Abstract
Background:
Carcinoma-associated fibroblasts (CAFs) can promote the progression of tumours in many ways. They can remodel the extracellular matrix to generate an environment that enables the invasion of cancer cells. We hypothesised that compounds that prevent matrix remodelling by CAFs would block their ability to promote carcinoma cell invasion.
Methods:
We designed a screen for compounds that interfere with CAF-promoted matrix remodelling. Hits from this screen were investigated in organotypic invasion models of squamous cell carcinoma (SCC).
Results:
We find that lovastatin and simvastatin reduce matrix remodelling by fibroblasts and thereby reduce SCC invasion. This class of compounds exert their effects partly through disrupting the function of Rab proteins, and we show a new role for Rab21 in promoting cancer cell invasion promoted by CAFs.
Conclusions:
Rab21 is required for CAFs to promote the invasion of cancer cells. It enables the accumulation of integrin α5 at the plasma membrane and subsequent force-mediated matrix remodelling.
Similar content being viewed by others
Main
The local invasion of cancer is a major problem and is frequently associated with distant metastases. However, cancer cell invasion is not solely determined by the characteristics of the cancer cells but also by multiple cell types within tumours, including fibroblasts and a range of immune cells (Egeblad et al, 2005). Matrix remodelling by fibroblasts generates paths through the extracellular matrix (ECM) that are subsequently used by cancer cells (Gaggioli et al, 2007). This process requires MMPs, integrins and the actin cytoskeleton (Friedl and Wolf, 2008). In particular, coordination of integrin-mediated matrix attachment and actomyosin force generation enable fibroblasts to move matrix components such as collagen fibres (Grinnell, 2003; Meshel et al, 2005). This process is regulated at many levels including the delivery of integrins to the plasma membrane, integrin activation, actin polymerisation and regulation of myosin activity (Grinnell, 2003). Integrin delivery and recycling is mediated through various vesicular compartments and is largely controlled by Rab family small G proteins (Jones et al, 2006; Pellinen and Ivaska, 2006). Both Rab 5 and Rab 21 have been localised to early endosomes from which integrins can be recycled back to the plasma membrane by either Rab4- or Rab11-dependent route (Jones et al, 2006; Pellinen et al, 2006). Ligand-bound integrins initiate a range of intracellular signalling pathways, including activation of actomysoin contraction. Myosin activity is largely controlled by the phosphorylation of MLC, which can be performed by numerous kinases including the RhoA-regulated kinases ROCK1 and ROCK2 (Olson and Sahai, 2009). Both ROCK and MLC function are required for matrix remodelling by fibroblasts (Gaggioli et al, 2007; Honjo et al, 2007; Yuge et al, 2007).
At a microscopic level matrix remodelling can be visualised by the appearance of holes in the ECM adjacent to the carcinoma-associated fibroblasts (CAFs) and the concentration of matrix fibres around cells. Many fibroblasts also have the ability to contract collagen gels at the macroscopic level (Ngo et al, 2006). We noted a good correlation between matrix remodelling at the microscopic and macroscopic levels and with the ability of CAFs to promote the invasion of squamous cell carcinoma (SCC) cells. We therefore hypothesised that matrix contraction by CAFs could be used as a screening method to identify compounds that prevent matrix remodelling and hence would reduce fibroblast-stimulated carcinoma cell invasion.
In this work we screen almost 200 compounds for their effect on matrix remodelling by CAFs. We find that two HMG-CoA reductase inhibitors reduce matrix remodelling by fibroblasts and consequently diminish cancer invasion. This class of compounds exert their effects partly through disrupting the function of Rab proteins and we show a new role for Rab21 in matrix remodelling associated with delivery of integrin α5 to the plasma membrane and the generation of contractile force.
Materials and methods
Cell culture and transfection
Carcinoma-associated fibroblasts and SCC12 were cultured as described by Gaggioli et al (2007). HN-CAF were transfected with 100 nM siRNA using Dharmafect 1 (Dharmacon; catalogue no. T-2001-03) 2 μl per well in six-well plates, Dharmafect 2 (Dharmacon; catalogue no. T-2002-03) was used for SCC12 siRNA transfection. Plasmid transfections were performed using Fugene-6. Human Rab11b and 21 cDNAs were fused on to the C terminus of mCherry and CFP respectively (details available on request). GFP-Rab5a was a gift from Sharon Tooze (Cancer Research UK London Research Institute).
The following siRNA reagents from Dharmacon were used: RabGGTaseβ #1, GAGAAUGAGUGGCAUCUAUUU; RabGGTaseβ #2, UUACUUGGCUGGUGGCUUUUU; Rab5a #1, GCUAUGAACGUGAAUGAUCUU; Rab5a #2, CAAGCCUGGUAUUACGUUUUU; Rab5a #3, ACAAACGUAUGGUGGAGUAUU; Rab11b #1, GACAGAAGCCCAACAAGCUUU; Rab11b #2, GGAUUCCACUAACGUAGAGUU; Rab11b #3, UAACGUAGAGGAAGCAUUCUU; Rab21 #1, GGAGAGACAUGUUUCCAUUUU; Rab21 #2, GAGUAAACCUUGCCAUAUGUU; Rab21 #4, CAAGAGAGAUUCCAUGCAUUU; Cdc42 #1, GUGGGUGCCUGAGAUAACUUU; Cdc42 #2, AGACUCCUUUCUUGCUUGUUU; Integrin α5 #1, GAACGAGUCAGAAUUUCGAUU; Integrin α5 #2, CAAACGCUCCCUCCCAUAUUU; RabGGTaseβ smart pool #M-007262-01; Rab4a smart pool #M-008539–01; Rab4b smart pool #M-008780-03; Rab5a smart pool #M-004009-00; Rab5b smart pool #M-004010-01; Rab8a smart pool #M-003905-00; Rab8b smart pool #M-008744-01; Rab11a smart pool #M-004726-02; Rab11b smart pool #M-004727-02; Rab21 smart pool #M-009450-01.
Compound screening
The ‘library’ of compounds for screening is described with Supplementary Table 1. A total of 2.5 × 103 CAFs were embedded in 1 ml of a mixture of collagen I and Matrigel yielding a final collagen I concentration of approximately 4.6 mg ml−1 and a final Matrigel concentration of 2.2 mg ml−1. Gel mix (100 μl) per well was plated in a 96-well plate. After the gel was set at 37°C for 1 h, 100 μl media containing inhibitors or growth factors (see above) were added on top of the gel at either 1 or 10 μ M final concentration for 4 days with 100 μl top up after 2 days. After 4 days, the plates were scanned and the diameter of the gel to well was measured using ImageJ software (http://rsbweb.nih.gov/ij/). The extent of contraction was assessed by subtracting the gel area from the well area. For each plate, the contraction values were normalised to the average contraction in the eight DMSO wells.
Microscopy
Cells were either plated on glass coverslips or seeded into a gel consisting of 2–2.5 mg ml−1 (BD Biosciences; catalogue no. 354234) Matrigel and 4.25–4.75 mg ml−1 collagen I (BD Biosciences; catalogue no. 354249). Cells were fixed using 4% paraformaldehyde in PBS and then permeablised using 0.25% Triton X-100 in PBS before blocking with 3% bovine serum albumin in PBS. The following primary antibodies were used diluted 1 : 100: anti-pS19-MLC2 (Cell Signaling; catalogue no. 3671), anti-α5 integrin (Santa Cruz; catalogue no. sc-13547), anti-Rab5a (Abcam; catalogue no. ab18211). Fluorescent time-lapse imaging used MARS-lifeact (Riedl et al, 2008) to highlight F-actin and CFP-Rab21. All fluorescent images were acquired using Zeiss LSM 510 confocal microscopes (Jena, Germany).
Organotypic invasion assays
Two types of organotypic assay were performed: either both cell types were alive simultaneously as described in Gaggioli et al (2007), or to more specifically evaluate the effect of compounds on either the CAFs or the carcinoma cells, the assay was divided into two phases. During the first phase CAFs were allowed 90–96 h to remodel the matrix in the absence of SCC12 cells before killing with 10 μg ml−1 puromycin. During this phase the matrix can be remodelled by fibroblasts leading to its contraction: at the start of the puromycin treatment the matrix was photographed to enable quantification of the extent of contraction. After extensive washing of the ECM with media for 24 h SCC12, cells were plated on top of the matrix that was mounted on a bridge at a gas/liquid interface and left for 5 days. Inhibitors could be added during either phase. Also all siRNA experiments were performed using this two-phase experimental design.
Western blotting
Western blots were performed using standard techniques. The following antibodies were used: Rab5a (Abcam; catalogue no. ab18211), Rab21 (Santa Cruz; catalogue no. sc-81917), RabGGTaseβ subunit (Abnova; catalogue no. h00005876-mo2), integrin α5 (Santa Cruz; catalogue no. sc-10729), pS19-MLC2 Cell Signaling (catalogue no. 3671) and MLC Cell Signaling (catalogue no. 3672).
Adhesion assays
Adhesion assays were performed as described by Pinner and Sahai (2008).
Flow cytometry
Analysis was performed as described by Brockbank et al (2005) using anti-α5 integrin (Santa Cruz; catalogue no. sc-13547) on non-permeablised cells.
Results
A chemical screen identifies statins as reducing matrix remodelling
Our previous work had shown a correlation between microscopic matrix remodelling and macroscopic gel contraction (Gaggioli et al, 2007). Further analysis showed a positive correlation between matrix contraction by CAFs and their ability to promote SCC invasion (Supplementary Figure 1). This led us to speculate that compounds that block matrix contraction would also block carcinoma cell invasion promoted by CAFs. To test this idea, we developed a high-throughput assay for matrix contraction. Carcinoma-associated fibroblasts consistently contract a collagen/Matrigel matrix in a 96-well plate over a 4-day period. Matrix contraction is blocked by a ROCK inhibitor, Y27632, which reduces actomyosin contraction (Figure 1A). This effect was simply quantified by measuring the area of the gel (Figure 1B).
We used 96-well plate assay to screen 182 inhibitors, growth factors and cytokines for their ability to modulate collagen contraction at both 1 and 10 μ M. The screen was performed twice and for each plate the matrix contraction was normalised to the average of the DMSO control points before the average of the two experiments was calculated. There were also 20 empty wells included in the screening plates and from these we estimated the normalised standard deviation of the assay as 0.08. Figure 1C, i and ii shows the range of normalised scores following both 1 and 10 μ M treatment. A smaller range of deviation from the controls was observed following 1 μ M treatment; although several compounds reduced collagen contraction at both concentrations (Figure 1C, iii). Compounds that reduced contraction to less than 0.6 at 1 μ M also reduced contraction at 10 μ M but that the converse was not necessarily true. The complete data set is listed in Supplementary Table 1; whereas selected classes of compounds are shown in Figure 1C, iv. Four out of the five compounds included in the screen reported to inhibit ROCK1 and 2 strongly reduced collagen contraction (including the well-established ROCK inhibitors Y27632 and H1152). The broad-spectrum MMP inhibitor GM6001 also inhibited matrix contraction. Interestingly, two HMG-CoA reductase inhibitors (simvastatin and lovastatin, generically referred to as statins) reduced collagen contraction by ∼0.4 and ∼0.1 normalised units at 10 and 1 μ M respectively (highlighted with red arrowheads in Figure 1C, iv). Statins are widely used to treat hypercholesterolaemia and have been associated with reduced cancer incidence and/or mortality (Demierre et al, 2005). We therefore decided to investigate their action on matrix remodelling by CAFs further.
We confirmed that the defects in collagen contraction observed macroscopically reflected defects in matrix re-organisation at the microscopic level. Control and DMSO-treated fibroblasts were able to both locally concentrate matrix (increased green signal around cells) and generate large holes (dark areas) in the matrix (Figure 1D). In contrast, these activities were defective in simvastatin- or lovastatin-treated fibroblasts. We next tested whether statins affect CAF-promoted SCC invasion. Figure 2A shows that both statins reduce SCC invasion in an organotypic model with IC50 values approximately 0.5–1 μ M. Supplementary Figure 2 shows that neither cell growth nor survival was significantly affected by statin doses below 5 μ M. The organotypic assay used to assess invasion depends on two cell types, the SCC cells and CAFs, either one of which could be affected by statin treatment. To determine which cell type is critically affected by statins, we used a modified assay in which fibroblast-mediated matrix remodelling and SCC invasion into the matrix occur sequentially (Gaggioli et al, 2007). Statins were then applied either during the fibroblast-promoted matrix remodelling phase or the SCC invasion phase when carcinoma cells move into a matrix that has previously been ‘conditioned’ by CAFs. Figure 2B and C shows that 1 μ M simvastatin or lovastatin treatment during the matrix remodelling phase reduces SCC invasion but treatment after this phase has no effect. These data indicate that statins prevent CAFs from generating a matrix that is permissive for SCC invasion and not by preventing SCC cells invading an already permissive matrix.
Rab protein lipid modification is required for matrix remodelling
Statins modulate cholesterol biosynthesis indirectly and also affect the production of many other metabolites (Werner et al, 2002; Walker and Olson, 2005). In particular, the biosynthesis of mevalonate, geranyl-, farnesyl- and geranylgeranyl-pyrophosphate is affected by statin treatment. To investigate the mechanism of statin action in more detail, we attempted to ‘rescue’ the effect of statin treatment by adding additional mevalonate or geranylgeranyl-pyrophosphate. As expected, mevalonate restored both matrix contraction by CAFs and their ability to generate matrix permissive for SCC12 invasion (Figure 2D and E). In addition, geranylgeranyl-pyrophosphate significantly restored these activities in CAFs (Figure 2D and E). This finding is striking because geranylgeranyl-pyrophosphate is not an intermediate between HMG-CoA reductase and cholesterol synthesis but is largely used to modify small G proteins and enable their interaction with cellular membranes. Furthermore, previous reports have documented defects in small G-protein targeting after statin treatment (Laezza et al, 1998; Kusama et al, 2001; Holstein et al, 2002; Ghittoni et al, 2005; Walker and Olson, 2005). In agreement with these findings, simvastatin and lovastatin both affected the subcellular localisation of a range of small G proteins in CAFs (Figure 3A and B). Of the proteins investigated, the subcellular targeting of Rab5 and RhoA was most sensitive to statin treatment with pronounced effects observed at doses that also reduce fibroblast-stimulated SCC invasion (1 μ M). We have previously shown a role for RhoA in matrix remodelling by CAFs (Gaggioli et al, 2007) but were intrigued by the possibility that Rab proteins may also be critical for this process.
To test whether the geranylgeranyl modification of Rab proteins is required for CAFs to promote SCC invasion, we depleted the enzyme that adds the lipid groups to Rab proteins. Two independent siRNA to the RabGGTaseβ subunit effectively depleted that protein and also prevented fibroblasts from contracting the ECM (Figure 3C and D). Furthermore, siRNA against RabGGTaseβ subunit dramatically reduced the ability of CAFs to promote the invasion of SCC cells (Figure 3D). These data show that lipid modification of Rab proteins is critical for CAF-promoted cancer cell invasion. We next wished to determine which Rabs might be required for CAFs to promote SCC invasion. We therefore screened numerous Rabs that have been implicated in cytoskeletal regulation, integrin or MMP trafficking. Figure 5A shows that siRNA smart pools to Rab4b, Rab5a, Rab8a, Rab8b, Rab11b and Rab21 reduced the ability of CAFs to contract the ECM (Figure 4A). Correspondingly, all these Rabs except Rab4a reduced CAF-promoted SCC invasion (Figure 4B). The results for Rab5a, Rab11b and Rab21 could be reproduced using at least three independent siRNA targeting sequences (Figure 4C, i). The efficiency of siRNA knockdown of Rab5a and Rab21 is shown in Figure 4C, ii and iii. Interestingly, depletion of Rab5a, 11b or 21 in carcinoma cells did not affect their ability to invade into matrix that had previously been remodelled by fibroblasts (Figure 4D).
Rab21 is required for integrin α5 accumulation at the plasma membrane
Rab5a, 11 and 21 have all been implicated in the recycling of integrins, although Rab11 is implicated in a different recycling route from Rabs5a and 21 (Jones et al, 2006; Pellinen et al, 2006). In agreement with this we found that there was extensive colocalisation between Rab5a and Rab21 but not with Rab11b (Supplementary Figure 3). To learn more about the role of these Rabs, we performed time-lapse imaging of control and Rab-depleted CAFs plated on deformable collagen-rich matrices. Mock- or control-transfected CAFs exhibited broad cell protrusions that were either associated with cell motility or local deformation of the matrix (Supplementary Movie 1). In contrast, Rab5a-, 11b- or 21-depleted cells had more transient protrusions that were not usually associated with matrix deformation or movement (Rab21siRNA shown in Supplementary Movie 2). To determine if depletion of Rab5a, Rab11b or Rab21 was simply preventing fibroblasts from adhering to the matrix, we performed cell adhesion assays. Adhesion to the collagen I/Matrigel mixture used in our assays was reduced to varying degrees by depletion of Rab GGTaseβ, Rab11b and Rab5a, and by an integrin β1 blocking antibody (Figure 5A). Interestingly, siRNA against Rab21 had no effect: therefore, defects in matrix remodelling in the absence of Rab21 are not due to a failure to adhere to the ECM (Figure 5A). This led us to focus our attention on Rab21. We confirmed that low doses of statins disrupted the subcellular localisation of Rab21 (Supplementary Figure 4).
We next investigated if Rab21 was having a more specific effect on the cell adhesion machinery. Analysis of the location of a range of integrins revealed that a fraction of integrin α5 colocalised with Rab5a and Rab21 in fibroblasts in three-dimensional matrices (Figure 5B). In many cases Rab21 appeared to be most concentrated around the outside of the Rab5a- and integrin α5-positive vesicles (in top part of panels, marked with arrowheads). We therefore investigated if Rab5a or Rab21 were involved regulating integrin α5 in CAFs. Depletion of Rab21 and, to a lesser extent, Rab5a led to accumulation of integrin α5 in internal vesicular structures with slightly lower levels of plasma membrane staining (Figure 5C, marked with red arrowheads). We used quantitative flow cytometry to confirm the reduction in integrin α5 levels at the plasma membrane following Rab21 depletion (Figure 5D). In the absence of Rab21 integrin α5 accumulates in intracellular vesicles positive for Rab5 (Figure 5E) and EE1A (data not shown). Total integrin α5 levels were not significantly affected by Rab21 siRNA (Figure 5E). We did not see any dramatic changes in the distribution of integrin β1, α3 or αV in Rab21-depleted cells (Supplementary Figure 5), nor did we observe affects on cell proliferation following Rab21 knockdown (Supplementary Figure 6A). Together these data suggest that Rab21 is required for efficient delivery of integrin α5 to the plasma membrane.
ROCK-dependent regulation of actomyosin contractility is critical for matrix remodelling (Figure 1; Gaggioli et al, 2007). We therefore tested whether fibroblasts lacking Rab21 or integrin α5 had defects in the activation of the actomyosin contractile machinery. Control cells typically had an elongated morphology with thick actin cables associated with phosphorylated ‘active’ MLC running along their length. Strikingly, cells depleted for Rab21 had a less elongated morphology (quantification is shown in Supplementary Figure 6B). Rab21-depleted cells also lacked contractile actomyosin cables spanning the cell body, although phosphorylated MLC could still be detected (Figure 6A). Fibroblasts depleted for integrin α5 also had reduced levels of phosphorylated MLC associated with F-actin cables. Western blot analysis confirmed that Rab21 and integrin α5 regulate MLC phosphorylation in CAFs (Figure 6B). We further probed the relationship between Rab21 and cell contractility by analysing Rab21 dynamics in CAFs plated on deformable matrices. Figure 6C shows that Rab21 is much more prominently localised in areas of the cell that are contracting compared to those that are protruding (also Supplementary Movie 3). These data suggest that the localised delivery of Rab21 cargoes, such as integrin α5, can promote the generation of contractile force.
To determine whether reduced integrin α5 function could account for the reduced ability of Rab21-depleted CAFs to contract the matrix and promote SCC invasion, we investigated the effect of integrin α5 depletion. Figure 7A shows that depletion of integrin α5 reduces matrix contraction by CAFs (efficacy of siRNAs #1 and 2 shown in Figure 6A). Correspondingly, integrin α5 depletion also reduces the ability of CAFs to promote SCC invasion (Figure 7B). These data support integrin α5 delivery to the plasma membrane as a key function of Rab21 in enabling CAF-promoted SCC invasion.
Discussion
Matrix remodelling by fibroblasts is critical for normal and pathological processes including wound healing, fibrosis and cancer invasion (Grinnell, 2003). One manifestation of matrix remodelling is contraction of collagen gels (Ngo et al, 2006). We noted a correlation between CAF-promoted matrix contraction and their ability to promote the invasion of carcinoma cells. Therefore, we screened ∼200 compounds to identify agents that would prevent matrix contraction with the hope that they would also reduce fibroblast-promoted carcinoma invasion. Numerous compounds were identified in this screen; however, many were discarded when we tested their effect on cell viability. We also noticed that many compounds that reportedly have the same molecular target gave different matrix contraction scores (Supplementary Table 1). This may reflect differing stabilities of the compounds in the 4-day matrix contraction assay, varying degrees of efficacy or off-target effects.
We focused on two related agents that scored similarly in the matrix contraction assay, simvastatin and lovastatin. As we hypothesised, these compounds also reduced the ability of CAFs to promote cancer cell invasion. Statins are of interest because several studies have shown reduced cancer incidence or mortality in patients taking these drugs for elevated cholesterol (Demierre et al, 2005). Several mechanisms have been put forward to account for these observations (Murtola et al, 2008). Here, we show that statins reduce cancer invasion by targeting the stromal compartment. Specifically, statins reduce the ability of CAFs to remodel the matrix in a way that enables carcinoma cell invasion. Importantly, this effect occurs at doses (0.5 and 1 μ M) that are not cytotoxic or cytostatic and are close to those observed in cancer patients (Holstein et al, 2006). Consistent with this, statins can reduce the activation of other types of fibroblast and matrix contraction (Meyer-Ter-Vehn et al, 2008; Burke et al, 2009), although Rab proteins were not implicated. This suggests reduced matrix remodelling by the stroma could partly account for the altered cancer incidence in people taking statins. However, this study does not exclude other mechanisms.
Further analysis led us to conclude that cholesterol is not the critical target involved in matrix remodelling but to focus on proteins that have GGPP modifications. At least three Rab proteins (5a, 11b and 21) are required in CAFs for their ability to promote SCC invasion. Depletion of these Rabs did not affect the ability of SCC cells to invade matrix that had previously been remodelled by CAFs; this is probably because the ‘following’ SCC cells do not remodel the ECM and therefore matrix remodelling pathways are dispensable in SCC cells. Subsequent experiments showed that Rab21 is specifically required for effective integrin α5 accumulation at the plasma membrane. When Rab21 is absent, integrin α5 accumulates in Rab5a-positive vesicles suggesting that Rab21 is required for exit from this compartment (Figure 7C). Provocatively, Rab21-positive vesicles are preferentially localised to areas of cell contraction and both Rab21 and integrin α5 are needed for MLC phosphorylation. These data led us to propose that Rab21 delivers integrin α5 to the plasma membrane where it locally signals to the contractile machinery. Interestingly, a connection between Rab21, integrins and actomyosin regulation has been reported during cytokinesis (Pellinen et al, 2006, 2008). This is probably through the activation of Rho–ROCK function as ligand-bound integrin α5 can signal to RhoGEFs and thereby increase Rho activity (Ren et al, 1999; Dubash et al, 2007; Huveneers et al, 2008). Integrin α5 has also been implicated in collagen gel contraction in other fibroblast types (Liu et al, 2006). In these experiments it appears that other integrins are unable to compensate for loss of integrin α5 function. Our data do not exclude the possibility that Rab21 is required for the delivery or trafficking of other critical targets, in addition to integrin α5.
The analysis performed here illustrates that targeting of the stroma alone can reduce the invasion of cancer cells. Unfortunately, it also implies that the implementation of anti-invasion agents that target matrix remodelling may only be of limited use if the matrix surrounding a tumour is already permissive for carcinoma invasion. Nonetheless, statins may be useful in slowing the progression of early stage lesions and in range of other pathologies associated with aberrant fibroblast-mediated matrix remodelling, such as scarring and fibrosis. In conclusion, we have shown the feasibility of intermediate- to high-throughput screening of compounds that block matrix remodelling by fibroblasts. Following on from this, we have shown that statins reduce SCC invasion by targeting matrix remodelling by CAFs and have uncovered a critical role for Rab21 in this process.
Change history
16 November 2011
This paper was modified 12 months after initial publication to switch to Creative Commons licence terms, as noted at publication
References
Brockbank EC, Bridges J, Marshall CJ, Sahai E (2005) Integrin beta1 is required for the invasive behaviour but not proliferation of squamous cell carcinoma cells in vivo. Br J Cancer 92: 102–112
Burke JP, Watson RW, Murphy M, Docherty NG, Coffey JC, O’Connell PR (2009) Simvastatin impairs smad-3 phosphorylation and modulates transforming growth factor beta1-mediated activation of intestinal fibroblasts. Br J Surg 96: 541–551
Demierre MF, Higgins PD, Gruber SB, Hawk E, Lippman SM (2005) Statins and cancer prevention. Nat Rev Cancer 5: 930–942
Dubash AD, Wennerberg K, Garcia-Mata R, Menold MM, Arthur WT, Burridge K (2007) A novel role for Lsc/p115 RhoGEF and LARG in regulating RhoA activity downstream of adhesion to fibronectin. J Cell Sci 120: 3989–3998
Egeblad M, Littlepage LE, Werb Z (2005) The fibroblastic coconspirator in cancer progression. Cold Spring Harb Symp Quant Biol 70: 383–388
Friedl P, Wolf K (2008) Tube travel: the role of proteases in individual and collective cancer cell invasion. Cancer Res 68: 7247–7249
Gaggioli C, Hooper S, Hidalgo-Carcedo C, Grosse R, Marshall JF, Harrington K, Sahai E (2007) Fibroblast-led collective invasion of carcinoma cells with differing roles for RhoGTPases in leading and following cells. Nat Cell Biol 9: 1392–1400
Ghittoni R, Patrussi L, Pirozzi K, Pellegrini M, Lazzerini PE, Capecchi PL, Pasini FL, Baldari CT (2005) Simvastatin inhibits T-cell activation by selectively impairing the function of Ras superfamily GTPases. FASEB J 19: 605–607
Grinnell F (2003) Fibroblast biology in three-dimensional collagen matrices. Trends Cell Biol 13: 264–269
Holstein SA, Knapp HR, Clamon GH, Murry DJ, Hohl RJ (2006) Pharmacodynamic effects of high dose lovastatin in subjects with advanced malignancies. Cancer Chemother Pharmacol 57: 155–164
Holstein SA, Wohlford-Lenane CL, Hohl RJ (2002) Consequences of mevalonate depletion. Differential transcriptional, translational, and post-translational up-regulation of Ras, Rap1a, RhoA, and RhoB. J Biol Chem 277: 10678–10682
Honjo M, Tanihara H, Kameda T, Kawaji T, Yoshimura N, Araie M (2007) Potential role of Rho-associated protein kinase inhibitor Y-27632 in glaucoma filtration surgery. Invest Ophthalmol Vis Sci 48: 5549–5557
Huveneers S, Truong H, Fassler R, Sonnenberg A, Danen EH (2008) Binding of soluble fibronectin to integrin alpha5 beta1-link to focal adhesion redistribution and contractile shape. J Cell Sci 121: 2452–2462
Jones MC, Caswell PT, Norman JC (2006) Endocytic recycling pathways: emerging regulators of cell migration. Curr Opin Cell Biol 18: 549–557
Kusama T, Mukai M, Iwasaki T, Tatsuta M, Matsumoto Y, Akedo H, Nakamura H (2001) Inhibition of epidermal growth factor-induced RhoA translocation and invasion of human pancreatic cancer cells by 3-hydroxy-3-methylglutaryl-coenzyme a reductase inhibitors. Cancer Res 61: 4885–4891
Laezza C, Bucci C, Santillo M, Bruni CB, Bifulco M (1998) Control of Rab5 and Rab7 expression by the isoprenoid pathway. Biochem Biophys Res Commun 248: 469–472
Liu Y, Yanai R, Lu Y, Kimura K, Nishida T (2006) Promotion by fibronectin of collagen gel contraction mediated by human corneal fibroblasts. Exp Eye Res 83: 1196–1204
Meshel AS, Wei Q, Adelstein RS, Sheetz MP (2005) Basic mechanism of three-dimensional collagen fibre transport by fibroblasts. Nat Cell Biol 7: 157–164
Meyer-Ter-Vehn T, Katzenberger B, Han H, Grehn F, Schlunck G (2008) Lovastatin inhibits TGF-beta-induced myofibroblast transdifferentiation in human tenon fibroblasts. Invest Ophthalmol Vis Sci 49: 3955–3960
Murtola TJ, Visakorpi T, Lahtela J, Syvala H, Tammela T (2008) Statins and prostate cancer prevention: where we are now, and future directions. Nat Clin Pract Urol 5: 376–387
Ngo P, Ramalingam P, Phillips JA, Furuta GT (2006) Collagen gel contraction assay. Methods Mol Biol (Clifton, NJ) 341: 103–109
Olson MF, Sahai E (2009) The actin cytoskeleton in cancer cell motility. Clin Exp Metastasis 26: 273–287, e-pub 23 May 2008
Pellinen T, Arjonen A, Vuoriluoto K, Kallio K, Fransen JA, Ivaska J (2006) Small GTPase Rab21 regulates cell adhesion and controls endosomal traffic of beta1-integrins. J Cell Biol 173: 767–780
Pellinen T, Ivaska J (2006) Integrin traffic. J Cell Sci 119: 3723–3731
Pellinen T, Tuomi S, Arjonen A, Wolf M, Edgren H, Meyer H, Grosse R, Kitzing T, Rantala JK, Kallioniemi O, Fassler R, Kallio M, Ivaska J (2008) Integrin trafficking regulated by Rab21 is necessary for cytokinesis. Dev Cell 15: 371–385
Pinner S, Sahai E (2008) PDK1 regulates cancer cell motility by antagonising inhibition of ROCK1 by RhoE. Nat Cell Biol 10: 127–137
Ren XD, Kiosses WB, Schwartz MA (1999) Regulation of the small GTP-binding protein Rho by cell adhesion and the cytoskeleton. EMBO J 18: 578–585
Riedl J, Crevenna AH, Kessenbrock K, Yu JH, Neukirchen D, Bista M, Bradke F, Jenne D, Holak TA, Werb Z, Sixt M, Wedlich-Soldner R (2008) Lifeact: a versatile marker to visualize F-actin. Nat Methods 5: 605–607
Walker K, Olson MF (2005) Targeting Ras and Rho GTPases as opportunities for cancer therapeutics. Curr Opin Genet Dev 15: 62–68
Werner N, Nickenig G, Laufs U (2002) Pleiotropic effects of HMG-CoA reductase inhibitors. Basic Res Cardiol 97: 105–116
Yuge A, Nasu K, Matsumoto H, Nishida M, Narahara H (2007) Collagen gel contractility is enhanced in human endometriotic stromal cells: a possible mechanism underlying the pathogenesis of endometriosis-associated fibrosis. Hum Reprod 22: 938–944
Acknowledgements
We thank Mike Howell, our institute pathology services, and Debbie Aubyn for technical assistance, and Michael Olson and Michael Way for their comments. This work was funded by Cancer Research UK.
Author information
Authors and Affiliations
Corresponding author
Additional information
Supplementary Information accompanies the paper on British Journal of Cancer website (http://www.nature.com/bjc)
Rights and permissions
From twelve months after its original publication, this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/3.0/
About this article
Cite this article
Hooper, S., Gaggioli, C. & Sahai, E. A chemical biology screen reveals a role for Rab21-mediated control of actomyosin contractility in fibroblast-driven cancer invasion. Br J Cancer 102, 392–402 (2010). https://doi.org/10.1038/sj.bjc.6605469
Received:
Revised:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1038/sj.bjc.6605469
Keywords
This article is cited by
-
The Role of Rab GTPases in the development of genetic and malignant diseases
Molecular and Cellular Biochemistry (2024)
-
Identification of a novel therapeutic candidate, NRK, in primary cancer-associated fibroblasts of lung adenocarcinoma microenvironment
Journal of Cancer Research and Clinical Oncology (2021)
-
Regulation of heterogeneous cancer-associated fibroblasts: the molecular pathology of activated signaling pathways
Journal of Experimental & Clinical Cancer Research (2020)
-
A framework for advancing our understanding of cancer-associated fibroblasts
Nature Reviews Cancer (2020)
-
Proteomics profiling identify CAPS as a potential predictive marker of tamoxifen resistance in estrogen receptor positive breast cancer
Clinical Proteomics (2015)