Introduction

Gene therapy is an attractive strategy for the development of more effective anticancer therapies with reduced treatment-related toxicity.¹ There have been significant improvements in lung cancer treatment with gene therapy by targeting the protein products of mutated proto-oncogenes such as RAS,² tumor suppressor genes such as p53³ or overexpressed genes associated with cancer progression and invasion, such as IGF-1R.⁴ However, the efficacy of gene therapy is limited by the low efficiency of gene transfer and the technical difficulties of regimen delivery.

The first major limitation of gene therapy of the lung is the low efficiency of gene transfer. High gene transfection efficiency in the lung has been shown for DNA encapsulated by polymers and cationic lipids.^{5, 6} Recently, the cationic polymer polyethyleneimine (PEI) has been shown to be an efficient vector for gene transfer in vivo and to have promising utility for aerosol-based gene delivery without the acute inflammatory cytokine responses caused by cationic liposomes and viral vectors.^{7, 8, 9, 10} The second major limitation of gene therapy is the route of delivery. Gene therapy regimens are typically delivered to the lung through intratumoral, intrabronchial or intrapleural injections.^{3, 11, 12}

These types of direct intratracheal administration of therapeutic agents are technically cumbersome, uncomfortable and invasive. By contrast, aerosol delivery is more efficient and a simpler mode of gene therapy transport to the lungs. Aerosol delivery also has the advantages of uniform gene therapy agent distribution, lower risk of lung injury and access to a larger bronchial epithelium surface area^{7, 8} Intranasal aerosol delivery of biological agents has been successfully shown for interleukin-12,^{13, 14} p53,³ the therapeutic antibody cetuximab,¹⁵ PTEN,¹⁶ interleukin-2¹⁷ and granulocyte macrophage colony-stimulating factor.¹⁸ Several chemotherapeutic agents have also been tested for aerosol delivery to patients with lung carcinoma, including cisplatin and doxorubicin.^{19, 20, 21, 22} Thus, aerosol delivery cationic lipid-encapsulated DNA is a potentially more efficacious approach for the treatment of lung cancer with gene therapy regimens.

The Wilms' tumor gene 1 (WT1) is a potential therapeutic target for the treatment of leukemia and other cancers.^{23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35} WT1 encodes a transcription factor that is involved in gonadal development. Mutations in WT1 were initially found to cause urogenital disease and kidney tumors, suggesting that it is a tumor suppressor.^{36, 37, 38, 39} However, WT1 is considered to be an oncogene rather than a tumor suppressor gene because its increased expression is associated with the development and progression of diverse cancers including leukemia, mesothelioma, breast, gastric, colon, ovarian, melanoma and lung cancer. It also plays an important role in cell proliferation, differentiation of various tissue types, and apoptosis.^{40, 41, 42} Increased expression of WT1 is associated with unfavorable prognosis of multiple malignancies and its downregulation by different gene therapy strategies leads to a down of cell proliferation and apoptosis.^{32, 33, 34, 35} Overexpression of WT1 mRNA has been detected in 54 of 56 (96%) de novo non-small cell lung cancers and protein overexpression was confirmed in 5 of 6 (83%) de novo small cell lung cancers by immunohistochemistry.^{43, 44} It is therefore a target for gene therapy with high potential for lung cancer treatment.

In this study, we use a B16-F10 mouse melanoma lung metastasis model to show that aerosol delivery of PEI–RNAi can be used to silence the WT1 gene.

Silencing of WT1 reduced the number and growth of visible metastatic tumor foci in the lungs. It also reduced the number of blood vessels, induced apoptosis and increased the mean survival time of treated animals. These data suggest that the silencing of the WT1 gene with aerosol delivery of PEI–RNAi is an attractive strategy for the prevention and treatment of established tumor metastases in the lungs.

Materials and methods

Animals

Female C57Bl/6 mice (7–8 weeks old, 20–25 g) were obtained from Harlan Mexico (Mexico, DF) The animals were housed in a 12-h light/12-h dark cycle and were provided with an autoclaved rodent diet and water ad libitum. All experiments were carried out in accordance with prior approval from the local animal ethics committee.

B16F10 murine melanoma cell line

The murine B16F10 melanoma cell line was obtained from the American Type Culture Collection (ATCC, Manassas, VA) and cultivated in Dulbecco's modified Eagle Medium (DMEMF-12; Life Technologies, Invitrogen, Burlington, Ontario, Canada) supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY), 100 U ml^-1 penicillin, 100 g ml^-1 streptomycin and 10% FBS. Cells were maintained in culture flasks at 37 °C in a humidified atmosphere with 5% CO₂. The B16F10 murine melanoma cell line produces lung metastases when administered intravenously.⁴⁵ The cells were used at passages 3–12. B16F10 cells (5 10⁵) in 150 l of media without serum were injected per mouse through the tail vein. Lung metastases are detected within 7 days after injection.

Preparation of PEI–DNA complexes

A PEI (25 kDa branched form; Aldrich, Milwaukee, IL) stock solution was prepared at a concentration of 4.3 mg ml^-1 (0.1 M in nitrogen) in water. The DNA had 3 nmol of phosphate per microgram and l l of the 0.1 M PEI solution had 100 nmol of amine nitrogen. The resulting charge ratio was expressed as the ratio of PEI nitrogen to DNA phosphorus (N/P). A 10:1 N/P was used for the experiments, which corresponds to a 1.29:1 PEI/DNA weight ratio.

WT1 RNAi expression constructs

Two oligo pairs (sense and antisense) for WT1 RNAi were designed using the siRNA design guidelines online software (Ambion, Austin, TX), synthesized at a concentration of 0.05 g (Ambion) and used to create two recombinant plasmids (termed WT1-1 and WT1-2). For plasmid WT1-1, the oligos were 5'-gatccggctgtcccacttacagatggaagcttgcatctgtaagtgggacagcttttttggaag-3', 3'-gccgacagggtgaatgtctaccttcgaacgtagacattcaccctgtcgaaaaaaccttcgccgg-5' and for plasmid WT1-2, the oligos were 5'-gatccgaggagacatacaggtgtgagaagcttgtcacacctgtatgtctcctttttttggaagc-3', 3'-gctcctctgtatgtccacactcttcgaacagtgtggacatgcagaggaaaaaaaccttcgccgg-5'. The oligos were resuspended to a final concentration of 1 g l^-1, annealed and ligated into pGSH1-GFP (Gene Therapy Systems, Inc., San Diego, CA).

Delivery of PEI–DNA complexes by aerosol

For aerosol treatment, we used a nose exposure chamber system for four mice. The recombinant plasmids were aerosolized using a Pulmo-Aide compressor model 5650D, which includes a Micro-Mist Nebulizer (115v) (DeVilbiss Health Care Corp., Somerset, PA).⁴⁶ The mice were treated with 25 g of PEI–DNA complexes (WT1-1 or WT1-2) per mouse in a final volume of 2 ml. The aerosol delivery of the 2 ml solution took about 10 min. The mice were treated twice a week for 4 weeks (eight treatments in total), starting 2 days after injection of the melanoma cell line. The mice of the untreated control group were aerosolized with PEI–pEGFP–N2 complex (Clontech, Palo Alto, CA).

Evaluation of tumor burden

Mice were killed on day 27 after injection. The lungs were isolated, washed with phosphate-buffered saline (PBS), weighed and examined with an inverted microscope to count the visible foci. The growth of tumors contiguous to the lung was considered to be a part of the lung for the purpose of weighing the lungs. As lungs in the control groups had uncountable foci, we graded them on the basis of a scale of 1–5 as described earlier.⁴⁷ A value of 1 indicated that there were less than 10 tumor foci; 2 indicated that there were 10–100 tumor foci; 3 indicated that one lobe of the lung was filled with tumor; 4 indicated that both lobes were filled with tumor; and 5 indicated that the lungs were filled with tumor and the tumor was growing out of the lungs into the chest wall. The tumor index was calculated by the formula: tumor index=lung weights average grade for the group. Reported values are the means.d. (n=4 mice per group).

Quantitative real-time RT-PCR

Lungs were isolated and total RNA was extracted using 1 ml of Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer instructions. RNA concentration and integrity were determined by measuring the absorbance at 260 nm and by electrophoresis on a 1% agarose gel. For reverse transcription (RT)–PCR, 5 g of total RNA was reverse transcribed using SUPERSCRIPT RT (Invitrogen) and an oligo (dT)_12–18 primer (Invitrogen). Real-time RT-PCR was performed in an iCycler detection system (Bio-Rad, Hercules, CA). The measurements of WT1 mRNA using the TaqMan probe were carried out in 20 l of reaction mixture containing 200 nM of forward (TCTGCGGAGCCCAATACAG) primer, reverse (CACATCCTGAATGCCTCTGAAGA) primer and 250 nM probe using the Universal PCR Master Mix (Applied Biosystems, Foster, CA). After an initial hold of 10 min at 94 °C, samples were cycled 40 times at 94 °C for 30 s and at 64 °C for 30 s. Expression of the mRNA was assessed by evaluating the threshold cycle values. The threshold cycle values were normalized to the expression level of mouse -actin mRNA (Mouse ACTB, VIC-MGB; Applied Biosystems) and the relative amount of WT1 mRNA was calculated using the 'DCT' method and a reference gene.

Histology

The mouse lung tissue was fixed in 10% formalin and embedded in paraffin. Histological observations were made on 4-m-thick sections stained with hematoxylin and eosin (H&E). Three mice not injected with cancer cells were included in each of the treatment groups to detect signs of toxicity or any pulmonary inflammation owing to treatment, PEI or the aerosol delivery system.

Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling

The in Situ Cell Death Kit, AP (Roche Diagnostics, Indianapolis, IN) was used to analyze apoptosis in lung tissue. Paraffin-embedded mice lung tissue was rehydrated according to standard protocols by heating at 60 °C, washing in xylene and rehydrating through a graded series of ethanol and double-distilled water. Tissue sections were incubated for 30 min at 37 °C with proteinase K working solution (20 g ml^-1, 10 mM Tris/HCl, pH 7.4). The tissues were then washed with PBS, permeabilized for 8 min with 0.1% sodium citrate solution containing 0.1% Triton X-100, washed twice with PBS, stained with the terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) reaction mixture for 60 min at 37 °C, washed twice with PBS, incubated with Converter-AP solution for 30 min at 37 °C, washed three times with PBS and incubated with substrate solution (NBT/BCIP solution) for 10 min at 25 °C in the dark. After three washes, tissue sections were stained with hematoxylin, and apoptotic cells were observed by microscopy (Olympus Optical Co. Ltd, Center Valley, PA).

RT–PCR

Lung tissue was harvested and the total RNA was extracted using 1 ml of Trizol reagent (Invitrogen) according to the manufacturer's instructions. RNA concentration and integrity were determined by measuring the absorbance at 260 nm and by electrophoresis on 1% agarose gel. For RT–PCR, 5 g of total RNA was reverse transcribed using SUPERSCRIPT RT (Invitrogen) and oligo (dT)_12-18 primers (Invitrogen). The cDNA obtained was amplified using Taq DNA polymerase (Invitrogen) and the following primers: 5'-TTGGACAATGGACTGGTTGA-3' and 5'-GTAGAGTGGATGGTCAGTG-3', producing a 591 base-pair product (BclXS) or a 780 bp product (BclXL). For bax amplification, 5'-GGCCCACCAGCTCTGAGCAGA-3' and 5'-GCCACGTGGGCGTCCCAAAGT-3' primers were used to generate a 479 bp product. Amplifications for Bax and BclX were performed with 35 cycles (94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s).⁴⁸ The primer sequences designed for amplification of a -actin cDNA fragment (541 bp) were 5'-GTGGGGCGCCCCAGGCACCA-3' and 5'-GTCCTTAATGTCACGCACGATTTC-3'. Amplification was performed according to Laux et al.⁴⁹ PCR products were analyzed by electrophoresis on a 0.8% agarose gel and visualized by ethidium bromide (Anco and Rhenium Industries Ltd, Jerusalem, Israel).

Survival evaluation

To evaluate the length of survival after the aerosol delivery of PEI–WT1 RNAi constructs, a parallel experiment was carried out with eight tumor-bearing mice per group exposed to PEI–pEGFP–N2 (control), WT1-1 or WT1-2 RNAi. The mice were treated for 4 weeks, twice a week, beginning 2 days after tumor cell injection and then monitored over time for their survival.

Statistics

All experiments were carried out in triplicate, and statistical analysis was performed with the Mann–Whitney test using the SPSS 12.0 program (SPSS Inc.) with a significance of P<0.05.

Results

Suppression of B16F10 lung metastases by aerosol delivery of PEI–WT1 RNAi

To assess the effect of PEI–WT1-1 and PEI–WT1-2 RNAi on development of lung tumor metastases, the lung weight was measured and the numbers of metastatic lung surface nodules were observed for treated and untreated control animals. In comparison with the untreated control group (PEI–pEGFP–N2), the RNAi-treated groups showed reduced numbers of tumor foci and statistically significant reductions in mean lung weights and tumor index (Figures 1a and b). The average lung weight of the treated mice was 0.20 g for WT1-1 and 0.22 g for WT1-2. These values were significantly reduced (P=0.020) in comparison with those the untreated control group (0.69 g; Figure 1c).

Figure 1.

Effects of the Wilms' tumor gene 1 (WT1) gene silencing by aerosol treatment with WT1-1 or WT1-2 on the growth of B16F10 experimental lung metastases. (a and b) Representative lungs from PEI–pEGFP–N2 control group and WT1-1 and WT1-2-treated mice. (c) Lung weights of PEI–pEGFP–N2 control group and WT1-1 and WT1-2-treated groups. (d) Tumor index was calculated by the formula: tumor index=lung weights average grade for the group. Data are representative of at least two experiments. ^*show that the greatest statistical difference was presented between control and the group treated with WT1-1. This significance was performed by Mann-Whitney test using the SPSS 12.0 program (SPSS Inc.) with a significance of P<0.05.

Full figure and legend (184K)

The tumor index represents the tumor burden as the mean lung weight relative to the mean tumor grade of the group. The treated groups had a mean grade of two (10–100 tumor foci) and the untreated group had a mean grade of five (lungs covered by tumor with metastasis into the chest cavity). The mice treated with WT1-1 had a mean tumor index of 0.375 as compared with those treated with WT1-2 having a mean tumor index of 0.415 (P=0.020, control group tumor index=3.265; Figure 1d). These results show the efficacy of aerosol delivery of WT1 RNAi against lung cancer.

Aerosol delivery of PEI–RNAi WT1 complexes downregulates WT1 mRNA

To determinate whether the reduction in the number of metastatic lung tumors correlated with WT1 gene silencing, we evaluated WT1 mRNA levels in the lungs of mice after the treatment strategy using real-time RT-PCR. Quantitative analysis with real-time RT-PCR showed that aerosol delivery of WT1 RNAi significantly reduced (P=0.020) WT1 mRNA levels by 87% with WT1-1 and by 73% with WT1-2 in lung tissue in comparison with the untreated control group (Figure 2). These data suggest that the reduced tumor burden after RNAi treatments was due to silencing of WT1 expression in the lungs of treated mice.

Figure 2.

The Wilms' tumor gene 1 (WT1) mRNA expression in the lungs of mice after aerosol treatment with WT1-1 or WT1-2. The mice were treated with 25 g of PEI–DNA complexes (WT1-1 or WT1-2) twice a week for 4 weeks. The control mice were exposed to PEI–pEGFP–N2. The mice were killed on day 27, lungs were harvested and tissue was assayed for WT1 mRNA expression by quantitative real-time RT-PCR. ^*show that the greatest statistical difference was presented between control and the group treated with WT1-1. This significance was performed by Mann-Whitney test using the SPSS 12.0 program (SPSS Inc.) with a significance of P<0.05.

Full figure and legend (36K)

Histological analysis of lung tissue from aerosol WT1 RNAi-treated mice

Observation of H&E-stained lung sections from untreated and treated tumor-bearing mice showed the presence of tumor infiltrations and the architecture of thickened alveolar septum in both groups. A higher number of blood vessels was observed in the tumors of the untreated control group (10–20 blood vessels per field; Figure 3a) in comparison with the WT1-1 and WT1-2-treated groups (3–7 blood vessels by field; Figure 3b) Furthermore, the RNAi-treated samples contained cells with cystic cytoplasm and fragmented nuclei, typical signs of cells undergoing apoptosis (Figure 3). We did not observe damage associated with acute inflammatory responses in lung tissues independently of neutrophil infiltration in any of the samples.

Figure 3.

Histological analysis of lung sections. Mice were injected i.v. with 5 10⁵ B16F10 cells. After eight aerosol treatments with WT1-1 recombinant plasmid (twice a week), lungs were fixed in 10% formalin and embedded in paraffin for hematoxylin and eosin (H&E) staining. (a) Control group (PEI–pEGFP–N2) had 10–20 blood vessels per field. (b) TheWT1-1-treated mice had 3–7 blood vessels per field. Arrows indicate blood vessels. (c) The WT1-1 cells had cystic cytoplasm and fragmented nuclei in the tumor infiltrations.

Full figure and legend (229K)

Apoptosis in lung tumor foci of treated mice detected by TUNEL

We performed TUNEL assays to determine whether the cells with cystic cytoplasm and fragmented nuclei in the WT1-1- and WT1-2-treated groups were undergoing apoptosis. TUNEL-positive nuclei were detected in the WT1 RNAi-treated samples, but not in the PEI mock-treated samples (Figure 4). The apoptotic cells were present in the periphery of the tumor foci colocalized with tumor infiltrations. These results indicate that treatment with WT1 RNAi induces apoptosis in the lungs of B16F10 tumor-bearing mice.

Figure 4.

Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) analysis of apoptosis in lung tumor foci of the Wilms' tumor gene 1 (WT1)-treated mice. After the WT1 treatment of the tumor-bearing mice, lungs were isolated, fixed in 10% formalin, processed for TUNEL and stained with hematoxylin. (a) PEI–pEGFP–N2 control tumor cell infiltrations were negative for TUNEL staining. (b) WT1-1-treated samples had TUNEL-positive staining in the tumor cell infiltrations.

Full figure and legend (161K)

Expression of Bcl-xL, Bcl-xS and Bax in lung tissues of RNAi-treated mice

We analyzed the expression of apoptosis-related genes in the lung tissues of untreated or WT1-1 and WT1-2 RNAi-treated tumor-bearing mice. The expression of proapoptotic BclxS was preferentially expressed in the treated samples. By contrast, antiapoptotic Bcl-xL was preferentially expressed in the untreated samples. In addition, the Bax gene was also preferentially expressed in treated samples in comparison with the untreated samples (Figure 5). These results suggest that the WT1 RNAi treatment initiates an intrinsic apoptotic pathway involving the expression of the Bcl-xS and Bax genes.

Figure 5.

Expression of Bcl-xL, Bcl-xS and Bax genes by reverse transcription (RT)–PCR in lung tissues of control and RNAi-treated mice. After the eight treatments by aerosol with WT1-1 and WT1-2, lungs were harvested and apoptotic gene expression assessed by RT–PCR.

Full figure and legend (63K)

Survival time of mice treated with WT1-1 and WT1-2 complexes

The mice treated with the WT1-1 recombinant RNAi plasmid had prolonged survival (P=0.003, mean=36.59.5 days) in comparison with the untreated control group (29.51.5 days). Almost 80% of the mice treated with WT1-1 were alive on day 31, by which time all the untreated mice were deceased. By contrast, WT1-2 treatment did not produce a statistically different change in the mean survival time of the control tumor-bearing mice (302 days; Figure 6).

Figure 6.

Survival time of mice treated with WT1-1 and WT1-2 recombinant plasmids. Mice were injected i.v. with 5 10⁵ B16F10 cells and treated biweekly with PEI–pEGFP–N2, WT1-1 or WT1-2 for 4 weeks starting 2 days after tumor cell injection. Mice were monitored over time for their survival.

Full figure and legend (47K)

Discussion

WT1 has been considered to be an excellent potential target for the development of gene-therapy strategies to treat cancer because it is overexpressed in many types of neoplasias.^{40, 41, 42} Different strategies have been used to decrease the WT1 production and, thereby, inhibit cancer cell proliferation, induce tumor apoptosis and sensitize tumor cells to chemotherapy and radiotherapy.^{23, 24, 25, 26, 27, 28, 29, 30, 31} In previous studies, we showed that WT1 is expressed in B16F10 murine melanoma cell line and that in vitro RNAi silencing of WT1 expression results in the inhibition of cell proliferation, induction of apoptosis, caspase-3 activation and poly-(ADP-ribose)polymerase cleavage in vitro.³⁰ In this study, we extended this analysis to show that in vivo aerosol delivery of PEI–WT1-1 RNAi or PEI–WT1-2 RNAi complexes effectively reduces the metastatic tumor burden in the lungs of B16F10 mice. The PEI–WT1-1 RNAi or PEI–WT1-2 RNAi complexes significantly (P=0.020) reduced WT1 RNA expression in lung tissue and this correlated with reduction in the number and size of lung tumor foci.

Histological analysis of lung tissue revealed two major differences between the treated and untreated groups. First, we observed a reduction in the number and size of blood vessels in tumor samples from treated mice. The reduced number of blood vessels in the treated samples suggests that silencing of WT1 inhibits angiogenesis. This is consistent with the observation that WT1 activates the ETS-1 gene, which is important for tumor vascularization through regulation of endothelial cell proliferation and migration,⁵⁰ and with studies about WT1 transcriptionally regulating vascular endothelial growth factor expression. These molecular mechanisms may be responsible for the role of WT1 in angiogenesis and cancer progression.⁵¹

The second major histological and molecular observation was the presence of cells in apoptosis induced by WT1 RNAi. These apoptotic cells were observed in the infiltrated peripheral areas of the tumor, but were absent from the tumor foci. These results are consistent with the results of Gautam et al.,⁵² which showed that the peripheral areas of the tumor are most easily accessible to gene therapy. WT1 has also been shown to be required for the inhibition of apoptosis in vitro and in vivo. Several bcl-2 family members are either direct or indirect WT1 target genes, including the antiapoptotic bcl-2 and the proapoptotic family members Bak and Bax.^{53, 54, 55} Thus, silencing of WT1 would be expected to influence cell viability by favoring the expression of proapoptotic bcl-2 family member genes. Our results suggest that the silencing of WT1 in the tumor-bearing mice activates an apoptotic pathway, and for this reason we analyzed some of the Bcl-2 family related genes involved in the intrinsic apoptotic pathway. We observed an overexpression of the proapoptotic genes Bcl-xS and Bax in the treated mice in comparison with the controls. These results show the activation of the intrinsic apoptotic pathway by WT1 gene silencing and corroborate, in part, the report that shRNA silencing of WT1 induces apoptosis of fibrosarcoma cells.⁵⁶

WT1-1 RNAi treatment significantly increased (P=0.003) the mean survival time of tumor-bearing mice in comparison with the mice treated with WT1-2 RNAi or the untreated mice. Studies are ongoing to assess the potential of using 5% CO₂ during nebulization to increase the efficacy of aerosol delivery because it has been reported that this addition enhances transgene expression in the lung for PEI–DNA vectors.⁷ In conclusion, in vivo WT1 gene silencing by aerosol delivery of PEI–WT1 RNAi complexes effectively decreases B16F10 lung metastases by reducing the number and size of tumor foci, activates the expression of genes that initiate the intrinsic apoptotic pathway and increases the mean length of survival of tumor-bearing mice. Aerosol delivery of RNAi targeting WT1 is therefore an attractive strategy for the treatment of lung cancer and may complement conventional anticancer therapies.

Conflict of interest

The authors declare no conflict of interest.

References

1. Chada S, Menander KB, Bocangel D, Roth JA, Ramesh R. Cancer targeting using tumor suppressor genes. Front Biosci 2008; 13: 1959–1967. | Article | PubMed | ChemPort |
2. Zhang ZP, Jiang GC, Yang F, Zhou ZL, Wang J. Study of growth inhibition of lung cancer cells by siRNA targeting mutant K-ras gene in vitro and in vivo. Zhonghua Wai Ke Za Zhi 2007; 45: 1267–1270. | PubMed |
3. Zou Y, Tornos C, Qiu X, Lia M, Perez-Soler R. p53 aerosol formulation with low toxicity and high efficiency for early lung cancer treatment. Clin Cancer Res 2007; 13: 4900–4908. | Article | PubMed | ChemPort |
4. Dong AQ, Kong MJ, Ma ZY, Qian JF, Xu XH. Down-regulation of IGF-IR using small, interfering, hairpin RNA (siRNA) inhibits growth of human lung cancer cell line A549 in vitro and in nude mice. Cell Biol Int 2007; 31: 500–507. | Article | PubMed | ChemPort |
5. Bragonzi A, Boletta A, Biffi A, Muggia A, Sersale G, Cheng SH et al. Comparison between cationic polymers and lipids in mediating systemic gene delivery to the lungs. Gene Therapy 1999; 6: 1995–2004. | Article | PubMed | ISI | ChemPort |
6. Bragonzi A, Dina G, Villa A, Calori G, Biffi A, Bordignon C et al. Biodistribution and transgene expression with nonviral cationic vector/DNA complexes in the lungs. Gene Therapy 2000; 7: 1753–1760. | Article | PubMed | ISI | ChemPort |
7. Gautam A, Densmore CL, Xu B, Waldrep JC. Enhanced gene expression in mouse lung after PEI-DNA aerosol delivery. Mol Ther 2000; 2: 63–70. | Article | PubMed | ISI | ChemPort |
8. Densmore CL, Orson FM, Xu B, Kinsey BM, Waldrep JC, Hua P et al. Aerosol delivery of robust polyethyleneimine-DNA complexes for gene therapy and genetic immunization. Mol Ther 2000; 1: 180–188. | Article | PubMed | ChemPort |
9. Orson FM, Song L, Gautam A, Densmore CL, Bhogal BS, Kinsey BM. Gene delivery to the lung using protein/polyethylenimine/plasmid complexes. Gene Therapy 2002; 9: 463–471. | Article | PubMed | ChemPort |
10. Gautam A, Densmore CL, Waldrep JC. Pulmonary cytokine responses associated with PEI-DNA aerosol gene therapy. Gene Therapy 2001; 8: 254–257. | Article | PubMed | ChemPort |
11. Swisher SG, Roth JA, Komaki R, Gu J, Lee JJ, Hicks M et al. Induction of p53-regulated genes and tumor regression in lung cancer patients after intratumoral delivery of adenoviral p53 (INGN 201) and radiation therapy. Clin Cancer Res 2003; 9: 93–101. | PubMed | ISI | ChemPort |
12. Schuler M, Herrmann R, De Greve JL, Stewart AK, Gatzemeier U, Stewart DJ et al. Adenovirus-mediated wild-type p53 gene transfer in patients receiving chemotherapy for advanced non-small-cell lung cancer: results of a multicenter phase II study. J Clin Oncol 2001; 19: 1750–1758. | PubMed | ISI | ChemPort |
13. Duan X, Jia SF, Koshkina N, Kleinerman ES. Intranasal interleukin-12 gene therapy enhanced the activity of ifosfamide against osteosarcoma lung metastases. Cancer 2006; 106: 1382–1388. | Article | PubMed | ChemPort |
14. Jia SF, Worth LL, Densmore CL, Xu B, Zhou Z, Kleinerman ES. Eradication of osteosarcoma lung metastases following intranasal interleukin-12 gene therapy using a nonviral polyethylenimine vector. Cancer Gene Ther 2002; 9: 260–266. | Article | PubMed | ChemPort |
15. Maillet A, Congy-Jolivet N, Le Guellec S, Vecellio L, Hamard S, Courty Y et al. Aerodynamical, immunological and pharmacological properties of the anticancer antibody cetuximab following nebulization. Pharm Res 2008; 25: 1318–1326. | Article | PubMed | ChemPort |
16. Jin H, Xu CX, Kim HW, Chung YS, Shin JY, Chang SH et al. Urocanic acid-modified chitosan-mediated PTEN delivery via aerosol suppressed lung tumorigenesis in Kras(LA1) mice. Cancer Gene Ther 2008; 15: 275–283. | Article | PubMed | ChemPort |
17. Skubitz KM, Anderson PM. Inhalational interleukin-2 liposomes for pulmonary metastases: a phase I clinical trial. Anticancer Drugs 2000; 11: 555–563. | Article | PubMed | ChemPort |
18. Anderson PM, Markovic SN, Sloan JA, Clawson ML, Wylam M, Arndt CA et al. Aerosol granulocyte macrophage-colony stimulating factor: a low toxicity, lung-specific biological therapy in patients with lung metastases. Clin Cancer Res 1999; 5: 2316–2323. | PubMed | ISI | ChemPort |
19. Gagnadoux F, Hureaux J, Vecellio L, Urban T, Le Pape A, Valo I et al. Aerosolized chemotherapy. J Aerosol Med Pulm Drug Deliv 2008; 21: 61–70. | Article | PubMed | ChemPort |
20. Wittgen BP, Kunst PW, van der Born K, van Wijk AW, Perkins W, Pilkiewicz FG et al. Phase I study of aerosolized SLIT cisplatin in the treatment of patients with carcinoma of the lung. Clin Cancer Res 2007; 13: 2414–2421. | Article | PubMed | ChemPort |
21. Otterson GA, Villalona-Calero MA, Sharma S, Kris MG, Imondi A, Gerber M et al. Phase I study of inhaled Doxorubicin for patients with metastatic tumors to the lungs. Clin Cancer Res 2007; 13: 1246–1252. | Article | PubMed | ChemPort |
22. Azarmi S, Tao X, Chen H, Wang Z, Finlay WH, Löbenberg R et al. Formulation and cytotoxicity of doxorubicin nanoparticles carried by dry powder aerosol particles. Int J Pharm 2006; 319: 155–161. | Article | PubMed | ChemPort |
23. Shen H, Xu W, Wu Z, Tang H, Xie Y, Zhong X. Down-regulation of WT1/+17AA gene expression using RNAi and modulating leukemia cell chemotherapy resistance. Haematologica 2007; 92: 1270–1272. | Article | PubMed | ChemPort |
24. Glienke W, Maute L, Koehl U, Esser R, Milz E, Bergmann L. Effective treatment of leukemic cell lines with wt1 siRNA. Leukemia 2007; 21: 2164–2170. | Article | PubMed | ChemPort |
25. Liu Y, Qu X, Wang P, Tian X, Luo Y, Liu S et al. WT1 downregulation during K562 cell differentiation and apoptosis induced by bufalin. Zhonghua Xue Ye Xue Za Zhi 2002; 23: 356–359. | PubMed | ChemPort |
26. Hübinger G, Schmid M, Linortner S, Manegold A, Bergmann L, Maurer U. Ribozyme-mediated cleavage of wt1 transcripts suppresses growth of leukemia cells. Exp Hematol 2001; 29: 1226–1235. | Article | PubMed
27. Zapata-Benavides P, Tuna M, Lopez-Berenstein G, Tari AM. Down regulation of Wilms' tumor 1 protein inhibits breast cancer proliferation. Biochem Biophys Res Commun 2002; 295: 784–790. | Article | PubMed | ISI | ChemPort |
28. Navakanit R, Graidist P, Leeanansaksiri W, Dechsukum C. Growth inhibition of breast cancer cell line MCF-7 by siRNA silencing of Wilms tumor 1 gene. J Med Assoc Thai 2007; 90: 2416–2421. | PubMed |
29. Clark AJ, Chan DC, Chen MY, Fillmore H, Dos Santos WG, Van Meter TE et al. Down-regulation of Wilms' tumor 1 expression in glioblastoma cells increases radiosensitivity independently of p53. J Neurooncol 2007; 83: 163–172. | Article | PubMed | ChemPort |
30. Zamora-Avila DE, Franco-Molina MA, Trejo-Avila LM, Rodríguez-Padilla C, Reséndez Pérez D, Zapata-Benavides P. RNAi silencing of the WT1 gene inhibits cell proliferation and induces apoptosis in the B16F10 murine melanoma cell line. Melanoma Res 2007; 17: 341–348. | Article | PubMed | ChemPort |
31. Wagner N, Panelos J, Massi D, Wagner KD. The Wilms' tumor suppressor WT1 is associated with melanoma proliferation. Pflugers Arch 2008; 455: 839–847. | Article | PubMed | ChemPort |
32. Weisser M, Kern W, Rauhut S, Schoch C, Hiddemann W, Haferlach T et al. Prognostic impact of RT-PCR based quantification of WT1 gene expression during MRD monitoring if acute myeloid leukemia. Leukemia 2005; 19: 1416–1423. | Article | PubMed | ChemPort |
33. Miyoshi Y, Ando A, Egawa C, Taguchi T, Tamaki Y, Tamaki H et al. High expression of Wilms' tumor suppressor gene predicts poor prognosis in breast cancer patients. Clin Cancer Res 2002; 8: 1167–1171. | PubMed | ISI | ChemPort |
34. Srivastava A, Fuchs B, Zhang K, Ruan M, Halder C, Mahlum E et al. High WT1 expression is associated with very poor survival of patients with osteogenic sarcoma metastasis. Clin Cancer Res 2006; 12: 4237–4243. | Article | PubMed | ChemPort |
35. Netinatsunthorn W, Hanprasertpong J, Dechsukhum C, Leetanaporn R, Geater A. WT1 gene expression as a prognostic marker in advanced serous epithelial ovarian carcinoma: an immunohistochemical study. BMC Cancer 2006; 6: 90. | Article | PubMed | ChemPort |
36. Hohenstein P, Hastie ND. The many facets of the Wilms' tumour gene, WT1. Hum Mol Genet 2006; 15 Spec No. 2: R196–R201. | Article | PubMed | ChemPort |
37. Wagner KD, Wagner N, Schedl A. The complex life of WT1. J Cell Sci 2003; 116: 1653–1658. | Article | PubMed | ISI | ChemPort |
38. Yang L, Han Y, Suarez Saiz F, Minden MD. A tumor suppressor and oncogene: the WT1 story. Leukemia 2007; 21: 868–876. | Article | PubMed | ISI | ChemPort |
39. Ellisen LW. Regulation of gene expression by WT1 in development and tumorigenesis. Int J Hematol 2002; 76: 110–116. | Article | PubMed | ChemPort |
40. Oji Y, Ogawa H, Tamaki H, Oka Y, Tsuboi A, Kim EH et al. Expression of the Wilms' tumor gene WT1 in solid tumors and its involvement in tumor cell growth. Jpn J Cancer Res 1999; 90: 194–204. | PubMed | ChemPort |
41. Menssen HD, Bertelmann E, Bartelt S, Schmidt RA, Pecher G, Schramm K et al. Wilms' tumor gene (WT1) expression in lung cancer, colon cancer and glioblastoma cell lines compared to freshly isolated tumor specimens. J Cancer Res Clin Oncol 2000; 126: 226–232. | Article | PubMed | ISI | ChemPort |
42. Wagner N, Panelos J, Massi D, Wagner KD. The Wilms' tumor suppressor WT1 is associated with melanoma proliferation. Pflugers Arch 2008; 455: 839–847. | Article | PubMed | ChemPort |
43. Oji Y, Miyoshi S, Maeda H, Hayashi S, Tamaki H, Nakatsuka S et al. Overexpression of the Wilms' tumor gene WT1 in de novo lung cancers. Int J Cancer 2002; 100: 297–303. | Article | PubMed | ISI | ChemPort |
44. Oji Y, Miyoshi S, Takahashi E, Koga S, Nakano Y, Shintani Y et al. Absence of mutations in the Wilms' tumor gene wt1 in de novo non-small cell lung cancers. Neoplasma 2004; 51: 17–20. | PubMed | ChemPort |
45. Fidler IJ, Nicolson GL. Tumor cell and host properties affecting the implantation and survival of blood-borne metastatic variants of B16 melanoma. Isr J Med Sci 1978; 14: 38–50. | PubMed | ChemPort |
46. Geller DE, Pitlick WH, Nardella PA, Tracewell WG, Ramsey BW. Pharmacokinetics and bioavailability of aerosolized tobramycin in cystic fibrosis. Chest 2002; 122: 219–226. | Article | PubMed | ChemPort |
47. Gautam A, Densmore CL, Waldrep JC. Inhibition of experimental lung metastasis by aerosol delivery of PEI-p53 complexes. Mol Ther 2000; 2: 318–323. | Article | PubMed | ChemPort |
48. Gradilone A, Gazzaniga P, Ribuffo D, Scarpa S, Cigna E, Vasaturo F et al. Survivin, bcl 2, bax, and bcl-X gene expression in sentinel lymph nodes from melanoma patients. J Clin Oncol 2003; 21: 306–312. | Article | PubMed | ISI | ChemPort |
49. Laux DE, Curran EM, Welshans WV, Lubahn DB, Huang TH-M. Hypermethylation of theWilms tumor suppressor gene CpG island in human breast carcinomas. Breast Cancer Res Treatment 1999; 56: 35–43. | Article | ChemPort |
50. Wagner N, Michiels JF, Schedl A, Wagner KD. The Wilms' tumour suppressor WT1 is involved in endothelial cell proliferation and migration: expression in tumour vessels in vivo. Oncogene 2008; 27: 3662–3672. | Article | PubMed | ChemPort |
51. Hanson J, Gorman J, Reese J, Fraizer G. Regulation of vascular endothelial growth factor, VEGF, gene promoter by the tumor suppressor, WT1. Front Biosci 2007; 12: 2279–2290. | Article | PubMed | ISI | ChemPort |
52. Gautam A, Densmore CL, Melton S, Golunski E, Waldrep JC. Aerosol delivery of PEI p53 complexes inhibits B16-F10 lung metastases through regulation of angiogenesis. Cancer Gene Ther 2002; 9: 28–36. | Article | PubMed | ISI | ChemPort |
53. Loeb DM. WT1 influences apoptosis through transcriptional regulation of Bcl-2 family members. Cell Cycle 2006; 5: 1249–1253. | PubMed | ChemPort |
54. Morrison DJ, English MA, Licht JD. WT1 induces apoptosis through transcriptional regulation of the proapoptotic Bcl-2 family member Bak. Cancer Res 2005; 65: 8174–8182. | Article | PubMed | ChemPort |
55. Mayo MW, Wang CY, Drouin SS, Madrid LV, Marshall AF, Reed JC et al. WT1 modulates apoptosis by transcriptionally upregulating the bcl-2 proto-oncogene. EMBO J 1999; 18: 3990–4003. | Article | PubMed | ISI | ChemPort |
56. Tatsumi N, Oji Y, Tsuji N, Tsuda A, Higashio M, Aoyagi S et al. Wilms' tumor gene WT1-shRNA as a potent apoptosis inducing agent for solid tumors. Int J Oncol 2008; 32: 701–711. | PubMed | ChemPort |

Acknowledgements

This work was supported by research grant P 46571-Q from Consejo Nacional de Ciencia y Tecnología (CONACYT).