In the version of this article initially published, a sentence in Step 49 read “Order the top and bottom oligonucleotides corresponding to hit shRNA sequences formatted as in the example below for the target site TTTCTTACTCACCCTAAGAACT”. The sentence has been corrected to replace 'target site' with 'guide sequence'. The error has been corrected in the HTML and PDF versions of the article.
Additional information
The online version of the original article can be found at 10.1038/nprot.2014.103
Rights and permissions
About this article
Cite this article
Kampmann, M., Bassik, M. & Weissman, J. Correction: Corrigendum: Functional genomics platform for pooled screening and generation of mammalian genetic interaction maps. Nat Protoc 10, 644 (2015). https://doi.org/10.1038/nprot0415-644d
Published:
Issue Date:
DOI: https://doi.org/10.1038/nprot0415-644d
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
