Abstract
The potential applications of low temperature plasma (LTP) in wound healing have aroused the concern of many researchers. In this study, an argon atmospheric pressure plasma jet was applied to generate LTP for treatment of murine fibroblast cell (L929) cultured in vitro to investigate the effect of NF-κB pathway on fibroblast proliferation. The results showed that, compared with the control, L929 cells treated with plasma for less than 20 s had significant increases of proliferation; the productions of intracellular ROS, O2 − and NO increased with prolongation of LTP treatment time; NF-κB pathway was activated by LTP in a proper dose range, and the expression of cyclinD1 in LTP-treated cells increased with the same trend as cell proliferation. After RNA interference to block p65 expression, with the same treatment time, RNAi-treated cells proliferated more slowly and expressed less cyclinD1 than normal cells. Furthermore, pretreatment with N-acetyl-L-cysteine (NAC) markedly prevented the plasma-induced changes in cells. In conclusion, the proliferation of L929 cells induced by LTP was closely related to NF-κB signaling pathway, which might be activated by appropriate level of intracellular ROS. These novel findings can provide some theoretical reference of LTP inducing cell proliferation and promoting wound healing.
Similar content being viewed by others
Introduction
Low temperature plasma (LTP) has been used for sterilization in biomedical fields for several years1,2,3. The novel applications of LTP in wound healing, dental care, dermatological therapy, cancer treatment and so on have aroused great interests among researchers of both plasma physics and biomedicine4,5,6,7. A particular concern is that an appropriate dose of LTP can be effective in treating various skin wounds, including chronic, acute wounds and burn4,8,9, etc. Some research indicate that LTP can significantly reduce bacteria around wounds and potentially stimulate the proliferation of epithelial cells and immune cells10,11. Our preliminary studies have showed LTP could induce fibroblast proliferation around the wound in mice12. However, the mechanisms of how LTP to induce fibroblast proliferation are still unclear.
Nuclear transcription factor κB (NF-κB) is known to regulate gene expression in host defense, immune response, inflammation, cell proliferation, and cell survival. NF-κB is activated by a series of stimuli including cytokines, growth factors, bacterial products, receptor ligands, viruses, reactive oxygen species (ROS), and ultraviolet (UV)13,14. Notably, NF-κB up-regulates the transcription level of cyclinD1, which is a vitally important protein promoting cell cycle transition from G1 to S phase15. LTP is composed of complex chemical compositions, such as exited atoms, electrons, ions, free radical, UV, and so on16. These active particles can react with cell culture medium and tissues to form reactive oxygen and nitrogen species (RONS). Researchers suggest that RONS play pivotal roles in cell or tissue response to LTP treatment7. Therefore, we presume that LTP can induce L929 cell proliferation by activating NF-κB signaling pathway.
In this study, we firstly detected the components of LTP in gas and liquid phase and confirmed that LTP could induce L929 cell proliferation with cell viability assay and cell cycle distribution analysis. Secondly, with fluorescence probes, we observed that after LTP treatment, the intracellular ROS, O2 − and NO productions increased when the treatment time was prolonged. Thirdly, we detected the expressions of phosphorylated NF-κB p65 (phospho-p65), IκB and translocation of phospho-p65 from cytoplasm into nucleus with Western blotting and immunofluorescence (IF), respectively. It was found that NF-κB pathway was activated by LTP within a proper dose range. Through analyzing the expression of cyclinD1 extracted from LTP-treated cells, we discovered that the changes of cyclinD1 expression had the same trend with cell proliferation. However, pretreatment with N-acetyl-L-cysteine (NAC) markedly prevented the plasma-induced changes described above in cells. Finally, when the NF-κB pathway was blocked with RNA interference, RNAi-treated cells proliferated more slowly and expressed less cyclinD1 than normal cells with the same treatment time. These findings will provide some beneficial support of LTP inducing cell proliferation and promoting wound healing.
Results
APPJ device and its optical emission spectra
The plasma source in argon was generated by a co-axial double ring electrodes configuration as described elsewhere12. The schematic diagram of the APPJ device is shown in Fig. 1. A hollow quartz tube was used as the barrier dielectric and had inner and outer diameters of 0.2 and 0.4 cm, respectively. The powered electrode and the grounded electrode were 1 cm-wide copper strips wrapped around the tube, and the distance between them was fixed at 1.65 cm. The distance between the grounded electrode and the quartz tube nozzle was 1 cm. The flow rate of working gas was set as 0.5 L/min. An intermediate frequency (~39.5 kHz) sinusoidal resonant power supply (CTP-2000K, Suman Electronics Co. Ltd., Nanjing, China) with a peak voltage of 7 kV was applied to the two electrodes to ignite the plasma discharges. The applied voltage was recorded by a 4-channel digital oscilloscope (Tektronix TDS 4034, Beaverton, OR) through a high voltage probe (Tektronix P6015A). Measured by an alcohol thermometer, the temperature of the plasma jet at the tip of the effluent varied from 25 to 36 °C, similar to room temperature. The emission spectra of the plasma jet were collected by a spectrometer (Mechelle 5000, Andor Technology Ltd., Belfast, UK) together with an intensified charge coupled device (ICCD) (iStar334, Andor Technology Ltd.).
The APPJ emission spectra in the wavelength range of 300–900 nm were captured and the identified lines are shown in Fig. 2. It can be seen that the mainly lines emitted by excited atoms of the feed gas argon were between 680 and 900 nm, indicating that the discharge was dominated by electron impact ionization. Peaks corresponding to N2 were measured between 330 and 400 nm and were presumably present due to mixing of the feed gas argon with the surrounding ambient air along the plasma jet. Atomic oxygen line at 673 nm and OH radical at 309 nm were detected, presumably as a result of O2 and H2O dissociation. Atomic oxygen and OH radical are highly reactive radicals that could play important roles in the potential biomedical applications of plasmas such as bacteria inactivation and wound healing. Furthermore, reactive oxygen and nitrogen species (ROS and RNS) can influence the intracellular environment, possibly by diffusing into cells or by inducing new species within the cells12.
H2O2, nitrite/nitrate produced in phosphate buffered saline (PBS) and dulbecco’s modified eagle medium (DMEM) without cells
The concentrations of LTP-induced H2O2 in PBS and DMEM were detected with coumarin boronic acid (CBA) probe and shown in Fig. 3A. H2O2 was assayed with and without the catalase by observing the fluorescence of the product, 7-hydroxycoumarin (COH)17. It could be seen that H2O2 was produced in both PBS and DMEM obviously with the prolongation of LTP treatment time and the concentration in DMEM was lower than that in PBS of each groups (p < 0.05). Yan et al. found that the components in DMEM such as cysteine and methioine were the main factors that promoted degradation of reactive species including H2O2 18.
Besides, to quantify nitrite/nitrate produced in the PBS and DMEM by LTP, 200 μl of PBS or DMEM were exposed to LTP for 0, 5, 10, 15, 20, 25 and 30 s and the amount of nitrite/nitrate were quantified by UV absorption spectroscopy, as described in the Material and Methods section. The results in Fig. 3B,C showed that a time-dependent increase of each compound concentration, and the concentration of nitrite was lower than that of the nitrate. Normally, DMEM contains a certain amount of nitrate. Moreover the reductive components of DMEM including cysteine and serum maintain nitrite/nitrate in a low level. So a less than 10 s LTP did not cause a large change of nitrite/nitrate concentration. With the treatment time was more than 15 s, the accumulated nitrite/nitrate were sufficient to withstand the buffering of DMEM or PBS, resulting for the rapid increase of nitrite/nitrate (p < 0.05).
Intracellular ROS, O2 −, and NO production in LTP-treated L929 cells
A series of fluorescence probes were applied to characterize the intracellular oxidative production of LTP-treated L929 cells. The results demonstrated that all these three kinds of intracellular RONS increased gradually when the treatment time was longer than 5 s. The results were shown in Fig. 4A–C, representing ROS, O2 − and NO, respectively. It could be seen that LTP could induce ROS, O2 − and NO productions in time-dependent manner. After LTP treatment of 15 s, the cells displayed 6.0, 5.8 and 1.5 folds increase of ROS, NO and O2 − compared with their controls (p < 0.05). When the treatment time was 30 s, intracellular RONS productions increased rapidly compared with the control, and ROS, NO and O2 − productions increased 25.2, 20.5 and 2.2 folds, respectively (p < 0.05).
LTP induced L929 cell proliferation in vitro
To verify the effects of LTP on L929 cells, we treated each group of cells with different exposure intervals of 0 s (control group), 5 s, 10 s, 15 s, 20 s, 25 s and 30 s, respectively. After that, we characterized cell proliferation with cell viability and cell cycle distribution. The effects of LTP on cell viability were shown in Fig. 5A. The results indicated that, 5 s, 10 s and 15 s LTP exposure could enhance cell viability significantly compared with 0 s group (p < 0.05), and a peak value at 15 s exposure was observed. However, when the treatment time was longer than 25 s, the OD value decreased gradually with the extension of exposure time (p < 0.05). The flow cytometry results shown in Fig. 5B indicated that a proper LTP exposure dose could promote more cells from G0/G1 phase into S phase. Quantitative analysis showed that the percentage of S phase cells in the control group was (28.41 ± 0.54) %, which significantly increased in the 15 s LTP-treated group (37.02 ± 0.37) %. The ANOVA tests showed that the differences in the distributions of cell cycle among 10 s, 15 s and 0 s groups were statistically significant (p < 0.05). Besides, pretreatment cells with N-acetyl-L-cysteine (NAC), a ROS scavenger, significantly prevented the plasma-induced cell proliferation. (Fig. 5C).
LTP treatment activated NF-κB pathway
Previous studies showed that NF-κB pathway could be activated by ROS and other stimulating factors14. In addition, LTP reacted with cell culture medium to form RONS and other activated species7,19. To determine whether LTP could activate L929 cells in vitro, phospho-p65 and IκBα, key molecules involved in the NF-κB pathway were extracted from LTP-treated cells and determined with Western blotting. Besides, the transfer of phospho-p65 from cytoplasm into nucleus was regarded as a significant symbol of NF-κB pathway being activated. So we applied IF staining to analyze phospho-p65 translocation in nucleus. The results indicated that an appropriate dose of LTP could activate NF-κB pathway in L929 cells in vitro. It could be seen in Fig. 6A, compared with control groups, in the 5 s, 10 s and 15 s treatment groups, the expression of phospho-p65 increased gradually (p < 0.05). However, it decreased with 30 s treatment (p < 0.05). When the treatment time was longer than 10 s, IκBα expression decreased compared with control (p < 0.05). Figure 6B exhibited the fluorescence images of LTP-treated cells stained with fluorescent dyes, in which nucleus was blue and phospho-p65 was red. These results showed that more phospho-p65 emerged in the nucleus and cytoplasm at 15 s treatment compared with 0 s and 30 s.
Furthermore, 5 mM NAC was used to eliminate LTP induced ROS in cell culture medium, and then phosphor-p65 and IκBα were analyzed with western blotting. The results showed that the expression of phosphor-p65 had no obvious change with the treatment time prolongation compared with total p65. No variations were found in the expression of IκBα in each groups. It was indicated that LTP-induced ROS in medium were closely related to active NF-κB pathway (Fig. 6C).
CyclinD1 expression in LTP-treated L929 cells
As a cell cycle related protein, cyclinD1 plays an important role in G1/S phase, and promotes cells from G1 phase into S phase and commences the DNA replication. We detected cyclinD1 expression with Western blotting, and discovered that the expression of cyclinD1 was related to LTP treatment time (Fig. 7A). CyclinD1 increased significantly from 5 s to 20 s and reached the peak at 15 s. The expression of cyclinD1 had the similar trend with cell viability after LTP treatment. Besides, cyclinD1 mRNA were detected by quantitative RT-PCR at the level of transcription and the results were shown in Fig. 7B. It could be seen that mRNA transcription level of the 15 s group increased 1.76-folds compared to control (p < 0.05). The expression of cyclinD1 in NAC pre-treatment cells was displayed in Fig. 6C. It could be seen that there were no obvious variation about cyclinD1 expression and mRNA transcription (Fig. 7B).
Cell proliferation, cell cycle distribution and cyclinD1 expression in p65si-transfetced L929 cells treated with LTP
In order to clarify the relationship between NF-κB signal pathway and LTP-induced proliferation, we attempted to construct a blocked NF-κB pathway cell model by RNA interference. We applied specific small interfering RNA (siRNA) to knock down the expression of NF-κB p65 subunit. Figure 8A showed the level of p65 mRNA transcription and protein expression. An inhibition rate (66.87 ± 8.52) % indicated that the blocked-NF-κB signal pathway cell model was constructed successfully.
The same plasma treatment protocol as mentioned previously was used to investigate whether LTP could induce p65siRNA-treated L929 cell proliferation or not. For p65siRNA-transfected cells, the results (Fig. 5A) revealed that cell viability significantly increased at 15 s (p < 0.05). However, cell cycle distribution in Fig. 8B showed that there were no statistically significant differences among the groups (p > 0.05). The data of cell proliferation of both normal and p65siRNA-transfected L929 cells were analyzed. With the same treatment time, the viability of p65siRNA-transfected cells was significantly lower than that of the normal cells at 5 s, 10 s and 15 s (p < 0.05). Though we treated these two types of cells for the same time, the cell proliferation of p65siRNA-transfected cells was significantly inhibited. These findings demonstrated that NF-κB pathway played a critical role in LTP-induced cell proliferation in vitro.
LTP-induced expression of cyclinD1 in p65siRNA-transfected cells and normal cells were evaluated. The results (Fig. 8C) showed that with 15 s LTP treatment, p65siRNA-transfected cells had 1.2-folds increase of cyclinD1 mRNA transcription compared with the control (p < 0.05). However, for normal cells, the transcription of cyclinD1 mRNA increased 1.8 folds compared with the control (Fig. 8C). Compared with normal cells (Fig. 8C), p65siRNA-transfected cells had cyclinD1 expression dropped by 45.61% (p < 0.05) with the same treatment time (15 s). These results suggested that LTP-induced cyclinD1 expression was closely related to NF-κB pathway in L929 cells in vitro.
Discussion
Fibroblasts play a key role in the proliferative and remodeling phases of wound healing. The main functions of fibroblasts include synthesis of extracellular matrix (ECM) molecules, release of multiple proteases, such as interstitial collagenases, gelatinase, matrilysin, et al., secretion of cytokines and contraction of wound20,21. What is noteworthy is that cytokines synthesized by fibroblasts, including bFGF, TGF-β, IL-1, IL-6, TNF-α, endothelin-1 and so on, not only stimulated proliferation of fibroblasts themselves, but also affected other cells in a paracrine fashion22,23,24. Our previous studies revealed that the number of fibroblasts in the tissues around the LTP-treated wound in mice significantly increased12. E Sysolyatina et al. discovered that LTP promoted fibroblast proliferation and suggested this effect might be related to cell autophagy25. Paola Brun et al. provided evidence that helium generated plasma promoted proliferation and migration in liver and intestinal fibroblast-like primary cells mainly by increasing intracellular ROS levels and elicited the PPAR-c anti-inflammatory molecular pathway26. In this study, we found a similar proliferative effect of LTP on L929 cells. By focusing on the role of NF-κB signaling pathway in LTP-treated cells, LTP activated NF-κB pathway and it association with cell proliferation were revealed.
RONS include superoxide anion (O2 −), hydroxyl radical (OH•), hydrogen peroxide (H2O2), nitric oxide (NO), peroxynitrite (ONOO−), and so on, which derived not only from cellular metabolism but from external environment. It is important to maintain a dynamic balance of RONS in organisms27. Previous studies had proved that there was a dose-response relationship between RONS and cell functions. A normal level of RONS played important roles in organism signal transductions, including activating transcription factors (NF-κB)14, regulating phosphorylation and dephosphorylation of target proteins (MAPK), and maintaining calcium signaling channel28,29. However, higher level of RONS damaged nucleic acids, proteins, fatty acids and other molecules and induced cell apoptosis and even caused necrosis30,31,32. According to current researches, LTP-induced RONS were generated, transferred or interacted in culture medium. Furthermore, these extracellular RONS could enter cells possibly by diffusing and inducing new species of intracellular production7. O2 −, with strong oxidization and very short half-life, dismutated to hydrogen peroxide (H2O2) and oxygen by either enzyme SOD or no-enzymatic reaction system. Protonation of O2 − produced hydroperoxyl radical (H2O−), which subsequently caused lipid peroxidation and damaged biological membranes33,34. NO had diversified effects on cytostatics, chemotaxis, and vasodilation during early stage of wound healing, and it also regulated the proliferation, differentiation and apoptosis of cells involved in wound healing35. However, NO had negative effects: excessive or disordered production would cause a series of adverse outcomes including free radical damage, chronic inflammation et al.36,37. Our study observed that the productions of intracellular ROS, O2 − and NO increased with prolongation of LTP treatment time. It may be the reason why the fibroblast proliferation, NF-κB pathway-related proteins, and cell cycle-related protein increased firstly and then decreased. It was reported that RONS produced extracellularly by plasma may immediately move across the cell membrane by active transport across the membrane, transient opening of pores in the membrane, then interact with amino acids and proteins and finally lead to production of long-lived reactive hydroperoxides or activation of pathways that modify intracellular ROS concentration38. In our present study, the intracellular RONS had no significant change, whereas cell proliferation, NF-κB pathway activation occured with 5 s LTP treatment. It could be explained that the intracellular RONS might mainly activate signaling pathway and promote cell proliferation, which led to RONS consumption. Therefore, the intracellular RONS in 5 s group could not accumulate effectively and were no statistically significant compared with control. Furthermore, in present study, NAC was added into cell culture medium to eliminate LTP-evoked ROS. No obvious variations of cell proliferation, cell cycle distribution, phospho-p65 and cyclinD1 expression were observed compared to normal cells. This stategy may provide evidence that LTP-induced ROS play the critical role in cell proliferation.
It should be noted that there is no way to accurately obtain qualitative and quantitative detection results of intracellular free radicals. As a result, the common fluorescent probes such as DHE, DCFH-DA and DAF-FM DA39 were used in this study. These probes can only reflect the trend of free radicals variance but not quantify the concentration of free radicals.
Our study also demonstrated that LTP could activate NF-κB signaling pathway. NF-κB, as a familiar transcription factor, can respond to environmental stimuli with specific changes in gene expression. A wide variety of genes are regulated by NF-κB, including encoding cytokines, chemokines, adhesion molecules, acute phase proteins, inducible effector enzymes, antimicrobial peptides13,40. NF-κB forms homodimer and heterodimer with such five proteins: RelA (p65), c-Rel, RelB, NF-κB1 (p50), and NF-κB2 (p52), among which p65/p50 complex is the most abundant form and shows a great transcriptional activation. IκBs are bound with the nuclear localization signals (NLS) on NF-κB subunits. As a result, NF-κB is localized to the cytoplasm in an inactive form in unstimulated cells. As the major IκB protein, IκBα has been studied extensively. When cells are stimulated by cytokines, growth factor, oxidative stress, and other stimulus mentioned before, IκB kinases (IKKs) mediate IκBs phosphorylation, and then the protein is degradated by the ubiquitin and proteasome systems. With that an unmasked NLS p65/p50 heterodimers would be phosphorylated by IKK and others on p65 subunits13,41. Activated NF-κB translocates to nucleus from cytoplasma and binds at κB sites in the DNA. Our study showed that NF-κB signaling pathway was activated through the decrease of IκBα, increase of phospho-p65 and translocation of phospho-p65 into nucleus after 24 hours of LTP treatment, as shown in Fig. 6.
NF-κB can be activated by oxidant in many types of cells. The activation methods mainly include ROS activating NF-κB signaling pathway by IκBα phosphorylation at serine 32 or 36 and phospherylation IκBα on tyrosine 42 or PEST domain of serine residues42 For instance, hydrogen peroxide activated IKKs43, and singlet oxygen activates IκBα through an intact tyrosine 4244. Additionally, the phospherylation or dephospherylation and oxidation of thiol residues caused by ROS plays a critical role in ROS-induced transformation of the NF-κB signaling pathway45. In the previous studies, NO regulated NF-κB activation to inhibit the production of many proinflammatory factors. In normal human peripheral blood mononuclear cells, NO promoted cytoplasmic NF-κB proteins to translocate into nucleus22. Other studies with vascular endothelial cells revealed that NO could inhibit NF-κB target genes transcription through either protecting IκBα from proteolytic degradtion or upregulating transcription of IκBα gene46. In this study, we detected the crucial biomakers IκBα and phospho-p65 extracted from LTP-treated L929 cells, and the results demonstrated that LTP could activate NF-κB pathway at an appropriate dose. Besides, pretreatment with NAC markedly prevented the plasma-induced variations of cell viability, cell DNA synthesis, NF-κB pathway activation and cyclinD1 expression in cells. We presume that the mechanism is closely related with LTP-induced RONS productions.
As a DNA-binding protein, NF-κB can promote cells from G1 phase to S phase by enhancing expression of cyclinD147. CyclinD1 plays an essential role in G1/S phase checkpoint and DNA synthesis. Normally it associates with cyclin-dependent kinases CDK4 and CDK6, and phosphorylates the retinoblastoma protein (Rb) to release transcription factor E2F in mid-G1 phase48. E2F regulates transcription of genes such as CDK1, cyclinA, and cyclinE. Our study revealed that the changes of cyclinD1 expression were similar to the tend of cell proliferation mentioned above.
However, cyclinD1 gene transcription is regulated by not only NF-κB, but also STAT5, Ets1, c-Jun, Otc1 and so on. To ealuate the hypothesis that LTP-induced cyclinD1 increases in connection with NF-κB pathway, we knocked down p65 expression, and subsequently treated these cells with LTP. The results in Fig. 8 showed that cells which blocked NF-κB pathway proliferated slowly with treatment time prolonged and more cells were arrested in G1 phase. With the same dose of LTP, cyclinD1 expression in cells which block NF-κB pathway were significantly decreased than normal cells. So we consider that NF-κB-regulated cyclinD1 expression plays an important role in LTP-promoted L929 cell proliferation in vitro.
Methods
Cell culture
L929 cells were cultured in DMEM with high glucose (GE healthcare) complemented with 10% fetal bovine serum (Biological Industries, Israel), 2mM L-glutamine (Amresco, USA) and 1% antibiotics (100U/ml penicillin and 100 μg/ml streptomycin, Gibco, USA). The cells were maintained in a humidified conditions at 37 °C with 5% carbon dioxide incubator.
LTP treatment procedure
Before LTP treatment, L929 cell suspension was seeded on 96-well plate with 200 μl per well at a concentration of 105 cells/ml, and then kept in carbon dioxide incubator overnight with the same conditions described before. Besides, for treatment with NAC (Beyotime, China) and plasma, 5 mM of NAC was added to the wells 4 hours prior to exposure to plasma. According to a series of preliminary experiments, we determined LTP exposure time to be 5 s, 10 s, 15 s, 20 s, 25 s and 30 s.
Cell viability assay
Cell viability was determined with MTT assay. After LTP-treated cells were cultured for 44 h, 20 μL MTT (Sigma, USA) was added into each well, and the cells were incubated for another 4 h. The culture medium was discarded, and formazan crystals were dissolved into dimethyl sulphoxide (Sigma, USA). The A570 absorbance values were determined on microplate reader (Tecan Spectra, Austria).
Flow Cytometry analysis of cell cycle
After LTP-treated L929 cells were cultured for 48 h, all cultured medium is collected, and cells are digested with 0.25% trypsin (HyClone) without EDTA for 3 min. The digested cells and collected medium were centrifuged. The cells were washed with cold PBS twice and then fixed in 70% cold ethanol at least for 4 h. After incubation, cells were stained with propidium iodide (containing RNase1, Sigma, USA)), and then incubated in the dark at room temperature for 30 min. The samples were analyzed for DNA content profile with flow cytometry (Becton Dickinson, USA). The percentage of cells in G0/G1, S, and G2/M phases were assessed by ModFit LT software (Becton Dickinson, USA).
Western blotting
Protein samples were extracted with RIPA-buffer (Heart, China) from LTP-treated cells after 24 h in culture, then heated at 95 °C °C for 5 min with sample buffer (250 mM Tris-HCl, pH 6.8, 10% glycerol, 4% sodium dodecyl sulfate, 2% β-mercaptoethanol, and 0.003% bromophenol blue). Proteins were separated on 12% SDS-PAGE, and electrophoretically transferred onto polyvinylidene difluoride (PVDF) membrane (Millipore, USA), and then blocked with 5% dried skim milk in Tris buffer saline with 0.1% Tween-20 (TBST) for 2 h at room temperature. The blocked membranes are rinsed three times in TBST for 10 min, and then incubated in the primary antibodies (anti-phospho p65, 1:5000, Abcam; anti-NF-κB P65 and anti-NF-κBIα Polyclonal Antibody, 1:2000, ABclonal; anti-cyclinD1, 1:200, Santa Cruz; anti-β-actin, 1:2000, CWbio) overnight at 4 °C. After being washed three times with TBST, the secondary antibody horseradish peroxidase (CWbio) was incubated on the membrane for 2 h at room temperature. Then the PVDF membranes were washed three times with TBST and incubated with ECL Plus Reagent (Millipore, USA) and scanned using the chemiluminescence (BioRad, USA). Immunoreactive products were quantified by image-Pro plus 6.0 software to determine the optical density of protein bands.
Immunofluorescence
LTP-treated cells in 96 well-plate were washed three times with PBS, and then fixed by 4% paraformaldehyde for 10 min, blocked with 10% goat serum at room temperature for 1 h, and incubated with anti-phospho-p65 antibody (1:50, Abcam) overnight. The primary antibody was removed and washed three times with PBS, incubated with CY3-labeled secondary antibody (Beyotime, China) for 1 h. Nuclei were labeled with 1 μg/ml DAPI (Roche, Swiss) for 5 min and washed twice with PBS. Cells were visualized with inverted fluorescence microscope (Nikon, Japan).
RNA interference of p65 expression
siRNA oligo was synthesized by Biomics Biotechnology (Jiangsu, China). p65-siRNA target sequences were: sense, 5′CUGAAGCUAUAACUCGCCUdTdT 3′, antisense 5′AGGCGAGUUAUAGCUUCAGdTdT3′. negative control sense: sense, 5′UUCUCCGAACGUGUCACGUdTdT3′, antisense 5′ACGUGACACGUUCGGAGAAdTdT3′. 500 μl DMEM high glucose medium without antibiotics contained 105 L929 cells, which were inoculated in each well of a 24-well-plate, and then incubated in the conditions described before until they grew to 50% confluence. Before transfection, 2 μl 20 μM siRNA and 1.5 μl LipofectamineTM 2000 (Invitrogen, USA) were diluted with 48 μl and 48.5 μl Opti-MEM (Gibco, USA) respectively. The two reagents were mixed together and incubated at room temperature for 20 min, then added into each well. The final concentration of siRNA and LipofectamineTM 2000 were 67 nM and 2.5 μl/ml, respectively.
Reverse transcription polymerase chain reaction (RT-PCR)
Total RNA was extracted by TRIzol reagent (Invitrogen, USA) from p65SiRNA-transfected cells after 24 h. RNA was reverse transcribed with M-MLV first strand cDNA Synthesis Kit (Omega, USA), amplified with a Taq-PCR master mix kit (Runde, China) and a pair of primer sequences as followed: sense 5′ TGTGGAGATCATCGAACAGCCG3′, antisense 5′ TTCCTGGTCCTGTGTAGCCATTGAT3′. Total RNA was reverse transcribed for 60 min at 37 °C and denatured at 85 °C for 5 min. PCR amplification is reacted in a total reaction volume of 25 μL with the following thermal cycling parameters: 94 °C for 3 min, 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min, for 30 cycles with the above three steps, and finally the last step of 72 °C for 5 min is performed. The house-keeping gene β-actin was amplified as an internal control with the primers: sense 5′CAACCTCTCgTACATCgg3′, antisense 5′ggTCTggTgCTCAAAAgg3′. PCR products were separated on 2% agarose gels and stained with ethidium bromide (Heart, China). DNA bands were visualized by UV transilluminator.
Quantitative Real-time RT-PCR was performed using SYBR Green I qPCR Mix (Takara) according to the manufacturer′s protocol. The primers sequences of cyclinD1 used in this study were as follows: sense 5′ GGAGCAGAAGTGCGAAGA 3′, antisense 5′ GAGGGTGGGTTGGAAATG 3′. The primers used for β-actin was same as those described above.
Determination of intracellular ROS, superoxide anion (O2 −) and nitric oxide (NO)
Intracellular ROS, O2 - and NO productions were estimated with 2′, 7′-dichlorofluorescin diacetate (DCFH-DA, Sigma, USA), dihydroethidium (DHE, beyotime, China), 3-Amino, 4-aminomethyl-2′, 7′-difluorescein, diacetate (DAF-FM DA, keygen biotech, China), respectively. LTP-treated cells were cultured for 24 h, and then washed with PBS for 3 times. After that, 200 μL 10 μM DCFH-DA diluted with DMEM (serum and phenol red free medium) was added into each well of the 96-well plate, incubated for 30 min at 37 °C in CO2 incubator, and then the cells were washed 3 times with PBS gently. ROS productions were visualized with inverted fluorescence microscope (Nikon, Japan). Fluorescence intensity was analyzed with image-Pro plus 6.0 software. The same steps was repeated for 200 μL 5 μM DAF-FM DA to detect NO. The cells treated with DHE were digested with 0.25% trypsin (HyClone) without EDTA for 3 min, and then collected and washed with cold PBS twice. After then the cells were resuspended in PBS and detected with flow cytometry (Becton Dickinson, USA).
UV-visible absorption spectroscopy
Doublebeam UV-visible absorption spectroscopy (Hitachi, Japan) was used to detect nitrite/nitrate in the PBS and DMEM (without phenol red) treated by LTP. Spectra were recorded at room temperature in steps of 0.5 nm in the range from 200 to 500 nm using a 1 cm-path length quartz optical cell. Known concentrations of NaNO2 and NaNO3 were prepared in PBS.
Detection of H2O2 in LTP treated PBS and DMEM
LTP induced H2O2 in PBS and DMEM were estimated with coumarin boronic acid (CBA) probe. PBS and DMEM with or without 5 mM CAT were added into 96-well plate with 200 μl per well and LTP exposure time were same as mentioned above. And then 2 μl CBA (0.1 M) was added into LTP treated PBS or DMEM, incubated for 30 min at room temperature. The fluorescence intensity of COH was detected with microplate reader (Tecan Spectra, Austria) at excitation and emission wavelengths are 355 nm and 460 nm. The concentration of H2O2 was quantified based on H2O2 standard curve.
Statistics
The experiments of cell viability and cell cycle were repeated 3 times for each treatment dose. The values were expressed as means and standard deviation. All data were analyzed with one-way analysis of variance (ANOVA). All analyses were conducted with SPSS (vision 13.0). p < 0.05 was the level of significance adopted in this study.
References
Laroussi, M. Low temperature plasma-based sterilization: Overview and state-of-the-art. Plasma Process. Polym. 2, 391–400 (2005).
Baxter, H. C. et al. Elimination of transmissible spongiform encephalopathy infectivity and decontamination of surgical instruments by using radio-frequency gas-plasma treatment. J Gen Virol. 86, 2393–2399 (2005).
Shintani, H. Inactivation of Bacterial Spore, Endotoxin, Lipid A, Normal Prion and Abnormal Prion by Exposures to Several Sorts of Gases Plasma. Biocontrol Sci. 21, 1–12 (2016).
Lloyd, G. et al. Gas Plasma: Medical Uses and Developments in Wound Care. Plasma Process. Polym. 7, 194–211 (2010).
Miletic, M. et al. Effects of non-thermal atmospheric plasma on human periodontal ligament mesenchymal stem cells. J. Phys. D: Appl. Phys. 46, 1–9 (2013).
Heinlin, J. et al. Plasma applications in medicine with a special focus on dermatology. J. Eur. Acad. Dermatol. Venereol. 25, 1–11 (2011).
Yan, D. Y., Sherman, J. H. & Keidar, M. Cold atmospheric plasma, a novel promising anti-cancer treatment modality. Oncotarget. 13304/10.18632 (2016).
Woedtke, Th, Metelmann, H. R. & Weltmann, K. D. Clinical plasma medicine: state and perspectives of in vivo application of cold atmospheric plasma. Contrib Plasma Phys. 54, 104–117 (2014).
Isbary, G. et al. Successful and safe use of 2 min cold atmospheric argon plasma in chronic wounds: results of a randomized controlled trial. Br. J. Dermatol. 167, 404–410 (2012).
Kalghatgi, S., Fridman, G., Fridman, A. & Clyne, A. M. Endothelial Cell Proliferation is Enhanced by Low Dose Non-Thermal Plasma Through Fibroblast Growth Factor-2 Release. Ann. Biomed. Eng. 38, 748–757 (2010).
Haertel, B., Volkmann, F., Woedtke, T. & Lindequist, U. Differential sensitivity of lymphocyte subpopulations to non-thermal atmospheric-pressure plasma. Immunobiology. 217, 628–633 (2012).
Xu, G. M. et al. Dual effects of atmospheric pressure plasma jet on skin wound healing of mice. Wound Repair Regen. 23, 878–884 (2015).
Gilmore, T. D. Introduction to NF-κB: players, pathways, perspectives. Oncogene. 25, 6680–6684 (2006).
Siomek, A. NF-κB signaling pathway and free radical impact. Acta Biochim Pol. 59, 323–31 (2012).
Guttridge, D. C. et al. NF-κB controls cell growth and differentiation through transcriptional regulation of CyclinD1. Mol Cell Biol. 19, 5785–5799 (1999).
Deng, X. T., Shi, J. J. & Kong, M. G. Protein destruction by a helium atmospheric pressure glow discharge: Capability and mechanisms. J. Appl. Phys. 101, 074701 (2007).
Zielonka, J. et al. Mitigation of NADPH oxidase 2 activity as a strategy to inhibit peroxynitrite formation. J. Biol. Chem. 291, 7029–7044 (2016).
Yan, D. et al. Stabilizing the cold plasma-stimulated medium by regulating medium’s composition. Sci Rep. 6, 26016 (2016).
Schreck, R., Rieber, P. & Baeuerle, P. A. Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1. EMBO J. 10, 2247–2258 (1991).
Smith, R. S., Smith, T. J., Bliden, T. M. & Phipps, R. P. Fibroblasts as sentinel cells. Synthesis of chemokines and regulation of inflammation. Am J Pathol. 151, 317–322 (1997).
Li, B. & Wang, J. H. Fibroblasts and myofibroblasts in wound healing: force generation and measurement. J Tissue Viability. 20, 108–120 (2011).
Shah, K., Kumar, R. G., Verma, S. & Dubey, R. S. Effect of cadmium on lipid peroxidation, superoxide anion generation and activities of antioxidant enzymes in growing rice seedlings. Plant Scinece. 161, 1135–1144 (2001).
Schwentker, A., Vodovotz, Y., Weller, R. & Billiar, T. R. Nitric oxide and wound repair: role of cytokines? Nitric Oxide. 7, 1–10 (2002).
Lander, H. M., Sehajpal, P., Levine, D. M. & Novogrodsky, A. Activation of human peripheral blood mononuclear cells by nitric oxide-generating compounds. J Immunol. 150, 1509–1516 (1993).
Sysolyatina, E. et al. Frequency of cell treatment with cold microwave argon plasma is important for the final outcome. J. Phys. D: Appl. Phys. 49, 294002 (2016).
Brun, P. et al. Helium Generated Cold Plasma Finely Regulates Activation of Human Fibroblast-Like Primary Cells. PLoS One. 15, 9 (2014).
Nindl, G. et al. Effect of hydrogen peroxide on proliferation, apoptosis and interleukin-2 production of Jurkat T cells. Biomed Sci Instrum. 40, 123–128 (2004).
Cakir, Y. & Ballinger, S. W. Reactive species-mediated regulation of cell signaling and cell cycle: the role of MAPK. Antioxid Redox Signal. 7, 726–740 (2005).
Zorov, D. B., Juhaszova, M. & Sollott, S. J. Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol Rev. 94, 909–950 (2014).
Egler, R. A. et al. Regulation of reactive oxygen species, DNA damage, and c-Myc function by peroxiredoxin 1. Oncogen. 24, 8038–8050 (2005).
Chandra, J., Samali, A. & Orrenius, S. Triggering and modulation of apoptosis by oxidative stress. Free Radic Biol Med. 29, 323–333 (2000).
Kanazawa, S., Sano, S. & Koshiba, T. et al. Changes in antioxidative in cucumber cotyledons during natural senescence: comparison with those during dark-induced senescence. Physiol. Plant. 109, 211–216 (2000).
Marumo, T., SchiniKerth, V. B., Fisslthaler, B. & Busse, R. Platelet-derived growth factor-stimulated superoxide anion production modulates activation of transcription factor NF-kappa B and expression of monocyte chemoattractant protein 1 in human aortic smooth muscle cells. Circulation. 96, 2361–2367 (1997).
Fosen, K. M. & Thom, S. R. Hyperbaric Oxygen, Vasculogenic Stem Cells, and Wound Healing. Antioxid Redox Signal. 21, 1634–1647 (2014).
Soneja, A., Drews, M. & Malinski, T. Role of nitric oxide, nitroxidative and oxidative stress in wound healing. Pharmacol Rep. 57, 108–119 (2005).
Xu, D.H. et al. In Situ OH Generation from O2 − and H2O2 Plays a Critical Role in Plasma-Induced Cell Death. Plos One. https://doi.org/10.1371/journal.pone.0128205 (2015).
Kabe, Y. et al. Redox regulation of NF-kappaB activation: Distinct redox regulation between the cytoplasm and the nucleus. Antioxid Redox Signal. 7, 395–403 (2005).
Zhao, S. S. et al. Atmospheric pressure room temperature plasma jets facilitate oxidative and nitrative stress and lead to endoplasmic reticulum stress dependent apoptosis in HepG2 cells. PLoS One. 8, e73665 (2013).
Kalyanaraman, B. et al. Recent developments in detection of superoxide radical anion and hydrogen peroxide: Opportunities, challenges, and implications in redox signaling. Arch Biochem Biophys. 617, 38–47 (2017).
Allan, R. B. The NF-κB Regulatory Network. Cardiovasc Toxicol. 6, 111–130 (2006).
Karin, M. How NF-κB is activated: the role of the IκB kinase (IKK) complex. Oncogene. 18, 6867–6874 (1999).
Gloire, G. & Piette, J. Redox regulation of nuclear post-translational modifications during NF-kappaB activation. Antioxid Redox Signal. 11, 2209–2222 (2009).
Jaspers, I. Hydrogen peroxide has opposing effects on IKK activity and IκBα breakdown in airway epithelial cells. Am J Respir Cell Mol Biol. 24, 769–777 (2001).
Volanti, C., Matroule, J. Y. & Piette, J. Involvement of oxidative stress in NF-kappaB activation in endothelial cells treated by photodynamic therapy. Photochem Photobiol. 75, 36–45 (2002).
Valko, M. et al. Free radicals, metals and antioxidants in oxidative stress-induced cancer. Chem Biol Interact. 160, 1–40 (2006).
Kabe, Y. et al. Redox regulation of NF-kappaB activation: Distinct redox regulation between the cytoplasm and the nucleus. Antioxid Redox Signal. 7, 395–403 (2005).
Hinz, M. et al. NF-κB function in growth control: regulation of cyclinD1 expression and G0/G1-to-S-phase transition. Mol Cell Biol. 19, 2690–2698 (1999).
Burch, P. M. & Heintz, N. H. Redox Regulation of Cell-Cycle Re-entry: CyclinD1 as a Primary Target for the Mitogenic Effects of Reactive Oxygen and Nitrogen Species. Antioxid Redox Signal. 7, 741–751 (2005).
Acknowledgements
This work is supported in part by the National Natural Science Foundation of China under Grants 81372076, 51677146 and 51521065, the Sci-tech Project of Shaanxi Province (2010K16-04), and the Fundamental Research Funds for the Central Universities under Grant xkjc2013004.
Author information
Authors and Affiliations
Contributions
Xing-Min Shi and Guan-Jun Zhang designed and supervised all experiments. Jin-Ren Liu and Gui-Min Xu conducted experiments and measurements, co-led data analysis. All authors discussed the results and co-wrote the manuscript.
Corresponding authors
Ethics declarations
Competing Interests
The authors declare that they have no competing interests.
Additional information
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Electronic supplementary material
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Liu, JR., Xu, GM., Shi, XM. et al. Low temperature plasma promoting fibroblast proliferation by activating the NF-κB pathway and increasing cyclinD1 expression. Sci Rep 7, 11698 (2017). https://doi.org/10.1038/s41598-017-12043-w
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-017-12043-w
This article is cited by
-
NFKBIZ regulates NFκB signaling pathway to mediate tumorigenesis and metastasis of hepatocellular carcinoma by direct interaction with TRIM16
Cellular and Molecular Life Sciences (2024)
-
Orai1 downregulation causes proliferation reduction and cell cycle arrest via inactivation of the Ras-NF-κB signaling pathway in osteoblasts
BMC Musculoskeletal Disorders (2022)
-
Argon Atmospheric Plasma Treatment Promotes Burn Healing by Stimulating Inflammation and Controlling the Redox State
Inflammation (2020)
-
On–off switching of cell cycle and melanogenesis regulation of melanocytes by non-thermal atmospheric pressure plasma-activated medium
Scientific Reports (2019)
-
Short exposure to cold atmospheric plasma induces senescence in human skin fibroblasts and adipose mesenchymal stromal cells
Scientific Reports (2019)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.