Abstract
Recently, we reported that, in mice, hunger causes the autophagy-dependent release of a protein called “acyl-CoA-binding protein” or “diazepam binding inhibitor” (ACBP/DBI) from cells, resulting in an increase in plasma ACBP concentrations. Administration of extra ACBP is orexigenic and obesogenic, while its neutralization is anorexigenic in mice, suggesting that ACBP is a major stimulator of appetite and lipo-anabolism. Accordingly, obese persons have higher circulating ACBP levels than lean individuals, and anorexia nervosa is associated with subnormal ACBP plasma concentrations. Here, we investigated whether ACBP might play a phylogenetically conserved role in appetite stimulation. We found that extracellular ACBP favors sporulation in Saccharomyces cerevisiae, knowing that sporulation is a strategy for yeast to seek new food sources. Moreover, in the nematode Caenorhabditis elegans, ACBP increased the ingestion of bacteria as well as the frequency pharyngeal pumping. These observations indicate that ACBP has a phylogenetically ancient role as a ‘hunger factor’ that favors food intake.
Similar content being viewed by others
Introduction
Approximately 40% of the adult population of the United States is obese, and other countries follow the same trend or even attain higher proportions1,2. Logically, an entire industry proposes strategies for the behavioral, nutritional, and pharmacological treatment of obesity, a condition that nowadays is considered as a disease3, even before it leads to metabolic syndrome and entails co-morbidities including diabetes, non-alcoholic fatty liver, atherosclerosis, and cancer4. Nowadays, obesity can be considered as the epidemiologically most important risk factor for premature aging, causing a marked reduction in both health span and lifespan5,6,7,8,9.
In spite of an ever-expanding scientific literature, current knowledge on the pathogenesis of excessive appetite is limited, and research performed in rodents has not been translated to human obesity. Thus, the first appetite-controlling hormone that has been characterized in mice, leptin10, is usually overabundant in obese persons, leading to the proposal of a “leptin resistance” that would account for the obesity-related hyperphagy11,12. Only a handful of obese patients bear genetic aberrations in leptin and its receptors that are equivalent to those encountered in Ob/Ob and Db/Db mice, which lack leptin or its receptor, respectively13,14,15. Similarly, a major appetite-stimulating hormone, ghrelin16, is paradoxically low in obese individuals17,18.
Recently, we identified acyl-CoA-binding protein (ACBP), also known as diazepam binding inhibitor (DBI), as a novel appetite stimulating factor19. Indeed, plasma concentrations of ACBP are elevated in obese patients, as well as in mice that were rendered obese by a high-fat diet or that became obese on a normal diet due to the Ob/Ob mutation. Neutralization of ACBP by suitable antibodies reduced multiple obesity-related aberrations including increased nutrient uptake, stimulated lipo-catabolism (lipolysis, triglyceride breakdown, fatty acid oxidation, and conversion of glycerol into glucose) and suppressed lipo-anabolism, thus reducing body weight, adiposity, diabetes, and steatosis. These findings could be recapitulated by inducible knockout of the Dbi gene. Thus, in contrast to the leptin and ghrelin systems, ACBP appears to play a convergent (rather than divergent) role in the obesity-associated hyperphagy of humans and rodents19.
ACBP is a small (13 kDa), phylogenetically conserved protein (Supplemental Fig. 1) that can be found in some eubacteria as well as all three eukaryotic kingdoms (plants, fungi and animals), meaning that it is more ancestral than leptin and ghrelin20,21. ACBP has the peculiarity to be secreted as a leaderless protein through a non-conventional (Golgi-dependent) pathway that depends on autophagy22,23,24. In human and mouse cells, ACBP also regulates autophagy. Both the depletion of intracellular ACBP and its addition to the extracellular milieu inhibit autophagy, suggesting that the autophagy-related translocation of ACBP from the intracellular to the extracellular compartment acts as a feedback control system to limit autophagy19.
Here, we investigated the possibility that ACBP would act as phylogenetically conserved regulator of autophagy and appetite in two model systems; namely, in the yeast Saccharomyces cerevisiae (that undergoes sporulation to seek new food sources) and the nematode Caenorhabditis elegans (which can actively search for food and accelerate pharyngeal pumping). We show that ACBP plays an evolutionarily ancient role in appetite control.
Results
Opposed autophagy-regulatory effects of ACBP in unicellular and multicellular organisms
Knockout of S. cerevisiae ACB1 (the yeast of ACBP) inhibited autophagy during chronological aging (Fig. 1a–e), although this knockout did not affect maximum autophagy stimulated by rapamycin (Fig. 1f) or nitrogen starvation (Fig. 1g), as determined by assessing the proteolysis of green fluorescent protein (GFP) fused to autophagy-related gene 8 protein (GFP-Atg8) to free GFP detectable by immunoblot (Fig. 1a, b), the enzymatic activity of alkaline phosphatase (ALP) Pho8 (Fig. 1c, f, g), or the redistribution of a GFP-Atg8 to the yeast vacuole detectable by fluorescence microscopy (Fig. 1d, e). Thus, in yeast, Acb1 acts as a facilitator of autophagy.
In sharp contrast, knockout of C. elegans acbp-1 (the nematode orthologous of ACBP), alone or together with several homologs acbp-3, acbp-4 and/or acbp-6 (which exist in this species but not in yeast nor in mammals)25, stimulated autophagy, as indicated by the subcellular redistribution of a GFP::LGG-1 fusion protein (LGG-1 is the nematode orthologous of yeast Atg8 and mammalian LC3) to cytoplasmic puncta (Fig. 2a, b) and the concomitant decrease of SQST-1/p62::GFP (the nematode orthologous of mammalian SQSTM1 fused to GFP) puncta (Fig. 2c, d). Knockdown of daf-2 (the insulin/insulin growth factor 1 receptor) which induces autophagy26 also decreased SQST-1/p62::GFP puncta, while knockdown of bec-1 (the nematode orthologous of mammalian BECN1) robustly increased them, proving that this reporter can be reliably utilized for measuring autophagic flux (Fig. 2c, d). Twelve hours of starvation led to a similar decrease of SQST-1::GFP particles in control animals and acbp-1;3 and acbp-4;6 knockout worms (Fig. 2e). Of note the increase in autophagy induced by deletion of acbp genes was partially reduced by mutation of aak-2 (an orthologous of human PRKAA1 and PRKAA2, which encode subunits of AMP activated kinase, AMPK) which is implicated in autophagy induction via ULK-1 phosphorylation27. However, knockdown of acbp genes was unable to induce a further increase in autophagy in daf-2 mutants (which lack a functional insulin/insulin growth factor 1 receptor) (Supplemental Fig. 2). Thus, in nematodes, acbp genes act as endogenous inhibitors of autophagy.
This discrepancy between yeast and worms suggests that ACBP might have distinct autophagy-regulatory functions in unicellular vs. multicellular systems.
Convergent effects of ACBP depletion on feeding behavior in yeast and nematodes
In the next step, we determined whether the effect of ACBP on feeding behavior is phylogenetically conserved.
Yeast is devoid of ameboid movement, and the only possibility for this organism to seek new sources of nutrients consists in sporulation, which occurs in response to prolonged exhaustion of external resources28. The knockout of S. cerevisiae ACB1 (∆acb1) led to a defect in sporulation and this sporulation defect of ∆acb1 cells was blunted by adding recombinant yeast Acb1 (yAcb1) protein to the cultures (Fig. 3a, b), confirming that Acb1 stimulates sporulation. To investigate possible non-cell-autonomous effects of ACBP on sporulation, we co-cultured WT Hho1-mCherry tagged cells (which emits a red fluorescence) with ∆acb1 Hho1-GFP cells (expressing green fluorescent protein (GFP)). As controls these fluorescent protein tagged strains were co-cultured with respective non-fluorescent variants. This procedure revealed that ∆acb1 yeast co-cultured with ∆acb1 yeast cells exhibit a sporulation defect that is attenuated in the presence of WT cells (Fig. 3c). Thus, the sporulation defect of ∆acb1 cells could not only be partially rescued by adding recombinant yAcb1 protein to the cultures but was also blunted by co-culturing the cells with Acb1-expressing yeast cells (Fig. 3a–c), confirming that Acb1 stimulates sporulation. Finally, the rescue of the sporulation defect by Acb1 protein depended on Ste3 (but not Ste2), which is one of the two G protein-coupled receptors encoded by the yeast genome (Fig. 3d). These results indicate that extracellular Acb1 protein can act on Ste3 receptors to stimulate sporulation in yeast.
Next, we turned to the nematode model. In C. elegans, knockout of one or several genes coding for ACBP orthologous (acbp-1, acbp-3, acbp-4, and/or acbp-6) reduced the uptake of bacteria expressing red fluorescent protein (RFP) both in ad libitum feeding conditions (Fig. 4a, b) and after 12 h of starvation and refeeding (Fig. 4c, d). This result was confirmed by the analysis of pharyngeal pumping, revealing that removal of acbp-1, acbp-3, acbp-4, and/or acbp-6 reduced food intake (Supplemental Fig. 3) in C. elegans. The generation of acbp-1(sv62);daf-2(e1370) double mutants revealed that the daf-2 mutation is epistatic to the acbp-1 mutation, since the acbp-1;daf-2 double mutants behave quite similarly to single daf-2 mutants in respect to feeding (Fig. 4e, f). These observations indicate that the worm orthologous of ACBP stimulate feeding behavior, as additionally corroborated by comparisons with tax-4(p678) mutants (Fig. S4A, B) or animals treated with clozapine (Fig. S4C, D). TAX-4 is a nucleotide-gated channel which is broadly expressed in the C. elegans nervous system and in ASI neurons which mediate satiety quiescence29,30, while clozapine is a second generation antipsychotic drug, which inhibits pharyngeal pumping of nematodes31. Of note, acbp-1(sv62) mutants seem more sensitive to clozapine administration compared to their wild-type counterparts (Fig. S4C, D).
Discussion
ACBP is an evolutionarily ancient protein, based on sequence alignments and structural similarities suggesting that the physicochemical properties of this protein have been conserved throughout the eukaryotic radiation20,21,32. The present data suggest that the function of ACBP as a regulator of appetite is phylogenetically conserved as well.
At a first level, knockout of the gene coding for the (single) ACBP orthologous from yeast reduces sporulation, while its addition in the form of a recombinant protein restores sporulation, presumably through an action on Ste3, which is one of the two signal-transducing receptors present in this species. Ste3, a seven transmembrane G protein-coupled receptor, is best known to for the peptide pheromone alpha1-factor33, the mating factor of yeast, pointing to an intriguing cross-talk between the signal transduction pathways involved in mating and in the control of food intake. At a second level, knockout of the genes coding for the (several) ACBP orthologous from C. elegans reduces the uptake of bacteria as it reduces the frequency of pharyngeal pumping. Together, these findings favor the contention that the appetite control function of ACBP is conserved throughout evolution. Indeed, these results echo a previous report on a gene named Anorexia (Anox) that codes for an acyl-CoA-binding protein with an ankyrin repeat domain and that, if mutated, reduces feeding activity and mouth hook movement (the fly equivalent of mastication) in Drosophila melanogaster34. That said, Anox has been involved in central appetite control because it is mostly expressed in the central nervous system and in ganglions, differing from mouse ACBP that has been attributed a predominantly peripheral role in appetite control19.
The effects of ACBP on autophagy appear to be distinct in yeast and in nematodes. Thus, removal of the ACBP orthologous from yeast inhibited autophagy during chronological aging, contrasting with the observation that, in C. elegans, deletion of ACBP orthologous resulted in enhanced autophagy. As a possibility, these seemingly contradictory results reflect the distinct cellular organization of these species (monocellular for yeast, multicellular for nematodes), as well as the differential effects of intracellular vs. extracellular ACBP on autophagy. Indeed, when (mostly intracellular) ACBP is depleted from cultured human cells by RNA interference, this results in autophagy inhibition. However, when (mostly extracellular) ACBP is neutralized by antibodies, this results in autophagy induction, both in cultured human cells and in mice19. Thus, removal of ACBP from S. cerevisiae might reflect a situation in which physiological effects are secondary to the depletion of intracellular ACBP, while removal of ACBP from C. elegans might reflect the effects of a reduction in extracellular ACBP.
Irrespective of the aforementioned uncertainties, it appears clear that ACBP plays a major appetite-stimulatory role throughout eukaryotic evolution, meaning that it triggers a range of different feeding behaviors in yeast (sporulation), nematodes (pharyngeal pumping), insects (mouth hook movement) and mammals (food intake). Since it operates independently from the leptin and ghrelin systems (which only exist in mammals)35,36, ACBP may indeed represent the phylogenetically most ancient “hunger factor”. In a plausible scenario, starvation causes autophagy, resulting in the release of ACBP from cells, and ACBP then acts on cell surface receptors to stimulate feeding behaviors. In this sense, ACBP would act as a neuroendocrine factor that participates in a primate homeostatic feedback loop or ‘hunger reflex’ designed to mitigate the effects of nutrient deprivation.
Materials and methods
C. elegans experiments
We followed standard procedures for maintaining C. elegans strains. The rearing temperature was set at 20 °C for all experiments. We used the DA2123: adIs2122 [plgg-1GFP::LGG-1+rol-6(su1006)] to measure LGG-1/LC-3 autophagic puncta and the HZ589: him-5(e1490)V;bpIs151 [psqst-1SQST-1::GFP+unc-76(+)] to measure SQST-1/p62 puncta as previously described27,37. The DA2123 strain was crossed with the SV62:acbp-1(sv62)I and the quadruple FE0017:acbp-1(sv62)I;acbp-6(tm2995)II;acbp-4(tm2896)III;acbp-3(sv73)X strains to monitor autophagy in the acbp family mutant genetic backgrounds25. For pharyngeal pumping measurements, the SV62 and FE0017 strains were compared with DA465: eat-2(ad465)II, a genetic model for reduced pharyngeal pumping, PR678: tax-4(p678)III and CB1370: daf-2(e1370)III mutants. The following strains were generated in the present study:
IR1780: acbp-1(sv62)I; adIs2122 [plgg-1GFP::LGG-1+rol-6(su1006)]
IR1792: acbp-1(sv62)I;acbp-6(tm2995)II;acbp-4(tm2896)III;acbp-3(sv73)X; adIs2122 [plgg-1GFP::LGG-1+rol-6(su1006)]
IR2686: acbp-1(sv62)I; daf-2(e1370)III.
Autophagy was measured as described in the literature38. For measuring LGG-1/LC-3 puncta, 10 well-fed adult worms of the respective genetic backgrounds were allowed to lay eggs on nematode growth medium or RNAi plates. Four hours later, parents were removed and plates were placed at 20 °C. 2.5 days later, synchronized animals were collected, anaesthetized with 10 mM levamisole and mounted on slides for microscopic examination. The number of GFP::LGG-1 positive autophagic puncta was counted in hypodermal seam cells at the late L3–L4 larval stages26.
Pharyngeal pumping was measured as previously described39. Grinder movements of free-moving animals were measured under the stereomicroscope. Three independent measurements were performed for each individual and the average number of pumps per animal was recorded. Starvation was performed by placing the animals on NGM plates without bacterial lawn for 12 h. For assessing food intake using fluorescent bacteria, we fed synchronized day one (D1) adult animals for 5 min with HT115 bacteria transformed with a IPTG-inducible RFP expressing plasmid (modification of a previous protocol published40). Upon this short feeding period, the animals were immediately immobilized with levamisole and mounted on slides for microscopic observation with a Zeiss AxioImager Z2 epifluorescence microscope. Image J software was used for the quantification of mean RFP intestinal fluorescence. Clozapine (Sigma-Aldrich, product number: C6305) was diluted in 100% ethanol (stock 11 mg/mL) and was added before pouring of NGM plates at a final concentration of 200 μg/mL per plate, as previously described31. Plates with solvent alone (1.8% ethanol per plate) were used for comparison. Synchronized animals at day 1 of adulthood were placed overnight (14–16 h) on clozapine or ethanol-containing plates to avoid undesired developmental effects which have been previously described31). Ingestion of RFP+ bacteria at day 2 adult animals was measured as described above.
The following sets of primers were used both for the construction of acbp RNAi constructs and the detection of acbp gene deletions:
acbp-1 FW: 5′-TTGCAGAATTTTGCGAGTTTC-3′
acbp-1 REV: 5′-AGAATTTATTTAGGCTCCGTACTTG-3′
acbp-3 FW: 5′-TTAGGTCAACAGCAGCAGCC-3′
acbp-3 REV: 5′-ACACACATAACTCACGCAATTCTGA-3′
acbp-4 FW: 5′-CGATTATTCTGTTTTAGAGTGTTTGA-3′
acbp-4 REV: 5′-GAAGTGCTCACGGAGTTGATT-3′
acbp-6 FW: 5′-ACGCCCCATAATAGTAAAAGATGC-3′
acbp-6 REV: 5′-AAACATTCCCCATTTCTCTATCTCTC-3′.
The respective genomic fragments were initially cloned in TOPO and then in pL4440 vector backbone in combinations to generate double acbp RNAi constructs (acbp-1 together with acbp-3 and acbp-4 with acbp-6).
S. cerevisiae experiments
Strains
Wild type S. cerevisiae strain L5366 (wild type, MATa/α ura3-52/ura3-52 in the Σ1278b strain background41, gift from Dr. A. H. Limper) and the double deletion strain L5366 Δacb1 (Δacb1::URA3/Δacb1::URA3) as well as Hho1 GFP-tagged or mCherry-tagged variants thereof (L5366 mCherry and L5366 Δacb1 GFP) were used. HHO1 codes for the Histone H1 protein. Analyses of autophagy in yeast were carried out in BY4742 (MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0) and respective ∆acb1 mutant obtained from EUROSCARF. Strains were grown at 28 °C on synthetic minimal medium containing 0.17% yeast nitrogen base (Difco), 0.5% (NH4)2SO4 and 30 mg/L of all amino acids (except 80 mg/L histidine, 120 mg/L lysine, and 200 mg/L leucine), 30 mg/L adenine and 320 mg/L uracil with 2% glucose. For chronological aging, cells were inoculated to OD600nm 0.1 from fresh overnight cultures and grown at 28 °C. Where indicated, cultures were supplemented with 40 nM rapamycin (AG Scientific; 1 mg/mL stock in DMSO) at the time point of inoculation. For nitrogen starvation, cells where grown to OD600nm 1 on synthetic minimal medium and then transferred to medium without amino acids and (NH4)2SO4.
Yeast strain construction
Deletions of ACB1 were made in the haploid variants after sporulation of L5366 following standard protocols with PCR generated cassettes using primers ACB1_fw (5′-GAAGACTAAAACTCTAAAATTAGTTAAACTAGTGTTTTCAGCAAAcagctgaagcttcgtacgc -3′) and ACB1_rev (5′-AAAGCTAGGCCAAAACTCCTTACATGGAGCTAGTATACCCCTTTTgcataggccactagtggatc-3′) and pUG72 (URA3 marker) as template42,43 Transformation was done using the lithium acetate method44. Deletion was verified by PCR (Primer ACB1_ctrl 5′-GTCTAGCAATTTGTGTAGGGACT and plasmid-corresponding control Primer42,45. The generated haploid knock-out strains were transformed with a mating vector for selection purposes—Mata with pIS419 and Matα with pIS420 (EUROSCARF46)—and mated. Selection of diploid strains was performed by plating on agar plates containing both clonNAT (100 µg/mL, Sigma = wrong Werner BioAgents) and Hygromycin (300 µg/mL, Sigma = wrong InvivoGen). Diploid strains were grown and transferred several times on YPD-medium to encourage plasmid loss and plated afterwards on YPD agar plates. Occurring colonies were tested on agar plates containing Hygromycin, clonNAT or both Hygromycin and clonNAT for loss of the respective plasmid. Deletion of STE2 or STE3 in this diploid acb1 deletion strain was done by linear transformation with PCR-generated cassettes using pFA6a-hphNT1 (Hygromycin) and pFA6a-natNT2 (clonNAT) as templates as described above (Primers: STE2_S1_fw:GTTACTTAAAAATGCACCGTTAAGAACCATATCCAAGAATCAAAAATGCGTACGCTGCAGGTCGAC; STE2_S2_rev: TCAAAATTTACGGCTTTGAAAAAGTAATTTCGTGACCTTCGGTATTTAA TCGATGAATTCGAGCTCG; STE2_ctrl: AGTGCTCGAATAGGTGTTGC; STE3_S1_fw: AGGCAATTAAAT TTGTGTAGGAAAGGCAAAATACTATCAAAATTTTCATGCGTACGCTGCAGGTCGAC; STE3_S2_rev: AA AATAAAATACTCCTAGTCCAGTAAATATAATGCGACACTCTTGTGTTAATCGATGAATTCGAGCTCG; STE3_ctrl: GTACCACATTGCCAGATTTATGA).
To follow sporulated cells during co-culturing, fluorescent tags (mCherry and GFP, respectively) were recombinated to the histone H1 gene (HHO1) in the haploid WT L5366 and Δacb1::URA3 strains following standard protocols with PCR generated cassettes using primers Hho1_S3_fw (5′-AAGGGCCCCTCCGGCATTATTAAACTAAACAAGAAGAAGGTCAAACTCTCCACGCGTACGCTGC-3′) and Hho1_S2_rv (5′-TTTGATAGTATTGCTATCACCATTGACATTCTCGTTTGGATATTCACTTTTTAATCGATGAATTCG-3′) and templates pFA6a 3mCherry-hphNT1 and pFA6a 3mCherry-natNT2 (for mCherry tag) or pYM12 and pYM25 (for GFP-Tag). Deletion was verified by PCR (Primer Hho1_ctrl 5′-AGCATGCCTCAACTTAATGAC-3′ and plasmid-corresponding control Primer47). The haploid strains were mated afterwards and selected on agar plates containing Hygromycin and Geneticin or ClonNat, respectively.
Autophagy measurement in yeast
Autophagy was analyzed using two different approaches: Alkaline phosphatase (ALP) activity was determined as previously described47. Briefly, cells were transformed with and selected for stable insertion of a pTN9 HindIII fragment containing an engineered construct of PHO8 which codes for a protein that lacks its N-terminal transmembrane domain (Pho8pΔN60). ALP activity was measured at indicated days of chronological aging using 1 µg of total protein as determined via BioRad protein assay (BioRad). In order to correct for intrinsic (background) ALP activity, respective strains without pTN9 insertion were simultaneously processed and obtained values were subtracted as background. In addition, autophagy was monitored using cells equipped with a pUG36-URA plasmid coding for a GFP-Atg8 fusion protein as previously described48. At day 2 of chronological aging, cells were counterstained with 0.1 µg/mL propidium iodide (PI) to exclude dead cells and analyzed for GFP-Atg8 localization via fluorescence microscopy using small-band eGFP and DsRed filters (Zeiss) on a Zeiss Axioskop microscope. To monitor GFP liberation indicative of autophagic vacuolar breakdown of GFP-Atg8, cells were subjected to chemical lysis followed by SDS-PAGE and western blot using standard protocols49. Blots were probed with anti-GFP (Roche, #11814460001) and anti-glyceraldehyde 3-phosphat dehydrogenase (GAPDH; gift from Sepp Kohlwein, University of Graz) antibodies and the respective peroxidase-conjugated secondary antibodies (Sigma). Densitometric quantification was performed with Image Lab 5.2 Software (Bio-Rad). Quantification and statistical analysis: Micrographs of cells expressing GFP-Atg8 were manually counted, and 500–650 cells were evaluated per strain and per experiment. Thereby, cells displaying clear vacuolar GFP fluorescence were scored as autophagic cells and were depicted as percentage of viable (PI negative) cells. Data represents mean of five independent experiments. Densitometric quantification of immunoblots was performed with Image Lab 5.2 Software (Bio-Rad), and the ratio Free GFP/GAPDH was plotted. Data represent mean ± SEM of four independent experiments. Data showing ALP activity represent mean ± SEM of three independent experiments. Statistical analyses were performed using Students T-test (one-tailed, unpaired), with *p < 0.05, **p < 0.01, and ***p < 0.001.
Sporulation assay
For sporulation experiments all strains (L5366 and acb1 deletion variant) were grown 21–22 h over night in 2 mL YPD medium containing 1% yeast extract, 2% peptone and 2% glucose at 28 °C. Afterwards, the strains were inoculated to an OD600 of 0.3 in 2 mL pre-sporulation YPA medium containing 1% yeast extract, 2% peptone and 3% Potassium acetate50 and +/− 2 µg/mL final concentration of yAcb1 (recombinant S. cerevisiae Acyl-CoA-binding protein (acb1) from Mybiosource) at 28°. After 18–22 h cells were washed twice with 500 µL ddH2O and shifted to an OD600 of 0.5 in 2 mL high carbon (HC) sporulation medium (0.2% raffinose, 1% potassium acetate) and +/− 2 µg yAcb1/mL and grown at 25 °C for 3 days.
For sporulation co-culturing experiments with Hho1-fluorescent-tagged strains, cultures were grown 21–22 h over night in YPD medium at 28 °C, like above. Then strains were mixed to an OD600 of 0.15 each, in pre-sporulation medium YPA at 28 °C. Hho1-GFP-tagged L5366 Δacb1::URA3/Δacb1::URA3 strains were mixed with Hho1-mCherry-tagged WT-strains and L5366 Δacb1::URA3/Δacb1::URA3 strain, respectively. Correspondingly Hho1-mCherry-tagged WT-strain was also mixed with un-tagged WT-strains. After 18–22 h cells were washed twice with 500 µL ddH2O, shifted to an OD600 of 0.5 into 2 mL HC sporulation medium and grown at 25 °C for 3 days.
Microscopy studies
Microscopy was performed as previously described51 In short, for sporulation experiments with addition of yAcb1, cells were harvested after 3 days and stained with PI (0.1 µg/mL in 1×PBS).
Cells were viewed and documented by fluorescence microscopy with the use of a small-band dsRed filter (Zeiss) on a Zeiss Axioskop microscope. Sample images were taken with a Diagnostic Instruments camera (Model: SPOT 9.0 Monochrome-6), acquired and processed (coloring) using the Metamorph software (version 6.2r4, Universal Imaging Corp.) Subsequently, pictures were quantified by evaluating the amount of cells, which were sporulated, and the cells that were stained red (dead cells), relative to all pictured cells. At least 250–900 cells per strain per independent experiment were manually counted.
For sporulation co-culturing experiments with Hho1-tagged mCherry and GFP strains, cells were harvested after 3 days. Cells were viewed and documented by fluorescence microscopy with the use of a small-band eGFP and dsRed filter (Zeiss) on a Zeiss Axioskop microscope. Microscopy pictures were quantified by evaluating the amount of sporulated and un-sporulated cells of wild-type vs. acb1 deletion strains, compared to their respective mono-cultures. 250–900 cells per strain per experiment were manually counted. Data represent results of four independent experiments. Statistical analyses for sporulation experiments were performed using Students t-test (one-tailed, unpaired), with *p < 0.05, **p < 0.01, and ***p < 0.001.
Statistical analysis
Data are reported as the mean ± standard deviation (SD), mean ± standard error of the mean (SEM), or Box and whisker plots (mean, first and third quartiles, and maximum and minimum values) as specified. The number of independent data points (n) is indicated in the figure legends of the corresponding graphs or in the legends. For statistical analyses, p values were calculated by two-way ANOVA, one-way ANOVA with Tukey’s multiple comparisons test, two-tailed unpaired Student’s t-test, Wilcoxon matched pairs signed rank test, Pearson’s coefficients of correlation (R) or false discovery rate (FDR) as indicated (Prism version 7, GraphPad Software). Differences were considered statistically significant when p-values *(p < 0.05), **(p < 0.01), ***(p < 0.001) and n.s. = not significant (p > 0.1).
References
Swinburn, B. A. et al. The global syndemic of obesity, undernutrition, and climate change: the Lancet Commission report. Lancet 393, 791–846 (2019).
Jaacks, L. M. et al. The obesity transition: stages of the global epidemic. Lancet Diabetes Endocrinol. 7, 231–240 (2019).
Jarris, P. E. Obesity as disease: an opportunity for integrating public health and clinical medicine. J. Public Health Manage. Pract. 19, 610–612 (2013).
Nyberg, S. T. et al. Obesity and loss of disease-free years owing to major non-communicable diseases: a multicohort study. Lancet Public Health 3, e490–e497 (2018).
Sung, M. M. & Dyck, J. R. Age-related cardiovascular disease and the beneficial effects of calorie restriction. Heart Fail Rev. 17, 707–719 (2012).
Hohensinner, P. J. et al. Reduction of premature aging markers after gastric bypass surgery in morbidly obese patients. Obes. Surg. 28, 2804–2810 (2018).
Kroemer, G., Lopez-Otin, C., Madeo, F. & de Cabo, R. Carbotoxicity-noxious effects of carbohydrates. Cell 175, 605–614 (2018).
Jongbloed, F. et al. Effects of bariatric surgery on telomere length and T-cell aging. Int. J. Obes. https://doi.org/10.1038/s41366-019-0351-y (2019).
Lopez-Otin, C. & Kroemer, G. Decelerating ageing and biological clocks by autophagy. Nat. Rev. Mol. Cell Biol. 20, 385–386 (2019).
Halaas, J. L. et al. Weight-reducing effects of the plasma protein encoded by the obese gene. Science 269, 543–546 (1995).
Einerhand, M. P., Bakx, T. A. & Valerio, D. IL-6 production by retrovirus packaging cells and cultured bone marrow cells. Hum. Gene Ther. 2, 301–306 (1991).
Pan, W. W. & Myers, M. G. Jr Leptin and the maintenance of elevated body weight. Nat. Rev. Neurosci. 19, 95–105 (2018).
Montague, C. T. et al. Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 387, 903–908 (1997).
Clement, K. et al. A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature 392, 398–401 (1998).
Farooqi, I. S. et al. Effects of recombinant leptin therapy in a child with congenital leptin deficiency. N. Engl. J. Med. 341, 879–884 (1999).
Tschop, M., Smiley, D. L. & Heiman, M. L. Ghrelin induces adiposity in rodents. Nature 407, 908–913 (2000).
Tschop, M. et al. Circulating ghrelin levels are decreased in human obesity. Diabetes 50, 707–709 (2001).
Makris, M. C. et al. Ghrelin and obesity: identifying gaps and dispelling myths. A reappraisal. Vivo 31, 1047–1050 (2017).
Bravo-San Pedro, J. M. et al. Acyl-CoA-binding protein is a lipogenic factor that triggers food intake and obesity. Cell Metabol. 30, 754–767 (2019).
Burton, M., Rose, T. M., Faergeman, N. J. & Knudsen, J. Evolution of the acyl-CoA binding protein (ACBP). Biochem. J. 392, 299–307 (2005).
Faergeman, N. J. et al. Acyl-CoA binding proteins; structural and functional conservation over 2000 MYA. Mol. Cell Biochem. 299, 55–65 (2007).
Manjithaya, R., Anjard, C., Loomis, W. F. & Subramani, S. Unconventional secretion of Pichia pastoris Acb1 is dependent on GRASP protein, peroxisomal functions, and autophagosome formation. J. Cell Biol. 188, 537–546 (2010).
Duran, J. M., Anjard, C., Stefan, C., Loomis, W. F. & Malhotra, V. Unconventional secretion of Acb1 is mediated by autophagosomes. J. Cell Biol. 188, 527–536 (2010).
Kwon, H. S. et al. Analysis of an acyl-CoA binding protein in Aspergillus oryzae that undergoes unconventional secretion. Biochem. Biophys. Res. Commun. 493, 481–486 (2017).
Elle, I. C. et al. Tissue- and paralogue-specific functions of acyl-CoA-binding proteins in lipid metabolism in Caenorhabditis elegans. Biochem. J. 437, 231–241 (2011).
Melendez, A. et al. Autophagy genes are essential for dauer development and life-span extension in C. elegans. Science 301, 1387–1391 (2003).
Egan, D. F. et al. Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science 331, 456–461 (2011).
Zaman, S., Lippman, S. I., Zhao, X. & Broach, J. R. How Saccharomyces responds to nutrients. Annu Rev. Genet. 42, 27–81 (2008).
Komatsu, H., Mori, I., Rhee, J. S., Akaike, N. & Ohshima, Y. Mutations in a cyclic nucleotide-gated channel lead to abnormal thermosensation and chemosensation in C. elegans. Neuron 17, 707–718 (1996).
Gallagher, T., Kim, J., Oldenbroek, M., Kerr, R. & You, Y. J. ASI regulates satiety quiescence in C. elegans. J. Neurosci. 33, 9716–9724 (2013).
Karmacharya, R. et al. Clozapine interaction with phosphatidyl inositol 3-kinase (PI3K)/insulin-signaling pathway in Caenorhabditis elegans. Neuropsychopharmacology 34, 1968–1978 (2009).
Ozenne, V. et al. Exploring the minimally frustrated energy landscape of unfolded ACBP. J. Mol. Biol. 426, 722–734 (2014).
Wira, C. R. & Sandoe, C. P. Effect of uterine immunization and oestradiol on specific IgA and IgG antibodies in uterine, vaginal and salivary secretions. Immunology 68, 24–30 (1989).
Ryuda, M. et al. Identification of a novel gene, anorexia, regulating feeding activity via insulin signaling in Drosophila melanogaster. J. Biol. Chem. 286, 38417–38426 (2011).
Londraville, R. L., Prokop, J. W., Duff, R. J., Liu, Q. & Tuttle, M. On the molecular evolution of leptin, leptin receptor, and endospanin. Front. Endocrinol. 8, 58 (2017).
Hewes, R. S. & Taghert, P. H. Neuropeptides and neuropeptide receptors in the Drosophila melanogaster genome. Genome Res. 11, 1126–1142 (2001).
Kang, C., You, Y. J. & Avery, L. Dual roles of autophagy in the survival of Caenorhabditis elegans during starvation. Genes Dev. 21, 2161–2171 (2007).
Palmisano, N. J. & Melendez, A. Detection of autophagy in Caenorhabditis elegans using GFP::LGG-1 as an autophagy marker. Cold Spring Harb. Protoc. 2016, pdb prot086496 (2016).
Keane, J. & Avery, L. Mechanosensory inputs influence Caenorhabditis elegans pharyngeal activity via ivermectin sensitivity genes. Genetics 164, 153–162 (2003).
You, Y. J., Kim, J., Raizen, D. M. & Avery, L. Insulin, cGMP, and TGF-beta signals regulate food intake and quiescence in C. elegans: a model for satiety. Cell Metab. 7, 249–257 (2008).
Kottom, T. J., Kohler, J. R., Thomas, C. F. Jr., Fink, G. R. & Limper, A. H. Lung epithelial cells and extracellular matrix components induce expression of Pneumocystis carinii STE20, a gene complementing the mating and pseudohyphal growth defects of STE20 mutant yeast. Infect. Immun. 71, 6463–6471 (2003).
Gueldener, U., Heinisch, J., Koehler, G. J., Voss, D. & Hegemann, J. H. A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Res. 30, e23 (2002).
Guldener, U., Heck, S., Fielder, T., Beinhauer, J. & Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. 24, 2519–2524 (1996).
Gietz, R. D., Schiestl, R. H., Willems, A. R. & Woods, R. A. Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11, 355–360 (1995).
Sheff, M. A. & Thorn, K. S. Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast 21, 661–670 (2004).
Sadowski, I., Lourenco, P. & Parent, J. Dominant marker vectors for selecting yeast mating products. Yeast 25, 595–599 (2008).
Janke, C. et al. A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast 21, 947–962 (2004).
Eisenberg, T. et al. Induction of autophagy by spermidine promotes longevity. Nat. Cell Biol. 11, 1305–1314 (2009).
Madeo, F. et al. A caspase-related protease regulates apoptosis in yeast. Mol. Cell 9, 911–917 (2002).
Eastwood, M. D., Cheung, S. W., Lee, K. Y., Moffat, J. & Meneghini, M. D. Developmentally programmed nuclear destruction during yeast gametogenesis. Dev. Cell 23, 35–44 (2012).
Ruckenstuhl, C. et al. Lifespan extension by methionine restriction requires autophagy-dependent vacuolar acidification. PLoS Genet. 10, e1004347 (2014).
Acknowledgements
The authors thank Dr. Nils J. Færgeman for kindly providing the SV62 and FE0017 C. elegans strains, Dr. Andrew H. Limper for kindly providing the L5366 S. cerevisiae strain as well as C. Ploumi for worm maintenance during the revision process. G.K. is supported by the Ligue contre le Cancer (équipe labelisée); Agence National de la Recherche (ANR)—Projets blancs; Cancéropôle Ile-de-France; Chancelerie des universités de Paris (Legs Poix); the European Research Council (ERC); Fondation Carrefour; Institut National du Cancer (INCa); Inserm (HTE); Inserm Transfert; Institut Universitaire de France; LeDucq Foundation; the LabEx Immuno-Oncology; the RHU Torino Lumière, the Seerave Foundation; and the SIRICs SOCRATE and CARPEM). S.B. is supported by the Swedish Research Council Vetenskapsrådet, the Austrian Science Fund FWF (P27183-B24) and Olle Engkvist Stiftelse; F.M. by Austrian Science Fund FWF (Grants P23490-B20, P29262, P24381, P29203, P27893), DKplus Metabolic and Cardiovascular Diseases (W1226), Austrian Science Ministry, Karl-Franzens University of Graz (“Unkonventionelle Forschung” and “flysleep“), NAWI Graz and BioTechMed-Graz flagship project “EPIAge”. N.C. is supported by the project “BIOIMAGING-GR” (MIS5002755), which is implemented under the Action “Reinforcement of the Research and Innovation Infrastructure”, funded by the Operational Program “Competitiveness, Entrepreneurship and Innovation” (NSRF 2014–2020). Work in NT lab is supported by the European Research Council (GA695190-MANNA).
Author information
Authors and Affiliations
Corresponding authors
Ethics declarations
Conflict of interest
J.M.B.S.P. and G.K. filed a patent application dealing with targeting the ACBP/DBI system in anorexia, obesity and co-morbidities. G.K. filed additional patent applications dealing with caloric restriction mimetics (autophagy inducers) for the treatment of aging, age-related diseases, cancer, obesity and co-morbidities. G.K. is a scientific co-founder of Samsara Therapeutics and Therafast Bio. The remaining authors declare that they have no conflict of interest.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
These authors share senior co-authorship: José M. Bravo-San Pedro, Guido Kroemer
Edited by P. Agostinis
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Charmpilas, N., Ruckenstuhl, C., Sica, V. et al. Acyl-CoA-binding protein (ACBP): a phylogenetically conserved appetite stimulator. Cell Death Dis 11, 7 (2020). https://doi.org/10.1038/s41419-019-2205-x
Received:
Revised:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41419-019-2205-x
This article is cited by
-
Inhibition of acyl-CoA binding protein (ACBP) by means of a GABAARγ2-derived peptide
Cell Death & Disease (2024)
-
A distinct Acyl-CoA binding protein (ACBP6) shapes tissue plasticity during nutrient adaptation in Drosophila
Nature Communications (2023)
-
Local Structural Stability of the Acyl-Coenzyme A Binding Protein by ESR Spectroscopy
Applied Magnetic Resonance (2023)
-
An obesogenic feedforward loop involving PPARγ, acyl-CoA binding protein and GABAA receptor
Cell Death & Disease (2022)
-
TSPO protein binding partners in bacteria, animals, and plants
Journal of Bioenergetics and Biomembranes (2021)