Arp2/3 complex controls T cell homeostasis by maintaining surface TCR levels via regulating TCR+ endosome trafficking

Zhang, Ye; Shen, Hao; Liu, Haifeng; Feng, Haiyun; Liu, Yan; Zhu, Xiaoyan; Liu, Xiaolong

doi:10.1038/s41598-017-08357-4

Download PDF

Article
Open access
Published: 21 August 2017

Arp2/3 complex controls T cell homeostasis by maintaining surface TCR levels via regulating TCR⁺ endosome trafficking

Ye Zhang^1,2^na1,
Hao Shen^1,2^na1,
Haifeng Liu^1,2,
Haiyun Feng^1,2,3,
Yan Liu^1,2,3,
Xiaoyan Zhu^1,2 &
…
Xiaolong Liu^1,2,3

Scientific Reports volume 7, Article number: 8952 (2017) Cite this article

2565 Accesses
22 Citations
Metrics details

Subjects

Abstract

T cell receptor (TCR) signaling is important for T cell homeostasis and function. However, how surface TCR levels are regulated and its biological significance on T cells remains largely unknown. Here, we show that the T cell-specific deletion of Arpc2, a component of Arp2/3 complex, results in compromised peripheral T cell homeostasis. Arp2/3 complex-nucleated actin filaments are essential for maintaining surface TCR levels by regulating TCR⁺ endosome trafficking in resting state and controlling polarization of TCR⁺ endosomes during immune synapse formation in T cells. Additionally, Arpc2-TKO T cells are unable to form immune synapse. Interestingly, defected T cell homeostasis is caused by reduced surface TCR levels but not impaired immune synapse formation. Collectively, our findings suggest that Arp2/3 complex-nucleated actin filaments are required for maintaining surface TCR levels via regulating TCR⁺ endosome trafficking which is essential for T cell homeostasis.

CD45 pre-exclusion from the tips of T cell microvilli prior to antigen recognition

Article Open access 23 June 2021

Yunmin Jung, Lai Wen, … Klaus Ley

INPP5E regulates CD3ζ enrichment at the immune synapse by phosphoinositide distribution control

Article Open access 05 September 2023

Tzu-Yuan Chiu, Chien-Hui Lo, … Won-Jing Wang

IRAP-dependent endosomal T cell receptor signalling is essential for T cell responses

Article Open access 02 June 2020

Irini Evnouchidou, Pascal Chappert, … Loredana Saveanu

Introduction

Peripheral T cells are maintained at a constant cell number so that they can efficiently recognize foreign antigens and protect the host from pathogen invasion. T cell homeostasis requires the combined regulation of T cell survival and proliferation, which are mediated by complex homeostatic signals^1,2,3. It is widely accepted that there are two such homeostatic signals. One is an IL-7-induced signal that is essential for the survival and homeostatic proliferation of T cells. This signal activates the JAK/Stat5 pathway and increases the expression of the anti-apoptotic molecule B-cell leukemia/lymphoma 2 (Bcl-2)^{4, 5}. The other is a self-peptide-recognition-induced basal TCR signal, which is also required for both T cell survival and homeostatic proliferation⁶. Previous studies have shown that the adoptive transfer of naïve T cells into major histocompatiblity complex (MHC) deficient mice resulted in shortened lifespans in both CD4⁺ and CD8⁺ naïve T cells, indicating that interactions between TCR and the self-peptide-MHC complex is necessary for T cell homeostasis^{7, 8}.

The regulation of TCR expression level is essential for TCR signaling⁹. Synthesis, endocytosis, recycling and degradation are important processes that modulate and maintain TCR level in T cells¹⁰. In resting state, surface TCR maintenance relies on the constant transport of TCR between the intracellular pool and the plasma membrane¹⁰. TCR stimulation induces the downregulation of surface TCR levels by elevating its rate of endocytosis and the internalized TCR can then be recycled back to the plasma membrane¹¹. By forming immune synapse (IS), which is a junctional structure located at the contact regions between T cells and antigen-presenting cells (APCs), T cells can rapidly accumulate TCR at the interface¹². The contact region on T cells contains receptors, signaling proteins and cytoskeleton, forming a central supramolecular activation cluster (cSMAC) surrounded by 2 rings peripheral supramolecular activation cluster (pSMAC) and distal supramolecular activation cluster (dSMAC)^12,13,14. During the initiation and maintenance of immune synapse, TCR recruitment to the contact area is quite important¹⁴. Previous studies have demonstrated that this recruitment requires surface TCRs to move toward the center of the immune synapse^{14, 15}. Recently, some studies have investigated the mechanisms by which recycled TCR⁺ endosomes are delivered from the intracellular pool to immune synapse, a process that also plays a critical role in TCR recruitment¹⁶. In addition, this delivery ensures a steady supply of TCRs to the plasma membrane to sustain T-cell activation¹⁷. Finetti et al. showed that IFT20, a subunit of the intraflagellar transport (IFT) system, is required for the polarized recycling of TCR to immune synapse¹⁸. Recently, experiments that induced the loss of a series of Rab GTPase subunits such as Rab8, Rab11 and Rab29, also resulted in impaired TCR polarization during immune synapse formation^19,20,21. Although TCR is required for homeostatic signals, the mechanisms that maintain surface TCR levels and its biological effects on T cell homeostasis remain largely unknown.

Actin-related Protein (ARP2/3) is a complex that is highly conserved in all eukaryotes that can nucleate branched actin filaments (F-actin) and generate actin networks^{22, 23}. The Arp2/3 complex is a seven-member complex that includes Arp2 and Arp3, which are structurally similar to actin monomers and contact with actin. The other 5 subunits of the Arp2/3 complex are Arpc1, Arpc2, Arpc3, Arpc4 and Arpc5²³. Arpc2 and Arpc4 form the core of the Arp2/3 complex and act to stabilize the complex²⁴. By using specific small-molecule inhibitors or loss-of-function genetic manipulations, the Arp2/3 complex has been found to play an essential role in many biological processes²⁵. For example, the Arp2/3 complex provides the protrusive force that is required to generate lamellipodia at the leading edge of cells²⁶. Besides, the Arp2/3 complex regulates cell-cell junctions to promote the formation of epidermal barriers²⁷. In Drosophila, the Arp2/3 complex helps to maintain Notch signaling by regulating the vesicles of the Notch ligand²⁸. In the brains, the Arp2/3 complex plays an essential role in shaping and maintaining dendritic spines²⁹. In T cells, TCR signal transduction can activate Nucleation Promoting Factors (NPF) to trigger the Arp2/3 complex-mediated actin polymerization³⁰. Although the biochemistry and structure of the Arp2/3 complex has been extensively studied, the function of this complex in T cells has not been well characterized.

To investigate the specific role of the Arp2/3 complex in T cells, we generated Arpc2-TKO mice by specifically deleting of Arpc2 in T cells, which disrupted the integrity of the complex. We found that loss of Arpc2 caused a dramatic decrease in peripheral T cell numbers and compromised T cell homeostasis. In the absence of Arpc2, peripheral T cells exhibited impaired surface TCR maintenance and immune synapse formation. The impaired surface TCR maintenance was caused by defective TCR⁺ endosome trafficking, which is promoted by Arp2/3 complex-nucleated actin filaments and such compromised actin filaments were also accounted for defective polarization of TCR⁺ endosome during immune synapse formation. Moreover, our data demonstrate that the defective homeostasis observed in Arpc2-TKO T cells is caused by a reduction in surface TCR levels but not impaired immune synapse formation. Taken together, our research supports an essential role for the Arp2/3 complex in surface TCR maintenance and such TCR levels are critical for T cell homeostasis.

Results

Deficiency in Arpc2 leads to reduced numbers of peripheral T cells

Arpc2 and Arpc4 were demonstrated to form the core of the Arp2/3 complex. Point mutations in Arpc2 disrupted the activity of Arp2/3 complex-promoted branched actin nucleation^{23, 31}. We examined the expression pattern of Arpc2 in different subsets of T cells. Intriguingly, peripheral T cells exhibited higher Arpc2 transcription and protein level than were observed in thymocytes (Fig. 1a and Supplementary Fig. S1a). Thus, we speculated that Arpc2 might play an essential role in peripheral T cells. To examine this hypothesis, we bred conditional Arpc2 ^L/L mice³² with Cd4-cre mice. This breeding resulted in the specific deletion of Arpc2 from double-positive (DP) stage of T cells in the thymus in CD4-cre ⁺ Arpc2 ^L/L mice (designated Arpc2-TKO mice) (Supplementary Fig. S1b-d). Compared with their wild-type control littermates (designated Ctrl mice, Arpc2 ^L/L or Arpc2 ^L/+), the expression of Arp2/3 complex component Arp3 was also decreased in Arpc2-TKO T cells, indicating that the integrity of the Arp2/3 complex was compromised (Supplementary Fig. S1e). The frequency and absolute number of various T cell subsets in the thymus of Arpc2-TKO mice were not significantly different from those in Ctrl mice (Fig. 1b,c). The expression of the TCR signaling strength markers CD5^{1, 6} were similar between Ctrl and Arpc2-TKO DP and SP thymocytes (Supplementary Fig. S1f). The expression of TCRβ was equal between Ctrl and Arpc2-TKO DP thymocytes and slightly lower in Arpc2-TKO SP thymocytes (Supplementary Fig. S1g). However, the frequencies and absolute numbers of peripheral CD4⁺ and CD8⁺ T cells were lower in the lymph nodes, spleen and blood in Arpc2-TKO mice than in Ctrl mice (Fig. 1d-i). The cellularity of lymph nodes, spleen was also decreased (Supplementary Fig. S2a). There was no difference in the absolute numbers of B cells in the lymph nodes and spleen (Supplementary Fig. S2b-d). Moreover, we found that the loss of Arpc2 led to a significant decrease in naïve T cells population compared with Ctrl mice (Fig. 1j,k). The decreased number of peripheral T cells in Arpc2-TKO mice may have resulted from an increasement in Tregs. However, the proportion of Tregs in the Arpc2-TKO mice was similar to that in Ctrl mice (Fig. 1l,m). Together, these data suggest that the loss of Arpc2 leads to a significant decrease in peripheral T cell numbers but does not influence thymocyte development.

T cell homeostasis is impaired in the absence of Arpc2

Given that survival and proliferation are both critical for maintaining peripheral T cell number¹, we analyzed survival and proliferation of T cells in the absence of Arpc2. Compared with Ctrl mice, the apoptosis of Arpc2-TKO CD4⁺ naïve T cells was lower and the apoptosis of Arpc2-TKO CD8⁺ naïve T cells was similar (Fig. 2a,b). Next, we examined the homeostatic proliferation potential of Arpc2-TKO naïve T cells using adoptive transfer assay³³. As expected, the recovery of Arpc2-TKO naïve T cells was much slower than Ctrl mice (Fig. 2c,d). Additionally, by generating bone-marrow chimeras, we found that Arpc2 affected peripheral T cell homeostasis in a cell-intrinsic manner (Fig. 2e-h). Collectively, these results indicate that Arpc2 is essential for peripheral T cell homeostasis.

TCR signaling is attenuated after Arp2/3 complex ablation

Because IL-7-induced signals are required for T cell homeostasis^{4, 5}, we examined surface IL-7 receptor (IL-7R) level. Although the surface expression of IL-7R was slightly decreased in Arpc2-TKO naïve T cells (Fig. 3a), these cells responded equally to IL-7-induced inhibition of T cell apoptosis compared with Ctrl mice (Fig. 3b). The expression of Bcl-2 was equal between Ctrl and Arpc2-TKO naïve T cells (Fig. 3c), and the upregulation of Bcl-2 following IL-7 stimulation was normal in Arpc2-TKO naïve T cells (Fig. 3d). As previous work demonstrated that TCR recognition of self-ligand-MHC complex was essential for T cell homeostasis³⁴, we next examined TCR signaling. Notably, the level of TCR-induced calcium flux was reduced in Arpc2-TKO naïve T cells compared with Ctrl mice by anti-CD3 and anti-CD28 crosslink (Fig. 3e). The upregulation of CD69 expression of Arpc2-TKO naïve T cells was diminished following TCR stimulation (Fig. 3f and Supplementary Fig. S3a) but similar when cells were stimulated with phorbol myristate acetate (PMA)/ionomycin (Fig. 3g), which bypass receptor-proximal signaling³⁵. Presumably, the defective T cell homeostasis that was observed in cells lacking Arpc2 might be caused mainly by a reduction in TCR-proximal signals.

Ablation of the Arp2/3 complex results in impaired surface TCR maintenance and immune synapse formation in peripheral T cells

Because TCR-proximal signals were reduced in the absence of Arpc2, we next analyzed TCR expression in Arpc2-TKO T cells and cells obtained from littermate controls. Intriguingly, FACS analysis revealed that surface TCR levels were lower in Arpc2-TKO T cells than in Ctrl mice, while total TCR levels were equal (Fig. 4a,b). To determine whether Arpc2 was able to directly affects surface TCR levels in peripheral T cells, we knocked down Arpc2 in peripheral T cells obtained from Ctrl mice and observed that the expression of surface TCR was also lower in Arpc2 knocked down T cells compared with control (Fig. 4c and Supplementary Fig. S4). Additionally, we found that Arpc2-TKO T cells failed to form immune synapse when stimulated with anti-CD3 and anti-CD28 activator beads (Fig. 4d,e). Consistent with this result, Arpc2-TKO T cells proliferated more slowly on TCR stimulation (Fig. 4f).

Arp2/3 complex-promoted branched actin polymerization is required for surface TCR maintenance via modulating the trafficking of TCR⁺ endosomes

Given that Jurkat T cells are bigger in size and have larger cytoplasm than primary T cells. To further assess the specific role of Arpc2 in T cells, we generated shRNA to stably silence Arpc2 in Jurkat T cells. Non-specific shRNA-transfected cells were used as a control. Arpc2 was efficiently deleted according to an analysis of mRNA and protein levels (Supplementary Fig. S5a,b). Consistent with the aforementioned data, we also detected lower surface TCR levels (Fig. 5a,b), implying that the TCR/CD3 complex were not efficiently trafficked to the plasma membrane and therefore resided in the cytoplasm³⁶. Surface TCR levels are regulated by TCR internalization and recycling from the intracellular endosomal pool¹⁰. We performed TCR internalization assay¹⁸ and found that TCR internalization was normal in Arpc2 KD Jurkat T cells (Fig. 5c). Next, we performed TCR receptor recycling assay by using an antibody-based assay to track the recycled TCRs that had been internalized from the plasma membrane following anti-CD3 mAb crosslink at 37 °C for 2 hours²⁰. As expected, FACS revealed that the Arpc2 KD Jurkat T cells showed limited TCR recycling back to the plasma membrane (Fig. 5d), indicating that TCR recycling was impaired in the absence of Arpc2. The sustained delivery of TCR⁺ endosomes has been shown to play a central role in maintaining constant surface TCR levels in T cells^{10, 16, 37}. Intriguingly, Arpc2 was spatially associated with the cytoplasmic TCR/CD3 complex, which resides in endosomes that can be labeled by EEA1 and Rab5 in Jurkat T cells using immunofluorescence assays (Fig. 5e). Thus, we presumed that Arp2/3 complex controls surface TCR maintenance in T cells by modulating the trafficking of TCR⁺ endosomes.

In agreement with previous studies that have shown that the Arp2/3 complex can nucleate branched actin filaments and promote actin cytoskeleton rearrangement, we found that Arpc2 KD Jurkat T cells produced fewer extended actin-rich lamellipodia in a TCR-stimulated spreading assay³⁸ (Supplementary Fig. S6a). We also visualized the architecture of the actin filaments network in unroofed Arpc2 KD Jurkat T cells using scanning electron microscopy (SEM). Arpc2 KD Jurkat T cells were much more sparsely coated with F-actin than were the controls after activation by anti-CD3 mAb (Supplementary Fig. S6b). Combined of these findings, we hypothesized that actin filaments nucleated by Arp2/3 complex might modulate the trafficking of TCR⁺ endosomes in T cells. To further evaluate whether Arp2/3 complex promoted actin filaments regulates TCR⁺ endosomes transport to the plasma membrane, we used 10 μM actin-depolymerization agent Cytochalasin D (cytD), which predominantly binds to actin filament barbed ends and compromises branched actin filaments generating³², to treat Jurkat T cells for 1 h. Similar to the previously described results, surface TCR levels were decreased following cytD treatment, but total TCR levels were equal (Fig. 5f,g). In accordance with aforementioned results, TCR internalization was only slightly lower (Fig. 5h) and only limited recycling of the TCRs that were internalized from the plasma membrane was observed after treatment with cytD (Fig. 5i). Altogether, these results indicate that Arp2/3 complex-nucleated actin filaments control TCR⁺ endosome trafficking to the plasma membrane to maintain constant surface TCR levels in resting state in T cells.

Arp2/3 complex-promoted branched actin polymerization modulates the polarization of TCR⁺ endosomes during immune synapse formation

Consistent with the aforementioned data in primary T cells, we also observed impaired immune synapse formation in Arpc2-deficient Jurkat T cells by using superantigen pulsed Raji B cells as APCs (Fig. 6a,b). We tracked the fate of internalized TCRs during immune synapse formation¹⁹. As expected, the internalized TCR⁺ endosomes were polarized at the T-APC contact region in control cells, whereas Arpc2 KD Jurkat T cells exhibited a disordered endosomal pattern (Fig. 6c,d). Moreover, we found that TCR resides in endosomes labeled with EEA1 or Rab5 or Rab11 failed to polarize towards T-APC contact region in Arpc2 KD Jurkat T cells compared with control cells (Fig. 6e-j). To further confirm that actin filaments directed TCR⁺ endosomal transport during immune synapse formation, we treated Jurkat T cells with cytD and found that the formation of immune synapse was also impaired and that TCR⁺ endosomes did not polarize to T-APC contact region (Fig. 6k,l). Together, these data indicate that Arp2/3 complex-promoted actin filaments are required for the polarization of TCR⁺ endosomes during immune synapse formation.

Reduced surface TCR expression but not impaired immune synapse formation accounts for compromised peripheral T cell homeostasis in Arpc2-TKO mice

Our aforementioned data demonstrate that Arpc2-TKO T cells exhibit lower surface TCR levels. Peripheral T cells obtained from OT-1 TCR transgenic (Tg) mice have a lower ratio of surface to total TCR than non TCR transgenic Ctrl mice (Fig. 7a,b), which indicated that surface TCR levels are much easier to get saturation in OT-1 TCR Tg T cells than non TCR Tg T cells. Thus, lower surface TCR levels requirements and higher total TCR expression in OT-1 TCR Tg T cells might weaken Arp2/3 complex mediated TCR translocation effect in maintaining surface TCR levels. So we generated Arpc2-TKO OT-1 TCR Tg mice and observed that surface TCR levels were restored in Arpc2-TKO OT-1 TCR Tg mice compared with Ctrl OT-1 TCR Tg mice (Fig. 7c,d). Intriguingly, the peripheral T cell populations could be restored to a great extent in both lymph nodes and spleen (Fig. 7e-h) and that the naïve T cells population was also restored (Fig. 7i,j). Moreover, the T cell homeostatic proliferation potential in Arpc2-TKO OT-1 TCR Tg mice was equal compared with Ctrl OT-1 TCR Tg mice by adoptive transfer assay (Fig. 7k). The signaling, proliferation and apoptosis was also similar (Supplementary Fig. S7a-e). However, peripheral T cells obtained from Arpc2-TKO OT-1 TCR Tg mice were still unable to form immune synapse (Fig. 7l,m). These results indicate that immune synapse is not necessary for T cell homeostasis. Collectively, these results lead us to conclude that the defective homeostasis observed in Arpc2-TKO T cells is mainly caused by reduced surface TCR levels and not impaired immune synapse formation.

Discussion

T cell homeostasis is essential for the functions of the adaptive immune system because it maintains a constant pool of peripheral T cells. This process is regulated by homeostatic signals that are initiated following the recognition of the self-peptide-MHC complex and IL-7 signals¹. Although TCR is important for T cell homeostasis and functions, how surface TCR levels is regulated and its biological significance on T cells remain largely unknown. In this study we explored the role of the actin-polymerized complex Arp2/3 in TCR trafficking and peripheral T cell homeostasis. We have demonstrated that Arp2/3 complex-nucleated actin filaments promote TCR⁺ endosomes movement to sustain homeostatic signaling by maintaining the constant cell surface level of TCR. Notably, such TCR levels but not immune synapse are essential for T cell homeostasis. Thus our study provides unique insights into the relationship among actin filaments-promoted TCR⁺ endosome trafficking, surface TCR maintenance and T cell homeostasis.

In recent years, TCR recycling has been shown to play a central role in maintaining surface TCR levels which mainly depends on the continuous delivery of the TCR/CD3 complex from an intracellular endosomal pool¹⁶. In our study we have demonstrated that Arp2/3 complex-promoted actin polymerization is essential to this process. As we have shown, TCRs are continuously internalized and recycled back to the plasma membrane¹⁰, thus proteins involved in vesicle docking and fusion may concentrate at particular areas underneath plasma membrane, where they form an “active zones”. Since actin filaments are located in “active zones”, they may also help to restrict and stabilize the proteins that are associated with endosomal transport in this area so as to facilitate the recycling TCR⁺ endosomes to plasma membrane. Matteoni et al. found that endosomes moved along microtubules and that this process was compromised by treatment with nocodazole³⁹. Gautreau et al. showed that WASH co-localized with endosomes in the NIH3T3 cell line⁴⁰. These findings also support the notion that the cytoskeleton plays a role in promoting endosomal TCR trafficking and that these biological processes could be important to T cells. Here we found that Arpc2 is spatially associated with TCR⁺ endosomes and that Arp2/3 complex-promoted actin polymerization is required for TCR⁺ endosomes trafficking to maintain the constant surface TCR levels. However, we have not determined whether TCR⁺ endosome movement also depends on crosstalk between microtubules and actin filaments.

An accumulating amount of evidence indicates that the recycled endosomal receptor pool is the source of the constitutive transfer of the TCR-CD3 complex to the plasma membrane. This pool enables T cells to rapidly upregulate surface TCR levels and to sustain TCR signals when they come into contact with antigens¹⁶. A number of other TCR signaling molecules, including LAT and Lck, also sustain TCR signaling as two pools: one that is plasma membrane associated and another that exists as an intracellular endosomal pool^{41, 42}. During antigen-induced immune synapse formation, microtubule-organizing center (MTOC) forms towards T-APC contact region and microtubules radiating from it set the track for directional transport of recycling TCRs⁴³. Actin filaments-promoted TCR⁺ endosomes trafficking is also important during the process of antigen induced T cell activation. Numerous TCR signaling molecules, such as VAV1, CDC42 and NPFs, drive the Arp2/3 complex mediated actin filaments nucleation after T cell activation³⁰. In this report, we have also demonstrated that TCRs resided in endosomes marked by EEA1, rab5 and rab11 are polarized towards immune synapse under the guidance of Arp2/3 complex-nucleated actin filaments. Thus, we presume that Arp2/3 complex-nucleated actin filaments direct TCR⁺ endosomes polarization to the immune synapse and maintain surface TCR levels, which further sustain TCR signals and strengthen immune synapse.

It has been established that naive T cell homeostasis relies on signals from self-peptide-MHC complexes. Previous study has found that the intense scanning of DCs by T cells in the absence of foreign is essential for T cell survival and function in steady state. Low-level TCR contact with self-antigens can promote T cell survival but is insufficient to induce their proliferation³⁴. However, the strength of TCR signals that is required for T cell homeostasis is largely unknown. Here we demonstrate that Arp2/3 complex nucleated-actin filaments could direct TCR⁺ endosome trafficking and thus maintain constant surface TCR levels, which is vital to T cell homeostatic signals. In this study, we found that the absolute number of CD8⁺ T cells in Arpc2-TKO OT-1 TCR Tg mice was partially rescued to levels similar to those in Ctrl OT-1 TCR Tg mice, while immune synapse formation remained impaired. These results indicate that homeostatic signals generated from the Arp2/3 complex promote the constant supply of surface TCR, but signals from immune synapses are not vital for T cell homeostasis.

We have also demonstrated that the role of the Arp2/3 complex in T cells is developmental independent in thymus. Peripheral T cells exhibit higher transcription level of Arpc2 than thymocytes, and Arp2/3 complex-promoted actin nucleation is essential for peripheral T cell homeostasis but does not affect T cell development in the thymus. In addition, peripheral T cells have a much longer life span about two months^{44, 45}, and they are harder to get close to scanning Dendritic cells (DC) pulsed with self-peptide. Whereas, thymocytes divide through developmental stages and they are near to self-peptide presented thymic stromal cells⁴⁶. We speculate that peripheral T cells may need such post-translational regulation of surface TCR levels more than thymocytes, that’s why actin filaments regulated TCR⁺ endosomes trafficking might not influence thymocytes development in thymus, but of great importance in peripheral T cells.

Hence, our data suggest a mechanism by which the actin filaments regulate T cell homeostasis via regulating TCR⁺ endosomes recycling to maintain surface TCR levels. Given the importance of the actin filaments to T cell functions, our data explore a new concept in which the constant TCR signal transduces from a self-peptide-MHC complex instead of forming a functional immune synapse is required for T cell homeostasis.

Methods

Mice

The C57BL/6 sperm with conditional deletion of Arpc2 alleles were ordered from the European Conditional Mouse Mutagenesis Program consortium as described³². Arpc2^fl/fl mice mated with FLP recombinase mice and then with Cd4-Cre transgenic mice. Cd4-Cre transgenic mice, OT-1 TCR transgenic mice, recombination-activating gene 1-deficient mice, and CD45.1 mice were obtained from The Jackson Laboratory. All mice were genotyped by PCR. Mice aged 5–8 weeks were used for experiments. All animal experiments were conducted in compliance with National Institutes of Health guidelines and were approved by the institutional animal care and use committee of the Shanghai Institutes for Biological Sciences (Chinese Academy of Sciences).

Antibody and reagents

For the flow cytometry analysis, anti-CD4 (GK1.5), anti-CD8α (53–6.7), anti-CD44 (IM7), anti-CD127 (A7R34), anti-CD69 (FN50), anti-Bcl-2 (BCL/10C4) were purchased from Biolegend. Anti-CD62L (MEL-14), anti-CD69 (H1.2F3), anti-CD5 (53–7.3), anti-CD45.1 (A20), anti-CD45.2 (104), mouse lgG1 κ isotype control (556027), anti-CD25 (PC61), Rat lgG2a isotype control (eBRG1) and purified anti-human-CD3 (OKT3) were purchased from BD Bioscience. Anti-Foxp3 (FJK-16s), anti-TCRβ (H57–597) and anti-CD3 (UCHT1) were purchased from eBioscience. Fluo-4,AM (F14217) was purchased from Invitrogen. Streptavidin (NEBN7021S) was purchased from Sigma.

For western analysis, anti-α-tubulin (sc-53029) and anti-Arp3 (sc15390) antibodies were purchased from Santa Cruz Biotechnology. Anti-Arpc2 (ab96779) was purchased from Abcam.

For immunofluorescence analysis, anti-Mouse TCR β-chain-488 (H57-597) and anti-Mouse CD3-488 (17A2) were purchased from Biolegend. Anti-CD3ζ (6B10.2) was purchased from Santa Cruz. Anti-EEA1 (C45B10), anti-Rab5 (C8B1) and anti-Rab11 (D4F5) were purchased from Cell Signaling Technology. Anti-LAMP1 (ab24170) was purchased from Abcam.

Cytochalasin D (ab143484) was purchased from Abcam. Staphylococcal enterotoxin E (ET404) was purchased from Toxin Technology. CELLTRACKER(TM) BLUE CMAC (C2110) was purchased from Invitrogen.

Cell lines and Jurkat T cells construction

For construction of knockdown Jurkat T cells, 293FT cells were co-transfected with indicated plasmids including: pLKO.1 shRNA, psPAX2 and pMD2.G. The lentiviral supernatants were harvested from cultured media 48 h after transfection. T cells maintained in RPMI-1640 were incubated in the lentiviral supernatants. Human Arpc2-target shRNA 5′-ACAUGGUGCUGAUGAGUUAUU-3′; scramble shRNAs AACAAGAUGAAGAGCACCAA; For construction of β-actin-mCherry or Arpc2-mCherry Jurkat T cells, 293FT cells were co-transfected with indicated plasmids including: β-actin-pHAGE-mCherry or Arpc2-pHAGE-mCherry, psPAX2 and pMD2.G.

Knockdown primary T cells construction

For construction of knockdown peripheral T cells, Plat-E cells were transfected with MLP shRNA plasmids, retrovirus supernatants were harvested 48 h after transfection. T cells were then incubated in media containing retrovirus supernatants and GFP positive cells were used for the indicated experiments after 72 h. Mouse Arpc2-target shRNA:5′-CAGTATTTCTTTGAAATTCTA-3′; A GFP positive cells-negative control was described⁴⁷.

Real-time RT-PCR

Total RNA was extracted and reverse-transcribed as done previously. The mRNA levels of the indicated genes were normalized to GAPDH by using real-time RT-PCR (Rotor gene 6000; Corbett Life Sciences) with a SYBR Green QPCR Master Mix (Toyobo). Primers were used for qPCR: Arpc2-human, 5′-AGACACAGACGCCGCTGTGGGT-3′ and 5′-GTGGTAGTGCAGATAGTCCCGG-3′; Arpc2-murine, 5′-AGACACAGATGCTGCTGTGGGT-3′ and 5′-GTGGTAGTGCAGATAGTCCCGG-3′; GAPDH-human, 5′-CCAGGTGGTCTCCTCTGACTTC-3′, 5′-GTGGTCGTTGAGGGCAATG-3′; GAPDH-murine, 5′-ACTCCACTCACGGCAAATTCA-3′, 5′-GCCTCACCCCATTTGATGTT-3′.

Electron microscopy

Control and Arpc2 KD Jurket T cells were added to 20 μg/ml OKT3 coated glass coverlip for 15 min, then the Jurket T cells were went through fixation, dehydration, embedding, critical point drying and conductive coating and viewed under FEI Quanta 250 scanning electron microscopy.

T-cell stimulation

For immune synapse formation, CMAC labeled SEE-pulsed Raji cells were incubated with Jurkat T cells for 5min⁴⁸. For confocal, T cells were sorted and incubated with anti-CD3 and anti-CD28 activator beads for 15min⁴⁹. For calcium flux assay, Naïve T cells were preloaded with Fluo4-AM and stained with anti-CD4, biotinylated anti-CD3 (10 μg/ml) and anti CD28 (10 μg/ml). Cells were washed and pre-warmed to 37 °C. After addition of streptavidin (20 μg/ml), Ca²⁺ mobility was measured by FACSAria II⁵⁰. For naïve T cell stimulation, T cells were stimulated with anti-CD3 and anti-CD28 activator beads.

TCR/CD3 complex recycling and internalization

Receptor recycling was determined by FACS as previously described²⁰. Briefly, Jurkat T cells were stained with anti-CD3 mAb on ice, washed and moved to 37 °C for 60 min, then acid-stripped to remove surface–bound mAb and shifted at 37 °C to allow recycling of internalized mAb-TCR/CD3 complex. The recycled Receptor-mAb complexes to plasma membrane were measured after staining with anti-mouse secondary antibody conjugated to Alexa Fluor 647. The data presented the percentage of the internalized TCR. For immunofluorescence analysis, T cells were stained with OKT3 at 37 °C for 2 h. After acid-stripping, cells were incubated with SEE-pulsed Raji cells for 15 min at 37 °C. For TCR internalization analysis¹⁸, cells were incubated on ice with anti-TCRβ-647 for 30 min, washed and incubated at 37 °C for indicated times. After acid-stripping, cells were analyzed by FACS.

Immunofluorescence microscopy

Cells were allowed to adhere to poly-L-Lysine-coated coverlips. Cells were then fixed with 4% (wt/vol) paraformaldehyde and permeabilized with permeabilization buffer (0.1% (vol/vol) triton X-100) in PBS, after blocking in 1%BSA in Tris-Buffered Saline and Tween 20 (TBST), cells were then stained with indicated primary antibodies and then incubated with indicated secondary antibodies. Slides were analyzed on Leica TCS SP8 and Olympus FV1200 confocal microscopy.

Adoptive Transfer of Naïve T Cells

The adoptive transfer of naïve T cells was done as previously described³³. The sorting naïve CD4⁺ and CD8⁺ T cells from 6- to 8-week-old Arpc2-TKO mice were mixed with equal number of T cells from CD45.1⁺ C57BL/6 control mice. After labeled with CFSE, 1 × 10⁶ cells were injected into tail vein to 6- to 8-week-old Rag1 ^−/− mice. Mice were sacrificed 7 days after transfer. CFSE dilution of Ctrl and Arpc2-TKO T cells in lymph nodes were measured by LSRII. All the FACS data were analyzed by FlowJo software.

Statistics

All experiments described were performed three or more times. Average values were expressed as mean ± S.D. The two-tailed unpaired Student’s t-test was used to determine statistical significance unless otherwise indicated.

References

Takada, K. & Jameson, S. C. Naive T cell homeostasis: from awareness of space to a sense of place. Nature reviews. Immunology 9, 823–832, doi:10.1038/nri2657 (2009).
Article CAS PubMed Google Scholar
Sun, H. et al. TIPE2, a negative regulator of innate and adaptive immunity that maintains immune homeostasis. Cell 133, 415–426, doi:10.1016/j.cell.2008.03.026 (2008).
Article CAS PubMed PubMed Central Google Scholar
Surh, C. D. & Sprent, J. Homeostasis of naive and memory T cells. Immunity 29, 848–862, doi:10.1016/j.immuni.2008.11.002 (2008).
Article CAS PubMed Google Scholar
Guo, F. et al. Coordination of IL-7 receptor and T-cell receptor signaling by cell-division cycle 42 in T-cell homeostasis. Proceedings of the National Academy of Sciences of the United States of America 107, 18505–18510, doi:10.1073/pnas.1010249107 (2010).
Article ADS CAS PubMed PubMed Central Google Scholar
Wojciechowski, S. et al. Bim/Bcl-2 balance is critical for maintaining naive and memory T cell homeostasis. J Exp Med 204, 1665–1675, doi:10.1084/jem.20070618 (2007).
Article CAS PubMed PubMed Central Google Scholar
Sprent, J. & Surh, C. D. Normal T cell homeostasis: the conversion of naive cells into memory-phenotype cells. Nat Immunol 12, 478–484, doi:10.1038/ni.2018 (2011).
Article CAS PubMed PubMed Central Google Scholar
Takeda, S., Rodewald, H. R., Arakawa, H., Bluethmann, H. & Shimizu, T. MHC class II molecules are not required for survival of newly generated CD4+ T cells, but affect their long-term life span. Immunity 5, 217–228 (1996).
Article CAS PubMed Google Scholar
Tanchot, C., Lemonnier, F. A., Perarnau, B., Freitas, A. A. & Rocha, B. Differential requirements for survival and proliferation of CD8 naive or memory T cells. Science 276, 2057–2062 (1997).
Article CAS PubMed Google Scholar
Smith-Garvin, J. E., Koretzky, G. A. & Jordan, M. S. T cell activation. Annual review of immunology 27, 591–619, doi:10.1146/annurev.immunol.021908.132706 (2009).
Article CAS PubMed PubMed Central Google Scholar
Geisler, C. TCR trafficking in resting and stimulated T cells. Critical reviews in immunology 24, 67–86 (2004).
Article CAS PubMed Google Scholar
Alcover, A. & Alarcon, B. Internalization and intracellular fate of TCR-CD3 complexes. Critical reviews in immunology 20, 325–346 (2000).
CAS PubMed Google Scholar
Dustin, M. L. & Depoil, D. New insights into the T cell synapse from single molecule techniques. Nature Reviews Immunology 11, 672–684, doi:10.1038/nri3066 (2011).
Article CAS PubMed PubMed Central Google Scholar
Dustin, M. L. & Groves, J. T. Receptor signaling clusters in the immune synapse. Annual review of biophysics 41, 543–556, doi:10.1146/annurev-biophys-042910-155238 (2012).
Article CAS PubMed PubMed Central Google Scholar
Alarcon, B., Mestre, D. & Martinez-Martin, N. The immunological synapse: a cause or consequence of T-cell receptor triggering? Immunology 133, 420–425, doi:10.1111/j.1365-2567.2011.03458.x (2011).
Article CAS PubMed PubMed Central Google Scholar
Campi, G., Varma, R. & Dustin, M. L. Actin and agonist MHC-peptide complex-dependent T cell receptor microclusters as scaffolds for signaling. J Exp Med 202, 1031–1036, doi:10.1084/jem.20051182 (2005).
Article CAS PubMed PubMed Central Google Scholar
Finetti, F., Onnis, A. & Baldari, C. T. Regulation of Vesicular Traffic at the T Cell Immune Synapse: Lessons from the Primary Cilium. Traffic 16, 241–249, doi:10.1111/tra.12241 (2015).
Article CAS PubMed Google Scholar
Martin-Cofreces, N. B., Baixauli, F. & Sanchez-Madrid, F. Immune synapse: conductor of orchestrated organelle movement. Trends in cell biology 24, 61–72, doi:10.1016/j.tcb.2013.09.005 (2014).
Article CAS PubMed Google Scholar
Finetti, F. et al. Intraflagellar transport is required for polarized recycling of the TCR/CD3 complex to the immune synapse. Nat Cell Biol 11, 1332–U1163, doi:10.1038/ncb1977 (2009).
Article CAS PubMed PubMed Central Google Scholar
Finetti, F. et al. The small GTPase Rab8 interacts with VAMP-3 to regulate the delivery of recycling T-cell receptors to the immune synapse. Journal of cell science 128, 2541–2552, doi:10.1242/jcs.171652 (2015).
Article CAS PubMed PubMed Central Google Scholar
Onnis, A. et al. The small GTPase Rab29 is a common regulator of immune synapse assembly and ciliogenesis. Cell death and differentiation 22, 1687–1699, doi:10.1038/cdd.2015.17 (2015).
Article CAS PubMed PubMed Central Google Scholar
Kumar, A., Kremer, K. N., Dominguez, D., Tadi, M. & Hedin, K. E. G alpha 13 and Rho Mediate Endosomal Trafficking of CXCR4 into Rab11( + ) Vesicles upon Stromal Cell-Derived Factor-1 Stimulation. Journal of immunology 186, 951–958, doi:10.4049/jimmunol.1002019 (2011).
Article CAS Google Scholar
Mullins, R. D., Heuser, J. A. & Pollard, T. D. The interaction of Arp2/3 complex with actin: nucleation, high affinity pointed end capping, and formation of branching networks of filaments. Proceedings of the National Academy of Sciences of the United States of America 95, 6181–6186 (1998).
Article ADS CAS PubMed PubMed Central Google Scholar
Goley, E. D. & Welch, M. D. The ARP2/3 complex: an actin nucleator comes of age. Nature reviews. Molecular cell biology 7, 713–726, doi:10.1038/nrm2026 (2006).
Article CAS PubMed Google Scholar
Pollard, T. D. & Beltzner, C. C. Structure and function of the Arp2/3 complex. Current opinion in structural biology 12, 768–774 (2002).
Article CAS PubMed Google Scholar
Skau, C. T. & Waterman, C. M. Specification of Architecture and Function of Actin Structures by Actin Nucleation Factors. Annual review of biophysics 44, 285–310, doi:10.1146/annurev-biophys-060414-034308 (2015).
Article CAS PubMed Google Scholar
Weed, S. A. et al. Cortactin localization to sites of actin assembly in lamellipodia requires interactions with F-actin and the Arp2/3 complex. The Journal of cell biology 151, 29–40 (2000).
Article CAS PubMed PubMed Central Google Scholar
Abu Taha, A., Taha, M., Seebach, J. & Schnittler, H. J. ARP2/3-mediated junction-associated lamellipodia control VE-cadherin-based cell junction dynamics and maintain monolayer integrity. Molecular biology of the cell 25, 245–256, doi:10.1091/mbc.E13-07-0404 (2014).
Article PubMed Google Scholar
Rajan, A., Tien, A. C., Haueter, C. M., Schulze, K. L. & Bellen, H. J. The Arp2/3 complex and WASp are required for apical trafficking of Delta into microvilli during cell fate specification of sensory organ precursors. Nat Cell Biol 11, 815–824, doi:10.1038/ncb1888 (2009).
Article CAS PubMed PubMed Central Google Scholar
Kim, I. H. et al. Disruption of Arp2/3 Results in Asymmetric Structural Plasticity of Dendritic Spines and Progressive Synaptic and Behavioral Abnormalities. J Neurosci 33, 6081–6092, doi:10.1523/Jneurosci.0035-13.2013 (2013).
Article CAS PubMed PubMed Central Google Scholar
Billadeau, D. D., Nolz, J. C. & Gomez, T. S. Regulation of T-cell activation by the cytoskeleton. Nature reviews. Immunology 7, 131–143, doi:10.1038/nri2021 (2007).
Article CAS PubMed Google Scholar
Daugherty, K. M. & Goode, B. L. Functional surfaces on the p35/ARPC2 subunit of Arp2/3 complex required for cell growth, actin nucleation, and endocytosis. The Journal of biological chemistry 283, 16950–16959, doi:10.1074/jbc.M800783200 (2008).
Article CAS PubMed PubMed Central Google Scholar
Rotty, J. D. et al. Profilin-1 Serves as a Gatekeeper for Actin Assembly by Arp2/3-Dependent and -Independent Pathways. Dev Cell 32, 54–67, doi:10.1016/j.devcel.2014.10.026 (2015).
Article CAS PubMed Google Scholar
Ouyang, W., Beckett, O., Flavell, R. A. & Li, M. O. An essential role of the Forkhead-box transcription factor Foxo1 in control of T cell homeostasis and tolerance. Immunity 30, 358–371, doi:10.1016/j.immuni.2009.02.003 (2009).
Article CAS PubMed PubMed Central Google Scholar
Hochweller, K. et al. Dendritic cells control T cell tonic signaling required for responsiveness to foreign antigen. Proceedings of the National Academy of Sciences of the United States of America 107, 5931–5936, doi:10.1073/pnas.0911877107 (2010).
Article ADS CAS PubMed PubMed Central Google Scholar
Snapper, S. B. et al. Wiskott-Aldrich syndrome protein-deficient mice reveal a role for WASP in T but not B cell activation. Immunity 9, 81–91 (1998).
Article CAS PubMed Google Scholar
Piotrowski, J. T., Gomez, T. S., Schoon, R. A., Mangalam, A. K. & Billadeau, D. D. WASH knockout T cells demonstrate defective receptor trafficking, proliferation, and effector function. Molecular and cellular biology 33, 958–973, doi:10.1128/MCB.01288-12 (2013).
Article CAS PubMed PubMed Central Google Scholar
Finetti, F. & Baldari, C. T. Compartmentalization of signaling by vesicular trafficking: a shared building design for the immune synapse and the primary cilium. Immunological reviews 251, 97–112, doi:10.1111/imr.12018 (2013).
Article PubMed Google Scholar
Gomez, T. S. et al. HS1 functions as an essential actin-regulatory adaptor protein at the immune synapse. Immunity 24, 741–752, doi:10.1016/j.immuni.2006.03.022 (2006).
Article CAS PubMed PubMed Central Google Scholar
Matteoni, R. & Kreis, T. E. Translocation and clustering of endosomes and lysosomes depends on microtubules. The Journal of cell biology 105, 1253–1265 (1987).
Article CAS PubMed Google Scholar
Derivery, E. et al. The Arp2/3 activator WASH controls the fission of endosomes through a large multiprotein complex. Dev Cell 17, 712–723, doi:10.1016/j.devcel.2009.09.010 (2009).
Article CAS PubMed Google Scholar
Soares, H. et al. Regulated vesicle fusion generates signaling nanoterritories that control T cell activation at the immunological synapse. J Exp Med 210, 2415–2433, doi:10.1084/jem.20130150 (2013).
Article CAS PubMed PubMed Central Google Scholar
Bonello, G. et al. Dynamic recruitment of the adaptor protein LAT: LAT exists in two distinct intracellular pools and controls its own recruitment. Journal of cell science 117, 1009–1016, doi:10.1242/jcs.00968 (2004).
Article CAS PubMed Google Scholar
Hashimoto-Tane, A. et al. Dynein-driven transport of T cell receptor microclusters regulates immune synapse formation and T cell activation. Immunity 34, 919–931, doi:10.1016/j.immuni.2011.05.012 (2011).
Article CAS PubMed Google Scholar
Sprent, J. & Tough, D. F. Lymphocyte life-span and memory. Science 265, 1395–1400 (1994).
Article ADS CAS PubMed Google Scholar
von Boehmer, H. & Hafen, K. The life span of naive alpha/beta T cells in secondary lymphoid organs. J Exp Med 177, 891–896 (1993).
Article Google Scholar
Klein, L. & Kyewski, B. Self-antigen presentation by thymic stromal cells: a subtle division of labor. Current opinion in immunology 12, 179–186 (2000).
Article CAS PubMed Google Scholar
Jiang, H., Pritchard, J. R., Williams, R. T., Lauffenburger, D. A. & Hemann, M. T. A mammalian functional-genetic approach to characterizing cancer therapeutics. Nat Chem Biol 7, 92–100, doi:10.1038/Nchembio.503 (2011).
Article CAS PubMed Google Scholar
Gomez, T. S. et al. Dynamin 2 regulates T cell activation by controlling actin polymerization at the immunological synapse. Nat Immunol 6, 261–270, doi:10.1038/ni1168 (2005).
Article CAS PubMed Google Scholar
Park, S. G. et al. The kinase PDK1 integrates T cell antigen receptor and CD28 coreceptor signaling to induce NF-kappaB and activate T cells. Nat Immunol 10, 158–166, doi:10.1038/ni.1687 (2009).
Article CAS PubMed PubMed Central Google Scholar
Cao, Y. et al. LKB1 regulates TCR-mediated PLCgamma1 activation and thymocyte positive selection. The EMBO journal 30, 2083–2093, doi:10.1038/emboj.2011.116 (2011).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We thank Baojin Wu and Guoyuan Chen for the animal husbandry and Wei Bian for the support of cell sorting. This work was supported by National Basic Research Program of China (2013CB835300), National Natural Science Foundation of China (31530021, 31501193 and 31621003), Strategic Priority Research Program of the Chinese Academy of Sciences (XDB19000000), and the Youth Innovation Promotion Association of Chinese Academy of Sciences.

Author information

Ye Zhang and Hao Shen contributed equally to this work.

Authors and Affiliations

State Key Laboratory of Cell Biology, CAS Center for Excellence in Molecular Cell Science, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, 200031, China
Ye Zhang, Hao Shen, Haifeng Liu, Haiyun Feng, Yan Liu, Xiaoyan Zhu & Xiaolong Liu
University of Chinese Academy of Sciences, 320 Yue-Yang Road, Shanghai, 200031, China
Ye Zhang, Hao Shen, Haifeng Liu, Haiyun Feng, Yan Liu, Xiaoyan Zhu & Xiaolong Liu
School of Life Science and Technology, ShanghaiTech University, Shanghai, 200031, China
Haiyun Feng, Yan Liu & Xiaolong Liu

Authors

Ye Zhang
View author publications
You can also search for this author in PubMed Google Scholar
Hao Shen
View author publications
You can also search for this author in PubMed Google Scholar
Haifeng Liu
View author publications
You can also search for this author in PubMed Google Scholar
Haiyun Feng
View author publications
You can also search for this author in PubMed Google Scholar
Yan Liu
View author publications
You can also search for this author in PubMed Google Scholar
Xiaoyan Zhu
View author publications
You can also search for this author in PubMed Google Scholar
Xiaolong Liu
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Y.Z. and H.S. contributed equally to this work, and either has the right to list first. Y.Z. and H.S. designed, performed and analyzed the experiments. H.L. helped with mice construction and breeding. H.F., Y.L. and X.Z. helped with experiments. Y.Z., H.S. and X.L. prepared the manuscript. X.L. conceptualized the research and directed the study.

Corresponding author

Correspondence to Xiaolong Liu.

Ethics declarations

Competing Interests

The authors declare that they have no competing interests.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Supplementary information

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Zhang, Y., Shen, H., Liu, H. et al. Arp2/3 complex controls T cell homeostasis by maintaining surface TCR levels via regulating TCR⁺ endosome trafficking. Sci Rep 7, 8952 (2017). https://doi.org/10.1038/s41598-017-08357-4

Download citation

Received: 07 April 2017
Accepted: 11 July 2017
Published: 21 August 2017
DOI: https://doi.org/10.1038/s41598-017-08357-4

This article is cited by

Moderate static magnetic fields enhance antitumor CD8+ T cell function by promoting mitochondrial respiration
- Xiaoyan Zhu
- Yan Liu
- Qiwei Zhai
Scientific Reports (2020)
Unveiling the heterogeneity of NKT cells in the liver through single cell RNA sequencing
- Hao Shen
- Chan Gu
- Xiaolong Liu
Scientific Reports (2020)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.