A novel male sterility-fertility restoration system in plants for hybrid seed production

Singh, Surendra Pratap; Singh, Sudhir P.; Pandey, Tripti; Singh, Ram Rakshpal; Sawant, Samir V.

doi:10.1038/srep11274

Download PDF

Article
Open access
Published: 15 June 2015

A novel male sterility-fertility restoration system in plants for hybrid seed production

Surendra Pratap Singh¹,
Sudhir P. Singh³,
Tripti Pandey¹,
Ram Rakshpal Singh⁴ &
…
Samir V. Sawant^1,2

Scientific Reports volume 5, Article number: 11274 (2015) Cite this article

13k Accesses
22 Citations
5 Altmetric
Metrics details

Subjects

Abstract

Hybrid seeds are used for stimulated crop production, as they harness heterosis. The achievement of complete male-sterility in the female-parent and the restored-fertility in F1-hybrids are the major bottlenecks in the commercial hybrid seed production. Here, we report a male sterility–fertility restoration system by engineering the inmost nutritive anther wall layer tapetum of female and male parents. In the female parent, high–level and stringent expression of Arabidopsis autophagy–related gene BECLIN1 was achieved in the tapetum, which altered the tapetal degeneration program, leading to male sterility. This works on our previously demonstrated expression cassette based on functional complementation of TATA-box mutant (TGTA) promoter and TATA-binding protein mutant3 (TBPm3), with modification by conjugating Long Hypocotyle in Far-Red1 fragment (HFR1^NT131) with TBPm3 (HFR1^NT131-TBPm3) to exercise regulatory control over it. In the male parent, tapetum–specific Constitutive photo-morphogenesis1 (COP1) was expressed. The F1 obtained by crossing these engineered parents showed decreased BECLIN1 expression, which was further completely abolished when COP1-mutant (COP1^L105A) was used as a male parent, leading to normal tapetal development and restored fertility. The system works on COP1-HFR1 interaction and COP1–mediated degradation of TBPm3 pool (HFR1^NT131-TBPm3). The system can be deployed for hybrid seed production in agricultural crops.

A spontaneous thermo-sensitive female sterility mutation in rice enables fully mechanized hybrid breeding

Article 06 September 2022

Haoxuan Li, Chenjiang You, … Guanqun Wang

One-step creation of CMS lines using a BoCENH3-based haploid induction system in Brassica crop

Article Open access 18 March 2024

Fengqing Han, Xiaoli Zhang, … Zhansheng Li

Disruption of the bHLH transcription factor Abnormal Tapetum 1 causes male sterility in watermelon

Article Open access 01 December 2021

Ruimin Zhang, Jingjing Chang, … Chunhua Wei

Introduction

Hybrid crops have been contributing to the substantial global rise in agricultural output over the past few decades as they harness heterosis (hybrid vigor), a phenomenon of outperformance of F1 hybrid progeny compared with their parents in terms of yield, biotic and abiotic resistance¹. Their utilization offers a 20% to more than 50% yield increase² and contributes to more than half of the production of the major crops³. Precise control over pollen fertility in the female parent and the fertility restoration in F1 hybrids are the prerequisites in the commercial production of the F1 hybrid in self-pollinating crops⁴. Restoration of male fertility in hybrids is especially important in crops where the desired agricultural products are seeds, such as cereals, pulses and so on.

Several approaches have been explored to limit self-fertilization in the female parent line for the development of an effective hybrid seed production system, such as emasculation (manual removal of male reproductive organs), chemical-induced male sterility, cytoplasmic and nuclear male sterility and biotechnological approaches for pollen abortion. Emasculation involves labor-intensive and time-consuming processes for large-scale hybrid seed production. The use of chemicals is limited by the issues related to bio-safety, variable effects, optimum dose and cost effectiveness⁵. The cytoplasmic and nuclear male sterility is limited by maintenance of multiple lines, partial and unstable male sterility and limited fertility restoring gene sources, all of which restrict the economic benefits of the hybrid⁶. A number of biotechnological strategies have been deployed to restrict self–fertilization in plants⁷. Several of the transgenic systems possess the male fertility–restoring constituent^{8,9,10,11,12,13,14,15,16,17}. However, the only commercialized transgenic male sterility method is SeedLink^TM, which relies on the expression of bacterial cytotoxic ribonuclease (Barnase) in the male reproductive organ of the female parent line and fertility restoration by ribonuclease inhibitor (Barstar) delivered by the male parent^18,19. Barnase-barstar system is tested in many crops²⁰; however, issues such as leaky expression of the barnase gene and difficulty in obtaining restoration lines of the barstar gene^{9,20,21,22,23} and biosafety concerns associated with the use of the bacterial cytotoxic gene in food crops are the key challenges associated with its applicability. Hence, it is desirable to develop a hybrid seed system that is equipped with capabilities of complete pollen abortion in a biologically safe and tightly controlled manner, as well as efficient male fertility restoration in the F1 hybrid.

Tapetum is the sporophytic tissue and innermost wall layer of the micro-sporangia in the angiosperm plants²⁴. It plays an important role in the development of male gametophyte (microspore) by providing enzymes, nutrients and wall material, first by secretion and eventually by degeneration²⁵. Tapetal degeneration is a programmed cell death (PCD) event^26,27 with typical cytological features of cell shrinkage, mitochondria and cytoskeleton degeneration, nuclear condensation, oligonucleosomal cleavage of DNA, vacuole rupture and endoplasmic reticular swelling^{26,28,29,30,31}. Tapetal PCD at a specific developmental stage is crucial for pollen fertility and disruption of the timing of PCD, either early or delayed, results in pollen abortion or male sterility. Several transgenic approaches have been developed to generate male sterile plants either through early tapetum degeneration by expressing BARNASE¹⁸, RNase -1¹⁹, DIPTHERIA TOXIN-A³², RIBOSOME INACTIVATING PROTEIN³³ and BAX²⁸, or by delaying tapetal PCD through BAX INHIBITOR²⁸, ethylene receptor gene Cm-ETR1/H69A³⁴, cystein protease BoCysP1 and BoCP3³⁵.

Here, we established a transcription regulation system for male sterility–fertility restoration in plants. It includes two tapetum-specific expression cassettes; one expressed in the female parent and the other expressed in the male parent of the desired F1 progeny. The female expression cassette has the potential to attain high-level, stringent expression of a desired gene limited to tapetal cells, but the expression switches to abolition in F1 when regulated by the male component. We successfully deployed this system to express the desired gene (we earlier demonstrated for male sterility) Arabidopsis BECLIN1¹⁵, which generates the complete male sterile parent by altering the tapetal degeneration program. The male fertility of F1 progeny was completely restored due to the abolished expression of BECLIN1,> as the tapetal degeneration program was sustained to be normal. The female component works on the functional complementation of mutated TATA-box (TGTA) and TBPm3³⁶ with aided HFR1^NT131 fused to TBPm3 (HFR^1NT131-TBPm3). The abolition of BECLIN1 expression in F1 was achieved by limiting TBPm3 through COP1 (male component) –mediated degradation^37,38,39 of the fusion protein HFR1^NT131-TBPm3. Nicotiana tabacum has been used for the proof of principle presented here, but the essential elements of the technology are generic and possibly will work in other crops.

Results

High-level, stringent and spatio-temporal expression of the desired gene in postmeiotic tapetum

We have previously utilized TATA box binding protein mutant3 (TBPm3) and TATA-box mutation TGTA complementation system³⁶ for high-level and stringently regulated expression in anther tapetum¹⁵. The expression through promoters with TATA-box mutated to TGTA was not driven by a native TBP protein because of its altered affinity^40,41,42, however, three amino-acid substitution mutant (Ile₁₅₂ to Phe₁₅₂, Val₁₆₁ to Thr_161, and Leu₁₆₃ to Val₁₆₃) of TBP (TBPm3) complement the TGTA-mutation and drive the expression from such promoters^43,44. The high-level expression of the TGTA-TBPm3 complementation system was achieved due to a dedicated pool of TBPm3 protein to TGTA-containing promoters^15,36,45. In this work, we seek transcriptional control over the TGTA-TBPm3 complemented system by fusing TBPm3 with the 131 amino-acid N-terminal domain of HFR1 (HFR1^NT131) and specifically targeting it for degradation by COP1, thus limiting TBPm3 protein in the cell. The limited cellular availability of TBPm3 protein leads to the abolition of expression of the transgene in tapetum cells (Fig. 1a–c). Tapetum-specific promoter TA₂₉ (^PTA₂₉)⁴⁶ was utilized to construct a TGTA-TBPm3 complemented system to attain high-level and stringent expression, specific to the postmeiotic tapetum as previously described¹⁵, with a modification of fusing HFR1^NT131 at the N-terminus of TBPm3 to excercise further control over it (Supplementary Fig. S1-a-I). The transgenic lines of Nicotiana tabacum cv. Petit Havana (NTPH) harboring this expression cassette 1370 (carrying TGTA-driven gusA gene and HFR1^NT131:TBPm3 fusion in a single T-DNA cassette; Supplementary Fig. S1-a-I) were normal during growth and development with a similar range of pollen viability, germination and seed setting when compared with NTPH plants (Supplementary Fig. S1-b and c). The anther development has been divided into seven premeiotic (−7 to −1; negative sign represents stages before the meiosis) and twelve postmeiotic stages (1 to 12) in tobacco⁴⁶. The expression of gusA protein was examined in the anthers of stages 2 and 3 in 1370 transgenic lines. The gusA expression in the stage 2 anther ranges from 11.45 nmoles mg⁻¹min⁻¹ to 47.57 nmoles m⁻¹min⁻¹ (Supplementary Fig. S2-a), with an average expression of 22.00 ± 5.15 nmoles mg⁻¹min⁻¹ (Fig. 2b); at stage 3, the expression ranges from 10.45 nmoles mg⁻¹min⁻¹ to 45.65 nmoles mg⁻¹min⁻¹(Supplementary Fig. S2-b), with average expression being 20.43 ± 5.74 nmoles mg⁻¹min⁻¹(Fig. 2b) in the anthers of transgenic lines evaluated. Histochemical GUS staining confirmed that the expression of gusA protein was limited to tapetal cells in anthers (Fig. 2d). Expression was not detected in other plant organs such as leaves, emasculated flower buds, stems and roots (data not shown). Taken together, our results showed that high-level and stringent expression was achieved in the postmeiotic (stages 2 and 3) tapetum, using the expression vector 1370.

Transcriptional abolition of TGTA-TBPm3 system based on HFR1^NT131-COP1^L105A–mediated light signalling

To evaluate whether limiting cellular protein levels of TBPm3 can abolish gusA expression, we developed transgenic tobacco lines expressing COP1 under the control of Arabidopsis tapetum-specific promoter A9 (^PA9)⁴⁷. In construct 1370, the desired gene (gusA in the case of 1370 cassette) was expressed under the control of the TGTA-mutated tapetum-specific promoter and the translationally fused HFR1^NT131-TBPm3 complex was under the regulation of the Pcec promoter⁴⁸. HFR1^NT131 is a truncated form (NT131: N-terminus 131-amino-acid fragment) of Long Hypocotyle in Far Red1 (HFR1), a basic helix-loop-helix (bHLH) involved in the seedling response to far-red light. The NT131 amino-acid fragment loses its bioactivity but retains its interaction ability with another protein COP1 (Fig.1a–c). COP1 is a repressor of light-mediated photo-morphogenesis that physically interacts with HFR1 (and HFR1^NT131) and mediates its targeted degradation through the proteosome^37,39,49,50. We, therefore, postulated that the fusion protein HFR1^NT131:TBPm3 will also be degraded by COP1 and this was exploited to exercise control over the TGTA-TBPm3 complementation system (construct 1370). To achieve this, a regulatory expression cassette (1372) was designed, in which the Arabidopsis COP1 gene was placed under the control of the Arabidopsis tapetum-specific promoter A9 (^PA9)⁴⁷ (Supplementary Fig. S1-a-III). The tobacco transgenic lines of 1372 were normal during growth and development with normal flowering, pollen viability, in-vitro pollen germination and seed setting similar to those of the control (NTPH) plants (Supplementary Fig. S1b-c and S3a-d). The relative expression of COP1 was evaluated using qRT-PCR in anther developmental stages 1 to 6. The highest expression was found in the stage 1 anthers (Supplementary Fig. S3-e). To screen the best expressing transgenic lines, relative expression of COP1 was compared using qRT-PCR in the stage 1 anthers in 19 transgenic lines. The transgenic lines 13 and 33 were selected for further studies based on their higher expression (Supplementary Fig. S4-a). To validate our hypothesis of achieving transcriptional control over the TGTA-TBPm3 system by COP1-mediated degradation of HFR1^NT131-TBPm3, crossing was performed between female 1370 lines (L3 and L5; Supplementary Fig. S2-a) and male 1372 plants (T13 and T33; Supplementary Fig. S4-a), raising F1 progeny. The F1 seeds were harvested, subjected to double antibiotic selection of kanamycine and hygromycine, considering the selectable marker genes of the constructs 1370 (NPTII) and 1372 (HPTII) and further confirmed by PCR (Supplementary Fig. S5a–c). The fluorimetric GUS analysis revealed a 4–6–fold reduced GUS activity in the anthers of F1 plants during stages s2 and s3 as compared to 1370 plants (Fig. 2b, Supplementary Fig. S2-c and d). Histochemical GUS staining of F1 plants revealed that the GUS expression was stringent to tapetal cells but diminished when compared with 1370 (Fig. 2e) Thus, COP1 imparts its control over the TGTA-TBPm3 system that is mediated by HFR1^NT131- linked TBPm3 protein (HFR1^NT131-TBPm3) degradation in F1 plants, albeit the expression was not completely abolished. The one reason for incomplete control of COP1 could be its light-responsive nuclear and cytoplasmic localiszation.

To develop a fertility restoration system, it is necessary to completely abolish the expression of the male sterility gene (here, BECLIN1) in the F1 hybrid. We postulate that increased nuclear localization of COP1 should cause complete degradation of HFR1^NT131-TBPm3, resulting in its unavailability to form the transcriptional pre-initiation complex (PIC) on the TGTA-mutated TATA-box of the ^PTA₂₉ promoter, leading to expression abolition in F1 progeny. To achieve it, COP1 was mutated to COP1^L105A. The mutation in COP1 (COP1^L105A) was reported to increase nuclear localization but it retained its normal functioning³⁸. The expression cassette 1373 (Supplementary Fig. S1-a-iv) was designed to express mutated COP1 (COP1^L105A) using ^PA9. The transgenic plants expressing COP1^L105Awere found to be normal during growth, development and fertility (Fig. 2g–j, Supplementary Fig. S1a-b). The highest COP1^L105A expression was found at the s1 anther development stage (Fig. 2k). Fifteen transgenic lines were compared for relative expression; lines 3 and 5 were selected for the crossing experiment based on their higher expression (Supplementary Fig. S4-b). The cross was made between female 1370 (emasculated) and male 1373 to raise F’₁ seeds. The F’₁ seeds were screened on double antibiotic selection medium (Kanamycin and Hygromycin) and standard PCR. The fluorimetric and histochemical GUS analysis of anthers of F’₁ plants at developmental stages s2 and s3 showed completely abolished expression of gusA protein (Fig. 2b,f and Supplementary Fig. S2e,f). The results indicated that the nuclear localization of COP1^L105A imparts its complete control over the TGTA-TBPm3 system through HFR1^NT131-mediated degradation of TBPm3.

Complete male sterility by high-level expression of BECLIN1 in tapetum cells

We previously demonstrated that high-level expression of Arabidopsis ATG6/BECLIN1 in the tapetum under control of the TGTA-TBPm3 complementation system leads to complete male sterility in tobacco¹⁵. To develop a male sterility–fertility restoration system, we cloned Arabidopsis ATG6/BECLIN1 into the 1370 vector replacing gusA, thus developing the construct 1371 (Supplementary Fig. S1-a-ii). The tobacco transgenic lines expressing 1371 showed no morphological anomaly, with normal growth and development comparable to wild plants except male sterility (Fig. 3a,b). The flowers of 1371 transgenics showed healthy stigma and other accessory whorls, whereas pollen grains laden to the anther were very low (Fig. 3c,d). The flowers failed to self-fertilize because of the formation of non-viable pollen, which eventually dries out and drops from the floral axis (Fig. 3d arrow shows point of detachment and drying); whereas when fertilized with the viable pollen of wild plants, a normal seed setting was observed (data not shown). The results suggest that stigma receptivity and female reproductive organs of 1371 transgenics were normal and the drop of flowers was due to the development of aborted pollen and failure in fertilization.

The relative expression of Arabidopsis BECLIN1 was compared using qRT-PCR at a different anther developmental stage of the 1371 transgenic lines; the highest expression was found in stages 2 and 3 (Fig. 3e). To understand the effect of postmeiotic, tapetum-specific and high-level expression of BECLIN1 on the pollen development, transmission electron microscopy (TEM) of developing pollens was performed. No obvious differences were found till stage 1, between 1371 transgenics and control (NTPH) as meiosis was normal and microspore tetrad was surrounded by the callose in both control (Fig. 3f, Supplementary Fig. S6-b) and in transgenic (Fig. 3l, Supplementary Fig. S6-i) plants. At stage 2, microspores became free due to callose decomposition, the nucleus was displaced aside due to a single large vacuole and development of the orderly microspore exine structure was seen in the control (Fig. 3g, Supplementary Fig. S6-c); whereas in 1371 transgenics the tetrad was not fully separated due to remnants of the callose deposition and deformation had started in microspores (Fig. 3m, Supplementary Fig. S6-j). The vacuole gets enlarged with demarked wall formation in stage 3 microspores in case of control (Fig. 3h, Supplementary Fig. S6-d), whereas deformation increases in 1371 transgenics (Fig. 3n, Supplementary Fig. S6-k). At stage 4, the generative cell was attached to the wall with a prominent vegetative nucleus, cytoplasm and normal exine and intine development in the control (Fig. 3i, Supplementary Fig.S6-e); whereas in 1371 transgenics, the cytoplasm was collapsed and pollen wall deformations were visible (Fig. 3o, Supplementary Fig. S6-e). The microspore shape became nearly circular and was filled with dense cytoplasm and small vesicles; the pollen wall also differentiated into well-developed exine and intine at stages 5,6 in control pollens (Fig. 3j,k, Supplementary Fig. S6f-g); whereas in case of pollens of 1371 transgenics, the cytoplasm collapsed and severe deformity was observed in the pollen wall (Fig. 3p,q, Supplementary Fig. S6m-n).

We next examined the pollen viability, in-vitro pollen germination and seed setting in wild and 1371 transgenics. The 1371 transgenic lines showed considerably low pollen viability (Fig. 4a,b,u) with nil germination (Fig. 4m,n,u) as compared to the control (wild type). In control plants, bagging of a young inflorescence before anthesis results in normal seed setting (Fig. 4q,v), unlike in male sterile plants in which all the bulbs were seedless (Fig. 4r,v). Further, the scanning electron micrograph (SEM) of stage 7 pollen of control showed normal pollen morphology (Fig. 4e,f and Supplementary Fig. S7a-b); whereas deformed pollens were seen in the 1371 transgenic lines (Fig. 4g,h and Supplementary Fig. S7c-d). The results obtained by the new system are in agreement with our previous finding¹⁵ that overexpression of BECLIN1 in the anther tapetum resulted in complete male sterility in the tobacco transgenic plants. In addition, the male sterile female lines are equipped with additional regulatory control over the TGTA-TBPm3 system operated through the male component.

Complete restoration of male fertility in F1 hybrid

Restoration of pollen fertility in F1 progeny is a prerequisite for hybrid seed production. The male sterile 1371 transgenic female lines were crossed with the selected male lines expressing either COP1 (1372) or COP1^L105A (1373) to raise F₁ and F’₁ progeny, respectively (Supplementary Fig. S5). In F1 [1371(♀) × 1372(♂)] plants, pollen viability was recorded ~15.14% (Fig. 4c,u) as compared with ~77.71% of control; whereas in-vitro pollen germination was ~18.5% (Fig. 4o,u) in F1 as compared with ~70% in case of control plants. The pollen viability of F1 was low, but the seed setting was found to be comparable to the control plants (Fig. 4s,v). The SEM of stage 7 pollens showed a high population of aborted and deformed pollens with a few normal architecture pollens in F1 plants (Fig. 4i,j, Supplementary Fig. S7 e-f).The relative expression of BECLIN1 and COP1 was quantified in s1-s6 anther developmental stages of F1 plants. We found higher accumulation of AtBECLIN1 transcript in s1, s2 and s3 stages. The COP1 expressed at considerably high level in the s1 stage. We next compared the expression of BECLIN1 in s2 stage in F1 with that of 1371 transgenic male sterile lines and found about ~21-fold decrease in the expression (Fig. 5a,c,d). The results, thus, indicate that COP1 (1372) mediates partial restoration of fertility in F1 plants by reducing the expression of BECLIN1. In F’1 [1371(♀) × 1373(♂)] progeny, the pollen viability and pollen germination was found to be comparable to that of control plants (Fig. 4d,p,u). The SEM of stage 7 pollen showed pollen architecture similar to control pollen (Fig. 4k,l and Supplementary Fig. S7g-h). The seed setting was normal with seed weight ~78.89 mg/pod, comparable to control ~74.23 mg/pod (Fig. 4t,v). The expression of BECLIN1 was completely abolished, while the expression of COP1 was found to be the highest in the s1 anther stage in F’1 (Fig. 5b–d). The results established complete restoration of male fertility in F’1 plants by utilizing the principle of COP1-mediated degradation of HFR1^NT131-TBPm3 and by abolishing the expression of BECLIN1.

BECLIN1 expression resulted in abnormal tapetal growth and delayed degeneration

To determine the cause of pollen abortion in BECLIN1 expressing transgenics (1371), we examined cross-sections of anther from control (NTPH) and 1371 transgenic lines at different anther developmental stages⁴⁶. At stage −1, the tapetum was well developed enclosing microspore mother cells (MMC) which were in the stage of meiotic division in the control (Fig. 6a). At stage 1, the meiotic division occurs, forming dyad and tetrad with distinct tapetum in the control (Fig. 6b). However, no obvious differences were observed in the 1371 transgenic anther in stages −1 and 1, when compared with the control (Fig. 6h,i). The morphological defects started surfacing at stage 2; at this stage, well-developed tapetal layer enclosing nascent-free microspores were observed in control anther (Fig. 6c), whereas in 1371 anther, tapetal cells showed abnormal growth and the entire pollen sac was filled with debris and unstructured cell matter (Fig. 6j). At stage 3, control tapetal cells shrank and microspores were clearly visible (Fig. 6d); whereas in 1371, the abnormal tapetal structure, debris and unstructured cell matter filled the pollen sac and microspores were not clearly visible (Fig. 6k). At stage 4, the control tapetum was degenerating and only epidermis and endothecial layers were visible as surrounding filled mature pollens (Fig. 6e). Interestingly in 1371 anther, tapetal layer remained intact with empty pollens in the pollen sac (Fig. 6l). At stages 5,6, the control tapetum was completely degenerated and pollens were mature with a darkly stained dense cytoplasm (Fig. 6f,g); whereas in 1371 transgenics, the tapetum was still visible as enclosing empty aborted pollens (Fig. 6m,n). To ensure that the abnormal tapetal growth and delayed degeneration in the male sterile parent was because of the expression of BECLIN1, the anther cross-sections of the F’1 were observed, as we had already observed complete abolition of BECLIN1 expression in F’1. The cross-section of F’1 showed normal development of tapetum and pollen similar to the control (Fig. 6o–u), confirming that the tapetal abnormality and pollen abortion in 1371 were due to the expression of BECLIN1.

Discussion

In this study, we have developed a male sterility–fertility restoration system for heterosis breeding in plants. In the female parent, tapetum-specific, high-level and postmeiotic expression of the Arabidopsis BECLIN1/ATG6 gene led to complete male sterility. The tapetum–specific expression was completely abolished and male fertility was restored in the F1 hybrid.

The male sterility system (construct 1371; Supplementary Fig. S1a-I) is the modification of our previously reported two component system¹⁵ based on the principle of expression restoration of a TGTA-mutated promoter by providing a complementing TBPm3, which binds specifically to the TGTA³⁶. The system gave several-fold enhancement of expression over the native tapetum-specific promoter (Fig. 1a), in agreement with our previous report¹⁵. In this study, we included the light-regulated transcription factor HFR1 that exhibits its COP1-mediated degradation^37,49,50 to limit TBPm3 and abolish expression of the desired gene. HFR1 is a transcription factor (bHLH) consisting of 292 amino acids, of which the N-terminus 131 amino acid interacts with COP1 and the C-terminus 161 amino acid has a functional role to bind DNA and promote photomorphogenesis^39,49. We fused the HFR1^NT131 fragment to the N-terminus of TBPm3, thus making the fusion protein HFR1^NT131-TBPm3. This fusion did not affect the functionality of TBPm3, resulting in a high-level expression of the desired gene (gusA or BECLIN1) (Fig. 1a). The transgenic plants expressing gusA were normal in growth and development and the strength and stringency of the expression system were not compromised (Fig. 2b,c–f and Supplementary Fig. S1-b and c). To ensure the transcriptional abolition of tapetum-specific expression in F1 progeny, it was crossed with the male parent expressing COP1 under the regulation of the Arabidopsis ^PA₉ promoter⁴⁷ (Fig. 1b). The expression of COP1 ensures its availability to bind with HFR1^NT131 and to degrade it in the F1 tapetal cell. The degradation of TBPm3 was also achieved, as it was conjugated HFR1^NT131-TBPm3 (Fig. 1c). However, COP1 facilitates only partial abolition of the TGTA-TBPm3 complementation system in F1 (Fig. 2b,c–f). The COP1 protein is known to shuttle between the cytoplasm and nucleus³⁹ and stoichiometrically insufficient nuclear concentration of COP1 might be a reason for partial expression reversion. Therefore, we made use of an alternative COP1-mutant (COP1^L105A)³⁸. The mutation retained dimerization and functional activity of the COP1 but increased its nuclear abundance. The expression of the reporter gene (gusA) was completely abolished in F’1 progeny when COP1^L105A lines were used as a male parent, instead of native COP1 (Fig. 2b,c–f). Thus, a tapetum-specific reversible expression system was established.

The male sterility and fertility restoration system developed by us are generic in nature and hence can be used with other reported genes for male sterility. Thus, the female expression cassette (1371) can be used to generate the male-sterile parent by expressing any known gene reported for the male sterility such as BARNASE¹⁸ , BAX²⁸ and so on. The major advantage with our system that there is no specific requirement of the fertility restoration gene for example BARSTAR in BARNASE^18,19. The male expression cassette (Construct 1373) offers restoration through abolishing transcription of the male sterility gene. We used the Arabidopsis BECLIN1/ATG6¹⁵ gene to raise complete male sterile transgenic plants. Genetic engineering of male-sterility and the fertility-restoration system have emerged as tangible options for hybrid seed production. Several restoration systems have been reported to redeem male fertility by inactivating the male sterility protein^18,19, degrading transcripts of the male sterility gene^14,17,51 and site-specific recombination in the male sterility gene^8,10. However, efficient restoration of fertility has been discussed as one of the limiting factors in some of the systems^14,21,51. The present system offers a system equipped with complete male sterility and fertility restoration in F1-progeny (Figs 4,1a–c; proposed model) with a novel approach.

The restoration of fertility of F1 hybrid is prerequisite, especially when the economic product is seed. The barnase/barstar system^18,19 was deployed for the commercial hybrid production but the identification of efficient restorer (barstar) line was proven to be difficult in Brassica juncea; one in 54 cross-recombination between barnase (male sterile) × barstar (restorer) was adequately restored male fertility in the F1 hybrid^21,23. Tapetum-specific promoter TA29 driven barstar (restorer) restore 65.6% male fertility (in terms of pollen viability), it was further improved to 78–90% when ^PA9 and chimeric system were used to express barstar (restorer)^9,21. Barnase weakly expressed in vegetative tissue resulted yield penalty in the plants²³. The other barnase based systems; the Cre/loxp-mediated site-specific recombination system¹⁰, two-component system²² and split-gene system^4,11 claimed 100% restoration of F1 fertility, however, use of toxic gene of trans-origin limited the acceptability due to biosefty concern in some countries. Pathogenesis-related (PR) β-1,3-glucanase gene based male sterility was only partially restored by pA9-driven sense and antisense PR glucanase fragments⁵¹. The temperature-sensitive DIPTHERIA TOXIN-A (DTA^ts) confer conditional-male-sterility (18 ^°C male sterility, 26 ^°C restored fertility)³² and reversible male sterility in egg plant¹⁶ claimed complete restoration but works on ethanol inducible method which limit its practical applicability. In our system, female expression cassette (1371) expressing plants generate complete male sterility; when compared with control (pollen viability (%): 77.7 ± 1.3 (100%), pollen germination (%): 70 ± 3.6 (100%) and seed-setting (mg/pod): 74.23 ± 5 (100%)), 10 randomly selected BECLIN1 expressing transgenic lines showed pollen viability (%): 0.76 ± 0.78 (~0.96%), pollen germination (%): 0.76 ± 0.73 (~2.3%) and nil seed setting (Fig. 4u,v). The fertility restoration of F1 progeny works on transcription abolition of male sterility gene (BECLIN1) regulated through male parent. When COP1 expressing lines (1372) were used as male parent, F1 showed ~21-fold reduction in BECLIN1 expression (Fig. 5c), which restored pollen viability (%): 15.14 ± 1.8 (20%), pollen germination (%): 18.5 ± 3.3 (26%) that is sufficient for optimal seed setting (mg/pod) 60.2 ± 15 (81%) (Fig. 4u,v). We observed further improvement in fertility restoration when COP1-mutant (COP1^L105A) lines (1373) were taken as male parent, which completely abolished the expression of BECLIN1 resulting complete restoration of pollen fertility in F’1 with pollen viability (%): 74.58 ± 1.2 (96%), pollen germination (%): 69 ± 4.6 (~97.14% ) and seed setting (mg/pod) 71.9 ± 6.1 (97%) (Fig. 4u,v) comparable to the untransformed control plants.

Maintaining the male-sterile female lines is a prerequisite for future commercial application of this technique and the genetic design of the male-sterile female line (construct 1371, Fig. S1a-ii) provides this opportunity. Crossing the heterozygous male-sterile female parent (BECLIN1/−) with its wild type (−/−) results in ~50% of the male-sterile progeny (1:1 ratio, (BECLIN1/−) and (−/−)). In future approaches, linking the herbicide resistance gene in the construct 1371 (as in SeedLink^TM) will enable the selection of male-sterile female parents. However, this requires overplanting and eliminating half of the sown plants by applying herbicide to obtain pure male-sterile female parents.

In conclusion, we have developed a system for tapetum-specific, high-level expression of the desired gene to achieve complete male-sterility, along with a system for transcriptional control over the expression system for fertility-restoration in the F1-hybrid. The tapetum-specific expression of the BECLIN1/ATG6 gene facilitated complete male sterility and COP1-mediated HFR1 degradation system was used for repression of transcription of BECLIN1 followed by fertility restoration in the F1 hybrid. The proposed male sterility-fertility restoration system described here will be a valuable future contribution for exploiting hybrid vigor and commercial production of hybrid seed.

Methods

DNA Constructs, Transformation and transgenic development

The four expression cassettes were constructed in the plant expression vector pBI₁₀₁ and modified pCAMBIA1300 (Schematically presented in Supplementary Fig. S1A). All the vector constructs that were transformed in Agrobacterium and transgenic tobacco plants were developed as previously described¹⁵.

Site-directed mutagenesis

TGTATATG mutation was introduced into the TATATATG box region of the TA29 promoter using Quik Change XL Kit (Stratagene, http://www.stratagene.com) as previously described¹⁵. In COP1, the L105A mutation³⁸ was introduced using site directed mutagenesis PCR was performed according to the manufacturer’s instructions. 5′TTCGCGGCCGATAAGGCAGCGAAG 3′ mutation was introduced into the 5′ TTCTTGCTCGATAAGCTATTGAAG 3′ region of the COP1 gene by using two sets of primers COPM_f1 5′gct tta ccc taa ttt cgc ggc ccg ata agc tat tga aga aaa ctt c 3′, COPM_r1 5′gtt ttc ttc aat agc tta tcg gcc gcg aaa tta ggg taa agc tg 3′ and COPM_f2 5′ taa ttt ctt gct cga taa ggc agc gaa gaa aac ttc agc tcg gc 3′, COPM_r2 5′ cga gct gaa gtt ttc ttc gct gcc tta tcg agc aag aaa tta gg 3′ primers, Clones were screened by DNA sequencing for the desired mutation using T3 and T7 primers.

Fluorimetric and histochemical GUS assay

Fluorimetric GUS assay was performed as previously described by³⁶. All results are an average of 10 independent lines with three independent experiments of T1 lines. Histochemical GUS analysis was performed as described by¹⁵.

Pollen viability and germination assay

Pollen from the blooming stage of flowers was collected and incubated in Fluorescein Diacetate (FDA)—Propidium Iodide (PI) solution for [2 mg/ml (FDA) in acetone and diluted by 10% sucrose drop by drop until turning milky with 1 mg/ml PI (PBS) added to a final concentration] for 5 min. The pollens were centrifuged at 5000 rpm for 1 min, the supernatant was discarded, 3 washings were done in phosphate-buffered saline (PBS) and finally suspended in 50ul PBS. It was mounted on slowfade@antifade (Molecular probes) and observed under a confocal microscope (LSM510META, CarlZeiss) with FDA (green) and PI (red) filters. The percentage of pollen viability that was counted was an average of ten transgenic (n = 10) with three independent experiments. An in-vitro pollen germination test was performed using artificial liquid medium (10% Sucrose, 0.1 mg/ml Boric acid, 0.3 mg/ml calcium nitrate, 0.2 mg/ml magnesium sulfate and 0.1 mg/ml potassium nitrate). Pollen germination images were taken on Leica microscope. Pollen germination (%) was an average of 10 lines (n = 10) with three replicates of the experiment.

Transmission electron microscopy (TEM) and Scanning electron microscopy (SEM)

Anther samples of developmental stages from −5 to +6 stage as described by⁴⁶ were washed with 1xPBS (pH 7.2) before fixing in 2.5% glutaraldehyde prepared in .1 M sodium cacodylate (Ladd Research) buffer (pH 7.2) for 2 h at 4 ^°C. Samples were washed thrice, with 0.1 M sodium cacodylate buffer and post-fixed in 1% osmium tetraoxide for 2 h. Further, samples were washed with sodium cacodylate, dehydrated in acetone series (15–100%) and embedded in araldite-DDSA mixture (Ladd Research Industries, USA). After baking at 60 ^°C, blocks were cut (60–80 nm thick) by an ultra-microtome (Leica EM UC7) and sections were stained by uranyl acetate and lead citrate. Analysis of sections was done under FEI Tecnai G2spirit twin transmission electron microscope equipped with Gatan digital CCD camera (Netherland) at 60 or 80 kV.

For SEM analysis stage 7 anthers of control (NTPH), 1371 transgenic and F1 and F’1 were washed twice in 0.1 M Sodium cacodylate buffer and fixed in 2.5% glutaraldehyde and 4% paraformaldehyde overnight 4 ^°C. Samples were washed thrice in 0.1 M Sodium cacodylate, 20 min each and transferred to Osmium tetraoxide overnight; further, two washings in 0.1 M sodium cacodylate buffer were done, dehydration was conducted in acetone series, 15%, 30%, 60% and 90% and 3 changes were made in 100% for 20 min each. Further samples were dehydrated till they reach critical point (CPD), anthers were ruptured and pollens were taken on the stub adhesive, coated with gold particles (2 coating) and observed under the scanning electron microscope (FEG450 Quanta, Netherland).

RNA extraction and quantitative real-time RT-PCR

Total RNA was isolated using Plant Spectrum Total RNA isolation kit according to manual instructions (Sigma –Aldrich, http://www.sigmaaldrich.com). After DNaseI treatment (Ambion Inc, Austin TX USA), RNA integrity was checked by electrophoresis and quantified by using using a NanoDrop^® ND-1000 UV-Vis spectrophotometer. 2 μg RNA was reverse transcribed using oligo(dT) primers and Superscript II RT (Invitrogen, Rockville, MD, USA) into first-strand c-DNA in a 20-μL reaction as per manual instructions. Quantitative real-time PCR was performed by Express SYBR^®Green ER™ qPCR SuperMix Universal (Invitrogen) using the ABI 7500 Fast Real-Time PCR Detection System (Applied Biosystems). The gene-specific primers listed in Table S1 were utilized. UBQ10 was taken as an internal control. Relative expression was calculated from threshold cycle values⁵²). Three independent qRT-PCR reactions were performed on different cDNA samples.

Microtome and light microscopy

Tobacco anthers of developmental stage from −1 to +6⁴⁶ were immediately fixed in Poly/LEM fixative (Polysciences, Inc. Cat# 16864) overnight at 4 ^°C. Fixed anthers were dehydrated in ethanol series 50%, 70%, 85%, 95% and 100% for 1h each. Infiltration was done in 2:1, 1:1 and 1:0 of (ethanol: infiltration solution) for 1h each and embedded in resin (JB-4 Embedding Kit, Polysciences Inc. Eppelheim, Germany). A 4-μM-thick section were cut by using Leica microtome, stained with 0.1% toluidine blue O’ (Sigma Aldrich) and pictures were captured using a Nikon microscope. Pictures were adjusted using adobe paint (NET) software.

Crossing strategies and F1 screening

The best expressing lines of transgenic 1370 were taken as the female parent and were crossed by the two best performing lines of 1372 and 1373 which were taken as male parents; F1 and F’1 were generated. Similarly 1371 transgenics were taken as the female parent and were crossed with the best performing 1372 and 1373 pollens; F₁ and F’₁ were generated. The F₁/F’₁ seeds were germinated on medium containing kanamycin (300 mg/litre) and hygromycin (50 mg/litre) on a petri-dish for 3 weeks. Plantlets of selected crosses were transferred into pots in a transgenic house.

Additional Information

How to cite this article: Singh, S. P. et al. A novel male sterility-fertility restoration system in plants for hybrid seed production. Sci. Rep. 5, 11274; doi: 10.1038/srep11274 (2015).

References

Schnable, P. S. & Springer, N. M. Progress toward understanding heterosis in crop plants. Annu Rev Plant Biol 64, 71–88 (2013).
CAS PubMed Google Scholar
Tester, M. & Langridge, P. Breeding technologies to increase crop production in a changing world. Science 327, 818–822 (2010).
ADS CAS PubMed Google Scholar
Shaoqing Li DYaYZ . Characterization and Use of male sterility in hybrid rice breeding. Journal of Integrative Plant Biology 49, 791–804 (2007).
Google Scholar
Kempe, K., Rubtsova, M. & Gils, M. Split-gene system for hybrid wheat seed production. Proc Natl Acad Sci U.S.A. 111, 9097–9102 (2014).
ADS CAS PubMed PubMed Central Google Scholar
Parodi, P. C. & Gaju, M. D., Male sterility induced by the chemical hybridizing agent clofencet on wheat, Triticum aestivum and T. turgidum var. durum. Ciencia e investigación agraria 36, 267–276 (2009).
Google Scholar
Chen, L. & Liu, Y. G. Male sterility and fertility restoration in crops. Annu Rev Plant Biol 65, 579–606 (2014).
CAS PubMed Google Scholar
Katja Kempe, M. G. Pollination control technologies for hybrid breeding. Molecular Breeding 27, 417–437 (2011).
Google Scholar
Bayer, M. H. D. Restoring full pollen fertility in transgenic male-sterile tobacco (Nicotiana tabacum L.) by Cre-mediated site-specific recombination. Mol Breed 15, 193–203 (2005).
CAS Google Scholar
Bisht, N. C., Jagannath, A., Burma, P. K., Pradhan, A. K. & Pental, D. Retransformation of a male sterile barnase line with the barstar gene as an efficient alternative method to identify male sterile-restorer combinations for heterosis breeding. Plant Cell Rep 26, 727–733 (2007).
CAS PubMed Google Scholar
Cao, B., Huang, Z., Chen, G. & Lei, J. Restoring pollen fertility in transgenic male-sterile eggplant by Cre/loxp-mediated site-specific recombination system. Genet Mol Biol 33, 298–307 (2010).
CAS PubMed PubMed Central Google Scholar
Gils, M. et al. A novel hybrid seed system for plants. Plant Biotechnol J 6, 226–235 (2008).
CAS PubMed Google Scholar
Li, S. F., Iacuone, S. & Parish, R. W. Suppression and restoration of male fertility using a transcription factor. Plant Biotechnol J 5, 297–312 (2007).
CAS PubMed Google Scholar
Nizampatnam, N. R. & Dinesh Kumar, V. Intron hairpin and transitive RNAi mediated silencing of orfH522 transcripts restores male fertility in transgenic male sterile tobacco plants expressing orfH522. Plant Mol Biol 76, 557–573 (2010).
Google Scholar
Schmulling, T., Rohrig, H., Pilz, S., Walden, R. & Schell, J. Restoration of fertility by antisense RNA in genetically engineered male sterile tobacco plants. Mol Gen Genet 237, 385–394 (1993).
CAS PubMed Google Scholar
Singh, S. P. et al. BECLIN1 from Arabidopsis thaliana under the generic control of regulated expression systems, a strategy for developing male sterile plants. Plant Biotechnol J 8, 1005–1022 (2010).
CAS PubMed Google Scholar
Toppino, L. et al. Reversible male sterility in eggplant (Solanum melongena L.) by artificial microRNA-mediated silencing of general transcription factor genes. Plant Biotechnol J 9, 684–692 (2010).
PubMed Google Scholar
Zabaleta, E., Mouras, A., Hernould, M. & Suharsono, Araya A. Transgenic male-sterile plant induced by an unedited atp9 gene is restored to fertility by inhibiting its expression with antisense RNA. Proc Natl Acad Sci U.S.A. 93, 11259–11263 (1996).
ADS CAS PubMed PubMed Central Google Scholar
Mariani, C., Beuckeleer, M. D., Truettner, J., Leemans, J. & Goldberg, R. B. Induction of male sterility in plants by a chimaeric ribonuclease gene. Nature 347, 737–741 (1990).
ADS CAS Google Scholar
Mariani, C. G. V. et al. A chimaeric ribonuclease-inhibitor gene restores fertility to male sterile plants. Nature 357, 384–387 (1992).
ADS CAS Google Scholar
Banga, S. K. B. P & Banga, S. S. Genetically engineered systems of male sterility. J Oilseeds Res 23, 1–7 (2006).
ADS Google Scholar
Bisht, N. C. J. A, Gupta, V, Burma, P. K & Pental, D. A two gene—two promoter system for enhanced expression of a restorer gene (barstar) and development of improved fertility restorer lines for hybrid seed production in crop plants. Mol Breed 14, 129–144 (2004).
CAS Google Scholar
Burgess, D. G. et al. A novel, two-component system for cell lethality and its use in engineering nuclear male-sterility in plants. Plant J 31, 113–125 (2002).
CAS PubMed Google Scholar
Jagannath, A. A. N., Gupta, V., Pradhan, A. K., Burma, P. K. & Pental, D. Development of transgenic barstar lines and identifi- cation of a male sterile (barnase)/restorer (barstar) combination for heterosis breeding in Indian oilseed mustard (Brassica juncea). Curr Sci 82, 46–52 (2002).
CAS Google Scholar
Goldberg, R. B., Beals, T. P. & Sanders, P. M. Anther development: basic principles and practical applications. Plant Cell 5, 1217–1229 (1993).
CAS PubMed PubMed Central Google Scholar
Zhu, J. et al. Defective in Tapetal development and function 1 is essential for anther development and tapetal function for microspore maturation in Arabidopsis. Plant J 55, 266–277 (2008).
CAS PubMed Google Scholar
Papini, A. & Brighigna, S. M. L. Programmed-cell-death events during tapetum development of angiosperms. Protoplasma 207, 213–221 (1999).
Google Scholar
Wu, H. M. & Cheun, A. Y. Programmed cell death in plant reproduction. Plant Mol Biol 44, 267–281 (2000).
PubMed Google Scholar
Kawanabe, T., Ariizumi, T., Kawai-Yamada, M., Uchimiya, H. & Toriyama, K. Abolition of the tapetum suicide program ruins microsporogenesis. Plant Cell Physiol 47, 784–787 (2006).
CAS PubMed Google Scholar
Li, N. et al. The rice tapetum degeneration retardation gene is required for tapetum degradation and anther development. Plant Cell 18, 2999–3014 (2006).
CAS PubMed PubMed Central Google Scholar
Luo, D. et al. A detrimental mitochondrial-nuclear interaction causes cytoplasmic male sterility in rice. Nat Genet 45, 573–577.
Varnier, A. L., Mazeyrat-Gourbeyre, F., Sangwan, R. S. & Clement, C. Programmed cell death progressively models the development of anther sporophytic tissues from the tapetum and is triggered in pollen grains during maturation. J Struct Biol 152, 118–128 (2005).
CAS PubMed Google Scholar
Guerineau, F., Sorensen, A. M., Fenby, N. & Scott, R. J. Temperature sensitive diphtheria toxin confers conditional male-sterility in Arabidopsis thaliana. Plant Biotechnol J 1, 33–42 (2003).
CAS PubMed Google Scholar
Cho, H. J., Kim, S., Kim, M. & Kim, B. D. Production of transgenic male sterile tobacco plants with the cDNA encoding a ribosome inactivating protein in Dianthus sinensis L. Mol Cells 11, 326–333 (2001).
CAS PubMed Google Scholar
Takada, K., Ishimaru, K., Minamisawa, K., Kamada, H. & Ezura, H. Expression of a mutated melon ethylene receptor gene Cm-ETR1/H69A affects stamen development in Nicotiana tabacum. Plant Sci 169, 935–942. (2005).
CAS Google Scholar
Konagaya, K., Ando, S., Kamachi, S., Tsuda, M. & Tabei, Y. Efficient production of genetically engineered, male-sterile Arabidopsis thaliana using anther-specific promoters and genes derived from Brassica oleracea and B. rapa. Plant Cell Rep 27, 1741–1754 (2008).
CAS PubMed Google Scholar
Chaturvedi, C. P. et al. Mutated TATA-box/TATA binding protein complementation system for regulated transgene expression in tobacco. Plant J 50, 917–925 (2007).
CAS PubMed Google Scholar
Duek, P. D., Elmer, M. V., van Oosten, V. R. & Fankhauser, C. The degradation of HFR1, a putative bHLH class transcription factor involved in light signaling, is regulated by phosphorylation and requires COP1. Curr Biol 14, 2296–2301 (2004).
CAS PubMed Google Scholar
Subramanian, C. et al. The Arabidopsis repressor of light signaling, COP1, is regulated by nuclear exclusion: mutational analysis by bioluminescence resonance energy transfer. Proc Natl Acad Sci U.S.A. 101, 6798–6802 (2004).
ADS CAS PubMed PubMed Central Google Scholar
Yang, J. et al. Light regulates COP1-mediated degradation of HFR1, a transcription factor essential for light signaling in Arabidopsis. Plant Cell 17, 804–821 (2005).
CAS PubMed PubMed Central Google Scholar
Chen, W. & Struhl, K. Saturation mutagenesis of a yeast his3 “TATA element”: genetic evidence for a specific TATA-binding protein. Proc Natl Acad Sci U.S.A. 85, 2691–2695 (1988).
ADS CAS PubMed PubMed Central Google Scholar
Harbury, P. A. & Struhl, K. Functional distinctions between yeast TATA elements. Mol Cell Biol 9, 5298–5304 (1989).
CAS PubMed PubMed Central Google Scholar
Wobbe, C. R. & Struhl, K. Yeast and human TATA-binding proteins have nearly identical DNA sequence requirements for transcription in vitro. Mol Cell Biol 10, 3859–3867 (1990).
CAS PubMed PubMed Central Google Scholar
Reddy, P. & Hahn, S. Dominant negative mutations in yeast TFIID define a bipartite DNA-binding region. Cell 65, 349–357 (1991).
CAS PubMed Google Scholar
Strubin, M. & Struhl, K. Yeast and human TFIID with altered DNA-binding specificity for TATA elements. Cell 68, 721–730 (1992).
CAS PubMed Google Scholar
Pan, S., Czarnecka-Verner, E. & Gurley, W. B. Role of the TATA binding protein-transcription factor IIB interaction in supporting basal and activated transcription in plant cells. Plant Cell 12, 125–136 (2000).
CAS PubMed PubMed Central Google Scholar
Koltunow, A. M., Truettner, J., Cox, K. H., Wallroth, M. & Goldberg, R. B. Different temporal and spatial gene expression patterns occur during anther development. Plant Cell 2, 1201–1224 (1990).
CAS PubMed PubMed Central Google Scholar
Paul, W., Hodge, R., Smartt, S., Draper, J. & Scott, R. The isolation and characterisation of the tapetum-specific Arabidopsis thaliana A9 gene. Plant Mol Biol 19, 611–622 (1992).
CAS PubMed Google Scholar
Sawant, S., Singh, P. K., Madanala, R. & Tuli, R. Designing of an artificial expression cassette for the high level expression of transgenes in plants. Theoretical and Applied Genetics 102, 635–644 (2001).
CAS Google Scholar
Jang, I. C., Yang, J. Y., Seo, H. S. & Chua, N. H. HFR1 is targeted by COP1 E3 ligase for post-translational proteolysis during phytochrome A signaling. Genes Dev 19, 593–602 (2005).
CAS PubMed PubMed Central Google Scholar
Kim, Y. M., Woo, J. C., Song, P. S. & Soh, M. S. HFR1, a phytochrome A-signalling component, acts in a separate pathway from HY5, downstream of COP1 in Arabidopsis thaliana. Plant J 30, 711–719 (2002).
CAS PubMed Google Scholar
Hird, D. L., Paul, W., Hollyoak, J. S. & Scott, R. J. The restoration of fertility in male sterile tobacco demonstrates that transgene silencing can be mediated by T-DNA that has no DNA homology to the silenced transgene. Transgenic Res 9, 91–102 (2000).
CAS PubMed Google Scholar
Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408 (2001).
CAS PubMed Google Scholar

Download references

Acknowledgements

The authors are grateful to the Department of Biotechnology (DBT), the Government of India, for funding the research project under Sr.IYBA. They are also thankful to the Council of Scientific and Industrial Research (CSIR) for fellowship funding support. They also acknowledge the support of Dr. Manu Agarwal, Delhi University, India for critical reading and the important suggestions in their article.

Author information

Authors and Affiliations

Plant Molecular Biology Laboratory, CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow, 226001, India
Surendra Pratap Singh, Tripti Pandey & Samir V. Sawant
Academy of Scientific and Innovative Research (AcSIR), Anusandhan Bhawan, 2 Rafi Marg, New Delhi, 110 001, India
Samir V. Sawant
Department of Biotechnology (DBT), National Agri-Food Biotechnology Institute, C-127, Industrial Area, Phase VIII, Mohali, 160071, India
Sudhir P. Singh
Department of Botany, University of Lucknow, Lucknow, 226007, India
Ram Rakshpal Singh

Authors

Surendra Pratap Singh
View author publications
You can also search for this author in PubMed Google Scholar
Sudhir P. Singh
View author publications
You can also search for this author in PubMed Google Scholar
Tripti Pandey
View author publications
You can also search for this author in PubMed Google Scholar
Ram Rakshpal Singh
View author publications
You can also search for this author in PubMed Google Scholar
Samir V. Sawant
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

S.V.S., S.P.S.1 and S.P.S.2 designed the study. S.P.S.1 and S.V.S. analyzed the data. All the experiments are performed by S.P.S.1. S.P.S.2 and TP helped in designing and cloning few constructs. S.V.S., S.P.S.1, S.P.S.2 and R.R.S. contributed towards the preparation of this article.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Electronic supplementary material

Supplementary Information

Rights and permissions

This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Reprints and permissions

About this article

Cite this article

Singh, S., Singh, S., Pandey, T. et al. A novel male sterility-fertility restoration system in plants for hybrid seed production. Sci Rep 5, 11274 (2015). https://doi.org/10.1038/srep11274

Download citation

Received: 12 February 2015
Accepted: 20 May 2015
Published: 15 June 2015
DOI: https://doi.org/10.1038/srep11274

This article is cited by

Comparative transcriptome analysis in Chinese cabbage (Brassica rapa ssp. pekinesis) for DEGs of Ogura-, Polima-CMS and their shared maintainer
- Xiaochun Wei
- Yanyan Lv
- Xiaowei Zhang
Physiology and Molecular Biology of Plants (2020)
Evolvement of transgenic male-sterility and fertility-restoration system in rice for production of hybrid varieties
- Gundra Sivakrishna Rao
- Priyanka Deveshwar
- Khareedu Venkateswara Rao
Plant Molecular Biology (2018)
Molecular Approaches for Manipulating Male Sterility and Strategies for Fertility Restoration in Plants
- Pawan Shukla
- Naveen Kumar Singh
- Pulugurtha Bharadwaja Kirti
Molecular Biotechnology (2017)
Cytoplasmic male sterility (CMS) in hybrid breeding in field crops
- Abhishek Bohra
- Uday C. Jha
- Narendra P. Singh
Plant Cell Reports (2016)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.