 4 l buffer (25 mM sodium phosphate, 100 mM NaCl, pH 7.0 or 7.4) using Spectra/por 3000 molecular weight cut-off dialysis membrane. Protein concentrations were determined spectrophotometrically using the appropriate theoretical extinction coefficient.

Electrophoretic mobility shift assays (EMSAs)

Nuclear extracts were prepared from cells washed with PBS and immediately lysed on ice in buffer A [20 mM Tris, pH 7.4, 20% glycerol, 10 mM NaCl, 1.5 mM MgCl2, 5 mM EDTA, 0.1% NP-40, 2 mM Pefabloc (Boehringer Mannheim), 70 mug/ml aprotinin, 50 mug/ml leupeptin]. The nuclear pellet was resuspended in buffer B (as buffer A except for 100 mM NaCl, 1% NP-40). The mixture was kept on ice for 15 min, spun and the supernatant used immediately. The binding reaction contained 0.1 mug PAb421, 1 mug poly(dI-dC), 5 mul nuclear extract (4 mug protein), 32P-labeled double-stranded p53CON oligonucleotide (105 c.p.m.) containing the p53 consensus binding site (Funk et al., 1992), shown underlined (GGATCCAAGCTTGGACATGCCCGGGCATGTCCCTCGAGGGATCC), in a final concentration of 100 mM NaCl, 5 mM EDTA, 20 mM Tris, pH 7.4. A fill-in reaction was used to label the oligonucleotide using Klenow DNA polymerase, [alpha-32P]dCTP and the antisense oligonucleotide (GGATCCCTCGAG). In some experiments a competitor oligonucleotide of the same base composition and length as p53CON was used. The reactions were incubated at room temperature for 20 min and samples were analyzed on a 4% non-denaturing polyacrylamide gel run at 200 V for 3 h. Gels were dried and exposed to a PhosphorImager screen for 3–5 days. Supershifted bands generated within the linear range of the DNA binding assay were quantified on a PhosphorImager (Molecular Dynamics) using ImageQuant software.

Immunoprecipitation, Western blot analysis and immunohistochemistry

Cells washed on ice with PBS were lysed either in lysis buffer C [1% NP-40, 150 mM NaCl, 20 mM Tris, pH 8.0, 2 mM Pefabloc (Boehringer Mannheim), 70 mug/ml aprotinin, 50 mug/ml leupeptin, 20 mug/ml pepstatin A, 500 mM EDTA] or SUG buffer (3% SDS, 125 mM Tris, pH 6.8, 6% urea, 10% glycerol and all of the above protease inhibitors). For immunoprecipitations lysates (1 mg) prepared using lysis buffer C were mixed with one of the following antibodies: PAb1801 (human p53-specific); PAb421 (panspecific p53); SC-187 (p21-specific); 318 (PARP-specific polyclonal). The immune complexes were collected with 100 mul protein G–Sepharose beads (Pharmacia). For analysis of PARP the samples were subjected to sonication for 20 s prior to immunoprecipitation. Protein quantification was performed using a modified Lowry assay (Sigma). An equal volume of 2times protein sample buffer was added to cell extracts adjusted to contain equivalent amounts of protein, boiled and loaded on 10% polyacrylamide gels containing SDS. Proteins were transferred to nitrocellulose membranes. The p53 protein was detected using DO-1, PAb1801 or PAb7 antibodies (Oncogene Science). CM1 is a polyclonal rabbit antibody raised against human p53 (Dimension Labs). PARP was detected using C2-10 monoclonal antibody. The protein–antibody complexes were detected using an HRP-conjugated secondary antibody using the super-signal enhanced chemiluminescence system (Pierce).

p21 protein was detected by immunohistochemistry using the Vectastain ABC kit (Dimension Labs) as suggested by the manufacturer. In brief, cells were fixed with 70% ethanol, blocked with 5% horse serum and washed with PBS containing 0.05% Tween-20. After incubation in a 1:200 dilution of SC-187 primary antibody (Santa Cruz) for 30 min, cells were incubated with a biotinylated secondary antibody for 10 min and treated with 3% H2O2 for 1 min.

Luciferase assay

Cells were lysed 72 h after transfection with p21P-luc or p21DeltaP-luc and the protein content of each extract was determined. Luciferase activity was measured using the luciferase assay reagent (Promega). Light emission over a 30 s interval was measured in a Berthold LB 9507 luminometer. A modified Hirt procedure (Matsuoka et al., 1990) was used to extract plasmid DNA from cells. Linearized plasmid DNA was run on a 0.8% agarose gel; the gel was dried and subsequently probed with a gamma-32P-end-labeled oligonucleotide (5'ATTACCAGGGATTTCAGTCG) specific for the luciferase coding sequence. Band intensities were quantified on a PhosphorImager (Molecular Dynamics) to provide an estimate of relative plasmid copy number in the transfected cells and, hence, a measure of transfection efficiency. This is preferred over co-transfection with a beta-galactosidase vector, for example, for several reasons: endogenous beta-galactosidase activity in HDFs increases with age (Dimri et al., 1995); measurement of beta-galactosidase activity provides only an indirect measure of transfection efficiency; p53 is known to modulate the activity of a large number of different promoters in co-transfection experiments. The RLUs (relative light units) obtained from the luciferase assay were normalized for differences in transfection efficiency in this way.

Isolation of DNA, SSCP analysis and measurement of telomeric DNA length

Cells were washed three times in PBS. Cell pellets was resuspended in proteinase K digestion buffer (100 mM NaCl, 10 mM Tris, pH 8, 5 mM EDTA, 0.5% SDS) containing proteinase K at a final concentration of 0.5 mg/ml. After incubation at 48°C overnight, the DNA was extracted once with phenol/chloroform/isoamyl alcohol (25:24:1) and once with chloroform. DNA was precipitated with 95% ethanol and dissolved in TE (10 mM Tris, pH 8, 1 mM EDTA, pH 8).

DNA (10 mug) was digested with HinfI and RsaI (20 U each; BRL), extracted as described above, precipitated with 95% ethanol, washed in 70% ethanol, resuspended in TE and quantified by fluorometry using a Turner model 450 fluorometer. One microgram of digested DNA was resolved by electrophoresis on a 0.5% agarose gel poured on a Gel bound membrane (FMC Bioproducts) and run for 700 V h. Gels were dried, denatured, neutralized and probed with a gamma-32P-5'-end-labeled (CCCTAA)3 oligonucleotide as described (Vaziri et al., 1993). Gels were exposed to a PhosphorImager screen and the hybridization signals were digitized and subdivided into 1 kbp to 21 kbp for calculation of the mean TRF length (L) using the formula L = Sigma(ODi*Li)/SigmaODi, where ODi is the integrated photon signal in interval i and Li is the TRF length at the midpoint of interval i.

SSCP analysis of p53 genomic DNA from Li–Fraumeni cells was performed as previously described (Mitsudomi et al., 1992) in young cells and during senescence and crisis.



Acknowledgements

Top

We thank Drs Silvia Bacchetti, Calvin Harley, Roger Reddel and Mike Tyers for discussions and critical reading of the manuscript, Dr Phil Branton for providing the E1A mutants, Dr Bert Vogelstein for wwp-luc, Dr Nikolai Kley for IGF-BP3 Box-A, Dr Chris Richardson for baculovirus-purified wild-type human p53 protein and Peter Yin for help with p53 constructs. We also wish to thank an anonymous reviewer for suggesting that the interaction of PARP with p53 may serve to sequester p53. This work was supported by grants from the Medical Research Council of Canada (S.B.), the National Cancer Institute of Canada (S.B. and C.H.A.) and The Cancer Research Society Inc (C.H.A.). C.H.A. is an MRC research scholar and R.A. was supported by an MRC post-doctoral fellowship. H.V. holds an MRC studentship award.

References

Top

Allsopp RC and Harley CB (1995) Evidence for a critical telomere length in senescent human fibroblasts. Exp Cell Res, 219, 130–136. | Article | PubMed | ISI | ChemPort |

Allsopp RC, Vaziri H, Patterson C, Goldstein S, Younglai EV, Futcher AB, Greider CW and Harley CB (1992) Telomere length predicts replicative capacity of human fibroblasts. Proc Natl Acad Sci USA, 89, 10114–10118. | Article | PubMed | ChemPort |

Anderson CW (1993) DNA damage and the DNA-activated protein kinase. Trends Biochem Sci, 18, 433–437. | Article | PubMed | ISI | ChemPort |

Atadja P, Wong H, Garkavtsev I, Veillette C and Riabowol K (1995) Increased activity of p53 in senescing fibroblasts. Proc Natl Acad Sci USA, 92, 8348–8352. | Article | PubMed | ChemPort |

Banasik M, Homura H, Shimoyama M and Ueda K (1992) Specific inhibitors of poly(ADP-ribose) synthesis and mono(ADP-ribosyl) transferase. J Biol Chem, 267, 1569–1575. | PubMed | ISI | ChemPort |

Barbeau D, Charbonneau R, Whalen SG, Bayley ST and Branton PE (1994) Functional interactions within adenovirus E1A protein complexes. Oncogene, 9, 359–373. | PubMed | ISI | ChemPort |

Benn P (1976) Specific chromosome alterations in senescent fibroblast cell lines derived form human embryos. Am J Hum Genet, 28, 465–473. | PubMed | ISI | ChemPort |

Bischoff FZ, Yim SO, Pathak S, Grant G, Siciliano MJ, Giovanella BC, Strong LC and Tainsky MA (1990) Spontaneous abnormalities in normal fibroblasts from patients with Li–Fraumeni cancer syndrome: aneuploidy and immortalization. Cancer Res, 50, 7979–7984. | PubMed | ISI | ChemPort |

Bond JA, Wyllie FS and Wynford-Thomas D (1994) Escape from senescence in human diploid fibroblasts induced directly by mutant p53. Oncogene, 9, 1885–1889. | PubMed | ISI | ChemPort |

Buckbinder L, Talbott R, Velasco-Miguel S, Takenaka I, Faha B, Seizinger BR and Kley N (1995) Induction of the growth inhibitor IGF-binding protein 3 by p53. Nature, 377, 646–649. | Article | PubMed | ISI | ChemPort |

Chen Q, Fischer A, Reagan JD, Yan LJ and Ames BN (1995) Oxidative DNA damage and senescence of human diploid fibroblast cells. Proc Natl Acad Sci USA, 92, 4337–4341. | Article | PubMed | ChemPort |

Counter CM, Avilion AA, LeFeuvre CE, Stewart NG, Greider CW, Harley CB and Bacchetti S (1992) Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J, 11, 1921–1929. | PubMed | ISI | ChemPort |

Datto MB, Li Y, Panus JF, Howe DJ, Xiong Y and Wang XF (1995) Transforming growth factor beta induces the cyclin-dependent kinase inhibitor p21 through a p53-independent mechanism. Proc Natl Acad Sci USA, 92, 5545–5549. | Article | PubMed | ChemPort |

Di Leonardo A, Linke SP, Clarkin K and Wahl GM (1994) DNA damage triggers a prolonged p53-dependent G1 arrest and long-term induction of Cip1 in normal human fibroblasts. Genes Dev, 8, 2540–2551. | Article | PubMed | ISI | ChemPort |

Dimri GP et al.(1995) A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci USA, 92, 9363–9367. | Article | PubMed | ChemPort |

Dulic V, Kaufmann WK, Wilson SJ, Tlsty TD, Lees E, Harper JW, Elledge SJ and Reed SI (1994) p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced G1 arrest. Cell, 76, 1013–1023. | Article | PubMed | ISI | ChemPort |

El-Deiry WS et al.(1993) WAF1, a potential mediator of p53 tumour suppression. Cell, 75, 817–825. | Article | PubMed | ChemPort |

Friend S (1994) p53: a glimpse at the puppet behind the shadow play. Science, 265, 334–335. | PubMed | ISI | ChemPort |

Fu L, Minden MD and Benchimol S (1996) Translational regulation of human p53 gene expression. EMBO J, 15, 4392–4401. | PubMed | ISI | ChemPort |

Funk WD, Pak DT, Karas RH, Wright WE and Shay JW (1992) A transcriptionally active DNA-binding site for human p53 protein complexes. Mol Cell Biol, 12, 2866–2871. | PubMed | ISI | ChemPort |

Goldstein S, Moerman EJ, Jones RA and Baxter RC (1991) Insulin-like growth factor binding protein 3 accumulates to high levels in culture medium of senescent and quiescent human fibroblasts. Proc Natl Acad Sci USA, 88, 9680–9684. | Article | PubMed | ChemPort |

Gollahon LS and Shay JW (1996) Immortalization of human mammary epithelial cells transfected with mutant p53 (273his). Oncogene, 12, 715–725. | PubMed | ISI | ChemPort |

Greenwell PW, Kronmal SL, Porter SE, Gassenhuber J, Obermaier B and Petes TD (1995) TEL1, a gene involved in controlling telomere length in S. cerevisiae, is homologous to the human ataxia telangiectasia gene. Cell, 82, 823–829. | Article | PubMed | ISI | ChemPort |

Grube K and Burkle A (1992) Poly(ADP-ribose) polymerase activity in mononuclear leukocytes of 13 mammalian species correlates with species-specific life span. Proc Natl Acad Sci USA, 89, 11759–11763. | Article | PubMed | ChemPort |

Harley CB (1991) Telomere loss: mitotic clock or genetic time bomb? Mutat Res, 256, 271–282. | Article | PubMed | ISI | ChemPort |

Harley CB, Futcher AB and Greider CW (1990) Telomeres shorten during ageing of human fibroblasts. Nature, 345, 458–460. | Article | PubMed | ISI | ChemPort |

Harper JW, Adami GR, Wei N, Keyomarsi K and Elledge SJ (1993) The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell, 75, 805–816. | Article | PubMed | ISI | ChemPort |

Hastie ND, Dempster M, Dunlop MG, Thompson AM, Green DK and Allshire RC (1990) Telomere reduction in human colorectal carcinoma and with ageing. Nature, 346, 866–868. | Article | PubMed | ISI | ChemPort |

Hayflick L and Moorhead P (1961) The serial cultivation of human diploid strains. Exp Cell Res, 25, 585–621. | Article | ISI

Holliday R (1991) A re-examination of the effects of ionizing radiation on lifespan and transformation of human diploid fibroblasts. Mutat Res, 256, 295–302. | Article | PubMed | ISI | ChemPort |

Howe JA, Mymryk JS, Egan C, Branton PE and Bayley ST (1990) Retinoblastoma growth suppressor and a 300-kDa protein appear to regulate cellular DNA synthesis. Proc Natl Acad Sci USA, 87, 5883–5887. | Article | PubMed | ChemPort |

Huang LC, Clarkin KC and Wahl GM (1996) Sensitivity and selectivity of the DNA damage sensor responsible for activating p53-dependent G1 arrest. Proc Natl Acad Sci USA, 93, 4827–4832. | Article | PubMed | ChemPort |

Huletsky A, de Murcia G, Muller S, Hengartner M, Lamarre D and Poirier GG (1989) The effect of poly(ADP-ribosyl)ation on native and H1-depleted chromatin. A role of poly(ADP-ribosyl)ation on core nucleosome structure. J Biol Chem, 264, 8878–8886. | PubMed | ISI | ChemPort |

Kastan MB, Onyekwere O, Sidransky D, Vogelstein B and Craig RW (1991) Participation of p53 protein in the cellular response to DNA damage. Cancer Res, 51, 6304–6311. | PubMed | ISI | ChemPort |

Kastan MB, Zhan Q, el-Deiry WS, Carrier F, Jacks T, Walsh WV, Plunkett BS, Vogelstein B and Fornace AJJr (1992) A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell, 71, 587–597. | Article | PubMed | ISI | ChemPort |

Kim NW et al.(1994) Specific association of human telomerase activity with immortal cells and cancer. Science, 266, 2011–2015. | Article | PubMed | ISI | ChemPort |

Kriegler M (1991) Gene Transfer and Expression. Stockton Press, New York.

Kulju KS and Lehman JM (1995) Increased p53 protein associated with aging in human diploid fibroblasts. Exp Cell Res, 217, 336–345. | Article | PubMed | ISI | ChemPort |

Lindahl T, Satoh MS, Poirier GG and Klungland A (1995) Post-translational modification of poly(ADP-ribose) polymerase induced by DNA strand breaks. Trends Biochem Sci, 20, 405–411. | Article | PubMed | ISI | ChemPort |

Lindsey J, McGill NI, Lindsey LA, Green DK and Cooke HJ (1991) In vivo loss of telomeric repeats with age in humans. Mutat Res, 256, 45–48. | Article | PubMed | ISI | ChemPort |

Lu X and Lane DP (1993) Differential induction of transcriptionally active p53 following UV or ionizing radiation: defects in chromosome instability syndromes? Cell, 75, 765–778. | Article | PubMed | ISI | ChemPort |

Matsuoka M, Yoshida K, Maeda T, Usuda S and Sakano H (1990) Switch circular DNA formed in cytokine-treated mouse splenocytes: evidence for intramolecular DNA deletion in immunoglobulin class switching. Cell, 62, 135–142. | Article | PubMed | ISI | ChemPort |

Metcalfe JA, Parkhill J, Campbell L, Stacey M, Biggs P, Byrd PJ and Taylor AM (1996) Accelerated telomere shortening in ataxia telangiectasia. Nature Genet, 13, 350–353. | Article

Michieli P, Chedid M, Lin D, Pierce JH, Mercer WE and Givol D (1994) Induction of WAF1/CIP1 by a p53-independent pathway. Cancer Res, 54, 3391–3395. | PubMed | ISI | ChemPort |

Mirzayans R, Aubin RA, Bosnich W, Blattner WA and Paterson MC (1995) Abnormal pattern of post-gamma-ray DNA replication in radioresistant fibroblast strains from affected members of a cancer-prone family with Li–Fraumeni syndrome. Br J Cancer, 71, 1221–1230. | PubMed | ISI | ChemPort |

Missero C, Calautti E, Eckner R, Chin J, Tsai LH, Livingston DM and Dotto GP (1995) Involvement of the cell-cycle inhibitor Cip1/WAF1 and the E1A-associated p300 protein in terminal differentiation. Proc Natl Acad Sci USA, 92, 5451–5455. | Article | PubMed | ChemPort |

Mitsudomi T et al.(1992) p53 gene mutations in non-small-cell lung cancer lines and their correlation with the presence of ras mutations and clinical features. Oncogene, 7, 171–180. | PubMed | ISI | ChemPort |

Morin GB (1989) The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell, 59, 521–529. | Article | PubMed | ISI | ChemPort |

Noda A, Ning Y, Venable SF, Pereira-Smith OM and Smith JR (1994) Cloning of senescent cell-derived inhibitors of DNA synthesis using an expression screen. Exp Cell Res, 211, 90–98. | Article | PubMed | ISI | ChemPort |

Reed M, Woelker B, Wang P, Wang Y, anderson ME and Tegtmeyer P (1995) The C-terminal domain of p53 recognizes DNA damaged by ionizing radiation. Proc Natl Acad Sci USA, 92, 9455–9459. | Article | PubMed | ChemPort |

Rogan EM et al.(1995) Alterations in p53 and p16INK4 expression and telomere length during spontaneous immortalization of Li–Fraumeni syndrome fibroblasts. Mol Cell Biol, 15, 4745–4753. | PubMed | ISI | ChemPort |

Rovinski B and Benchimol S (1988) Immortalization of rat embryo fibroblasts by the cellular p53 oncogene. Oncogene, 2, 445–452. | PubMed | ISI | ChemPort |

Rubelj I and Pereira-Smith OM (1994) SV40-transformed human cells in crisis exhibit changes that occur in normal cellular senescence. Exp Cell Res, 211, 82–89. | Article | PubMed | ISI | ChemPort |

Saito H, Hammond AT and Moses RE (1995) The effect of low oxygen tension on the in vitro-replicative life span of human diploid fibroblast cells and their transformed derivatives. Exp Cell Res, 217, 272–279. | Article | PubMed | ISI | ChemPort |

Shah GM, Poirier D, Desnoyers S, Saint-Martin S, Hoflack J, Rong P, Apsimon M, Kirkland JB and Poirier GG (1996) Complete inhibition of poly(ADP-ribose) polymerase activity prevents the recovery of C3H10T1/2 cells from oxidative stress. Biochim Biophys Acta, 1312, 1–7. | Article | PubMed | ISI | ChemPort |

Shay JW, Wright WE, Brasiskyte D and Van der Haegen BA (1993) E6 of human papillomavirus type 16 can overcome the M1 stage of immortalization in human mammary epithelial cells but not in human fibroblasts. Oncogene, 8, 1407–1413. | PubMed | ISI | ChemPort |

Sherwood SW, Rush D, Ellsworth JL and Schimke RT (1988) Defining cellular senescence in IMR-90 cells: a flow cytometric analysis. Proc Natl Acad Sci USA, 85, 9086–9090. | Article | PubMed | ChemPort |

Shiloh Y, Tabor E and Becker Y (1982) Colony-forming ability of ataxia-telangiectasia skin fibroblasts is an indicator of their early senescence and increased demand for growth factors. ExpCell Res, 140, 191–199. | ChemPort |

Srivastava S, Zou ZQ, Pirollo K, Blattner W and Chang EH (1990) Germ-line transmission of a mutated p53 gene in a cancer-prone family with Li–Fraumeni syndrome. Nature, 348, 747–749. | Article | PubMed | ISI | ChemPort |

Vaziri H and Benchimol S (1996) From telomere loss to p53 induction and activation of a DNA-damage pathway at senescence: the telomere loss/DNA damage model of cell aging. Exp Gerontol, 31, 295–301. | Article | PubMed | ISI | ChemPort |

Vaziri H, Schachter F, Uchida I, Wei L, Zhu X, Effros R, Cohen D and Harley CB (1993) Loss of telomeric DNA during aging of normal and trisomy 21 human lymphocytes. Am J Hum Genet, 52, 661–667. | PubMed | ISI | ChemPort |

Vaziri H, Dragowska W, Allsopp RC, Thomas TE, Harley CB and Lansdorp PM (1994) Evidence for a mitotic clock in human hematopoietic stem cells: loss of telomeric DNA with age. Proc Natl Acad Sci USA, 91, 9857–9860. | Article | PubMed | ChemPort |

von Zglinicki T, Saretzki G, Docke W and Lotze C (1995) Mild hyperoxia shortens telomeres and inhibits proliferation of fibroblasts: a model for senescence? Exp Cell Res, 220, 186–193. | Article | PubMed | ChemPort |

Wang ZQ, Auer B, Stingl L, Berghammer H, Haidacher D, Schweiger M and Wagner EF (1995) Mice lacking ADPRT and poly(ADP-ribosyl)ation develop normally but are susceptible to skin disease. Genes Dev, 9, 509–520. | Article | PubMed | ISI | ChemPort |

Watanabe S, Tadahito K and Yoshiike K (1989) Human papillomavirus type 16 transformation of primary human embryonic fibroblasts requires expression of open reading frames E6 and E7. J Virol, 63, 965–969. | PubMed | ISI | ChemPort |

Wesierska J, Schmid G and Cerni C (1996) ADP-ribosylation of wild-type p53 in vitro: binding of p53 to specific p53 consensus sequence prevents its modification. Biochem Biophys Res Commun, 224, 96–102. | Article | PubMed

Whitacre CM, Hashimoto H, Tsai ML, Chatterjee S, Berger SJ and Berger NA (1995) Involvement of NAD-poly(ADP-ribose) metabolism in p53 regulation and its consequences. Cancer Res, 55, 3697–3701. | PubMed | ISI | ChemPort |

Xu Y and Baltimore D (1996) Dual roles of ATM in the cellular response to radiation and in cell growth control. Genes Dev, 10, 2401–2410. | Article | PubMed | ISI | ChemPort |

Yang Z, Perkins N, Ohno T, Nabel EG and Nabel GJ (1995) The p21 cyclin-dependent kinase inhibitor suppresses tumorigenicity in vivo. Nature Med, 1, 1052–1056. | Article

Zhang J, Dawson VL, Dawson TM and Snyder SH (1994) Nitric oxide activation of poly(ADP-ribose) synthetase in neurotoxicity. Science, 263, 687–689. | Article | PubMed | ISI | ChemPort |