Main

Cardiovascular disease is the most frequent cause of death in the world, and bacterial and viral infections can cause the development of heart disease1,2,3. Infections with endemic picornaviruses, which are very frequent and cause common colds, diarrhea, encephalomeningitis and paralysis, may be triggers of heart disease and diabetes. Particularly notorious in this regard are coxsackieviruses, which are very contagious, positive-stranded RNA picornaviruses with a global occurrence2,3,4. The endemic coxsackievirus group B serotype 3 (CVB3), which is cytopathic for many mammalian cells, causes severe myocarditis, pancreatitis and meningitis in children, and sudden cardiac death in young adults. It has been estimated that at least 70% of the human population has come into contact with CVB3. CVB3 can be detected in the hearts of as many as 30–50% of patients with chronic dilated cardiomyopathy5,6 (DCM), a condition that often necessitates heart transplantation. These observations indicate that CVB3 infection is a principal trigger for chronic heart disease in humans. In addition, coxsackieviruses have been linked to diabetes.

Human CVB3 infections can be mimicked in mice using a human pathogenic CVB3 isolate7. CVB3-infected mice develop acute and very severe myocarditis, encephalomeningitis, hepatitis and pancreatitis, and either die of the acute cytopathic effects of the virus or recover from the acute infection but develop chronic DCM. The mouse disease closely mimics histopathological findings in human DCM patients, allowing the use of this model to make observations pertinent to humans. Both acute viral replication and disease chronicity are influenced by factors in the host8,9. However, the results of studies attempting to identify the host genetic factors that determine viral replication, susceptibility to acute disease and progression from acute viral infection to chronic heart disease have been equivocal. Moreover, no effective prophylaxis or treatment exists to combat coxsackievirus pathogenicity in vivo.

Here we show that the sarcoma (Src) family kinase p56lck is required for efficient CVB3 replication in T-cell lines and for viral replication and persistence in vivo. Infection of wild-type mice with human pathogenic CVB3 caused acute and very severe myo-carditis, meningitis, hepatitis, pancreatitis and chronic DCM, but mice lacking the p56lck gene were completely protected from CVB3-induced acute pathogenicity and chronic heart disease. Thus, our data show that Src family kinases have another, previously unknown function, and that p56lck is the essential host factor in controlling the replication and pathogenicity of CVB3.

P56 lck regulates CVB3 replication in human Jurkat T cells

After entering hosts through the alimentary tract, CVB3 infects and replicates in T and B cells and macrophages10,11. These immune cells provide a reservoir for viral RNA during acute and persistent infections10. Two surface receptors for CVB3 have been identified, both expressed on lymphocytes: the glycosylphosphatidyl inositol-linked surface glycoprotein CD55 (Genome Database designation, DAF; decay accelerating factor)12 and the immunoglobulin superfamily molecule coxsackievirus and adenovirus receptor13. Binding of CVB3 to the short consensus region 3 domain of CD55 is required for viral attachment and internalization, whereas coxsackievirus and adenovirus receptor serves as a membrane co-receptor for productive infection14.

As cross-linking of the short consensus region 3 of CD55 activates p56lck (ref. 15), we investigated whether p56lck was involved in CVB3 entry into the host cell. We infected normal and p56lck-deficient human Jurkat T-cell lines16 with CVB3 and assessed viral entry. CVB3 readily bound to its surface receptors on both p56lck−/− and p56lck+/+ Jurkat cells ( Fig. 1a). This binding was specific, as CVB3 did not bind to CD55− Molt4 T cells (Fig. 1a) and binding of CVB3 to normal or p56lck−/− Jurkat cells could be blocked with antibodies against CD55. The presence of CVB3 in the cytoplasm of both p56lck−/− and p56lck+/+ Jurkat T cells was demonstrated by PCR for the positive viral RNA strand ( Fig. 1b, top row) and by detection of the CVB3 core protein. Furthermore, CVB3-infected p56lck−/− Jurkat cells produced alpha interferon (IFN-α), albeit in smaller amounts than did CVB3-infected p56lck+/+ Jurkat cells (Fig. 1c); relative counts per minute (c.p.m.) for p56lck−/− Jurkat cells were 545 c.p.m. for glyceraldehyde phosphodehydrogenase (GAPDH) and 8,905 c.p.m. for IFN-α, and for p56lck+/+ Jurkat cells were 320 c.p.m. for GAPDH and 7,756 c.p.m. for IFN-α. Thus, CVB3 can enter human Jurkat T cells and trigger a cellular antiviral interferon response in the absence of p56lck.

Figure 1: p56lck regulates replication of CVB3 in human Jurkat T cells.
figure 1

a, Binding of CVB3 to specific receptors on Jurkat cells. Triplicate cultures of p56lck+/+ (▪) p56lck−/− (□) and CD45−/− (░) Jurkat T cells or Molt4 T cells (far right bar) were incubated with 35S-labeled CVB3. Data represent mean percentages (± s.d.) of membrane-bound CVB3 (one of five different experiments). Expression of CD55 and coxsackievirus and adenovirus receptor was similar for p56lck+/+, p56lck−/− and CD45−/− Jurkat cells (not shown). There is no CVB3 binding in Molt4 cells, which lack expression of the CVB3 receptor CD55. The differences in CVB3 binding between p56lck+/+, p56lck−/− and CD45−/− Jurkat cells are statistically not significant (P>0.05; ANOVA). b, Detection of positive and negative strands of the CVB3 genome in p56lck+/+ and p56lck−/− Jurkat cells. Cells (3×106) were left untreated (−) or were infected with 3×106 PFUs/ml CVB3 (+). After 24 h, positive- and negative-strand CBV3 sequences were detected in total RNA using RT–PCR. c, Induction of IFN-α in infected Jurkat T cells. T-cell lines (3×107 cells) were inoculated with 3×106 PFUs/ml CVB3. After 24 h of incubation, total RNA (15 μg) was assessed by northern blot analysis with a probe detecting IFN-α mRNA expression. Bottom, GAPDH mRNA expression in the same samples (control for sample loading). d, Detection of infectious CVB3. p56lck+/+, p56lck−/−, CD45−/− Jurkat cells and p56lck−/− Jurkat cells (3×106 cells/ml) reconstituted with wild-type p56lck (lck−/− + Lck) were inoculated in triplicate with 3×105 PFUs/ml CVB3. After 24 h, culture supernatants were analyzed for infectious CVB3 using standard plaque-forming assays in HeLa cells. Data represent mean PFU values (± s.d.) (one of five different experiments). P<0.001, lck+/+ and lck−/− + Lck compared with lck−/− and CD45−/− (ANOVA).

Full size image

CVB3 replicated in wild-type Jurkat cells, as demonstrated by the detection of the negative viral RNA strand (indicating the presence of viral replication intermediates; Fig. 1b, bottom row) and the recovery of high titers of infectious CVB3 from these cells (Fig. 1 d). In contrast, we detected no negative viral RNA strand (Fig. 1b) and recovered no infectious CVB3 ( Fig. 1d) in the absence of p56lck expression. The introduction of wild-type p56lck into p56lck−/− Jurkat cells restored viral replication and recovery of high titers of infectious CVB3 (Fig. 1d ). To further explore the role of p56lck in CVB3 replication, we infected Jurkat cells deficient in CD45 (Genome Database designation, Ptprc), a tyrosine phosphatase required for normal p56lck kinase activity17. CVB3 was able to bind to cell surface receptors (Fig. 1a) and penetrate into the cytoplasm of CD45−/− Jurkat cells but CVB3 replication was decreased in the absence of CD45 (Fig. 1d). Thus, efficient CVB3 replication in Jurkat cells depends at least partially on the p56lck tyrosine kinase activity. These results show that the Src family kinase p56lck is required for the replication of CVB3 in human T cells. The exact molecular mechanism by which p56lck regulates CVB3 replication needs to be determined.

P56 lck is essential for CVB3-mediated pathogenicity

To determine whether p56lck expression is important in CVB3 infections in vivo, we inoculated p56lck−/− mice18 with a human pathogenic CVB3 isolate19. In contrast to its effect on p56lck+/− mice, CVB3 infection of p56lck−/− littermates did not result in any disease or lethality (Fig. 2a). CVB3 infections in p56lck+/− mice led to acute and very severe myocarditis (Fig. 2b), pancreatitis (Fig. 2d), hepatitis (Fig. 2f) and meningoencephalitis. The histology of the hearts, livers, brains and pancreata of CVB3-infected p56lck−/− mice seemed normal at all times (Fig. 2c, e and g). We monitored the course of CVB3-mediated disease and viral replication in vivo in p56lck+/− and p56lck−/− littermate mice. In p56lck+/− mice, inoculation of CVB3 led to rapid infection of cells in spleen, brain, heart, pancreas and liver. We were able to isolate high titers of infectious CVB3 from these organs 4–10 days after the initial inoculation (Fig. 3a– d). Moreover, CVB3 persisted in the hearts of infected p56lck+/− mice for up to 42 days ( Fig. 3e). Although we were able to recover small amounts of infectious CVB3 from hearts, brains, pancreata and spleens of p56lck−/− mice 4 and 7 days after infection, infectious CVB3 was no longer detectable by 10 days after viral inoculation (Fig. 3a–e). Thus, p56lck is essential for CVB3 replication, CVB3 persistence and the pathogenesis of CVB3-mediated disease in vivo.

Figure 2: P56lck is essential for the pathogenesis of CVB3-mediated disease in vivo.
figure 2

a, Survival of CVB3-infected p56lck−/− mice. p56lck−/− mice (⋄; n=25) and p56lck+/− littermates (□; n=22) were inoculated with CVB3 and monitored for 30 d. p56lck+/− mice showed signs of severe systemic illness, including lethargy, ruffled coats and anorexia on days 3–15 after infection. p56lck−/− mice failed to show any signs of disease and had a 100% survival rate even at later times (more than 60 d after infection). Difference between survival curves at day 30: P<0.0001 (χ2 test). b–g, Histopathology of hearts (b and c), pancreata (d and e) and livers (f and g) of p56lck+/− mice (b, d and f) and p56lck−/− littermates (c, e and g) infected with CVB3; organ histology was evaluated with masson staining 7 d after infection. Data represent eight mice per group. There is extensive destruction and inflammation of heart tissue, exocrine and endocrine pancreas and liver parenchyma in p56lck+/− mice. Original magnifications, ×80 (b, c, f and g) and ×8 (d and e).

Full size image
Figure 3: Viral titers in p56lck−/− mice.
figure 3

a–d, Recovery of infectious CVB3 from spleens ( a), brains (b), hearts (c) and pancreata (d) of p56lck+/− (▪) and p56lck−/− ([square with a lot of small dots in it]) littermate mice, infected with CVB3. Viral titers were determined in triplicate from total organ homogenates using plaque assays on HeLa monolayers; n=5–6 mice per group analyzed for each time point. Data represent mean values of CBV3 PFUs per gram of tissue, to normalize for organ size. P<0.005, p56lck+/− compared with p56lck−/− at all time points (ANOVA). e, Detection of persistent CVB3 in vivo. P56lck+/− and p56lck−/− mice were infected with CVB3 and samples were obtained from mouse hearts 4, 10 and 42 d later (time, above gel). Positive-strand CBV3 RNA was detected in total tissue RNA using RT–PCR. GAPDH (bottom), control for sample loading. Data represent one of three different experiments.

Full size image

p56 lck expression in T cells is sufficient for CVB3 pathogenicity

Various host factors contribute to protection from viral pathogenicity in vivo (neutralizing antibodies, natural killer cells, interferons, T cells and others)2. Serum titers of neutralizing IgM antibodies against CVB3 and levels of IFN-α and IFN-β were similar in CVB3-infected p56lck−/− and p56lck+/− mice. In vivo depletion of natural killer cells in CVB3-infected p56lck−/− mice using antibodies against gangliotetraosylceramide did not result in exacerbation of disease, and there were no substantial changes in CVB3 replication or CVB3 titers in heart or spleen. Cytotoxic T-lymphocyte responses against CVB3 need to be determined in p56lck−/− mice. p56lck−/− mice have a defect in T-cell activation and decreased numbers of T cells in the blood and peripheral lymphoid organs18. To further elucidate the involvement of p56lck-expressing T cells in CVB3 disease pathogenesis, we generated chimeras in which wild-type T cells were transferred into p56lck−/− mice. After chimeric re-introduction of p56lck+/+ T cells into p56lck−/− mice, CVB3-mediated pathogenicity and the recovery of infectious CVB3 (Fig. 4) were restored to levels found in control littermate mice. These results indicate that expression of p56lck in T cells is an essential factor controlling the pathogenicity and replication of CVB3 in vivo.

Figure 4: p56lck expression in T cells is sufficient for CVB3 pathogenicity.
figure 4

Recovery of infectious CVB3 from spleens, brains, hearts and pancreata of p56lck+/+ (▪) and p56lck−/− (▒) mice and p56lck−/− mice reconstituted with p56lck+/+ T cells (░). Mice (6 weeks old; n=5 per group) were infected with CVB3. Data represent mean values of CBV3 PFUs per gram of tissue on day 4 after infection. P<0.01, p56lck+/+ and p56lck−/− mice reconstituted with wild-type T cells compared with p56lck−/− mice (ANOVA).

Full size image

Involvement of other Src family kinases and non-T cells

p56lck−/− mice have a defect in T-cell activation18. To determine if the resistance of p56lck−/− mice to CVB3-induced disease was due to a deficiency in activated T cells, we inoculate CBV3 into Cd4−/− mice, which lack Cd4+ T helper cells20, Cd8−/− mice, which lack Cd8+ cytotoxic lymphocytes21 and mice lacking the T-cell co-stimulatory receptor Cd28, which have a defect in T-cell activation22. CVB3-induced disease as well as replication and persistence of CVB3 in vivo were mostly independent of Cd4+ helper and Cd8+ cytotoxic T-cell subsets and independent of T-cell activation itself (as shown in Cd28−/− mice). These results show that not functional T cells themselves but p56lck is the essential factor that controls pathogenicity and replication of CVB3 in vivo. Thus, we analyzed CVB3 replication in other hematopoietic cell lines isolated from p56lck−/− mice. Whereas T and B cells expressed p56lck, macrophages and dendritic cells did not express p56lck, as determined by RT–PCR and western blot analysis. CVB3 replication was similar for p56lck+/+ and p56lck−/− dendritic cells and macrophages (Fig. 5a). However, CVB3 replication was partially reduced in p56lck−/− B cells (Fig. 5a). These results show that p56lck is important for CVB3 replication in B cells. However, CVB3 replication can occur in cells that normally do not express p56lck.

Figure 5: CVB3 infections in different cell types and p56lck−/−, Src−/− and Rag1−/− mice.
figure 5

a, CVB3 replication in p56lck+/+ and p56lck−/− dendritic cells (DCs; 1×105), B cells (5×105) and macrophages (Mø; 1×106). Purified cells were infected in triplicate with 5×105 PFUs CVB3 in the presence or absence of 2 μM PP2, and viral titers were determined 24 h after infection. P<0.05, p56lck+/+ B cells compared with p56lck−/− B cells (ANOVA). b, Survival curves of Rag1+/+ (□; n=21), Src−/− (⋄; n=15) and Rag1−/− (*; n=20) mice inoculated with CVB3 and monitored for 30 d. Day 30 survival: P<0.001, Rag1+/+ compared with Src−/−; P<0.0001, Rag1+/+ compared with Rag1−/− (χ2 test). c, Recovery of infectious CVB3 in the hearts of Rag1+/+ (▪; n=3), Src−/− (░; n=4) and Rag1−/− (□; n=4) mice infected with CVB3. Viral titers were determined from total heart tissue in triplicate using plaque assays. n.t., not tested. Data represent mean values of CBV3 PFUs per gram of tissue, to normalize for organ size. P<0.005 at day 7, Rag1+/+ or Src−/− mice compared with Rag1−/− mice, (ANOVA). d, Survival curves of p56lck+/− (□; n=12) and p56lck−/− (♦; n=15) mice inoculated with EMCV and monitored for 30 d after infection. Day 30 survival: P<0.005 (χ2 test).

Full size image

To further elucidate cellular requirements for CVB3 replication, we infected cells with CVB3 in the presence of a specific inhibitor of Src family kinase, PP2. The addition of PP2 decreased CVB3 replication in dendritic cells, B cells and macrophages (Fig. 5a), indicating that other Src family kinases can regulate CVB3 replication in these cells. The nature of this Src family kinase needs to be determined in genetic experiments. We excluded the possibility of essential involvement of the prototypical kinase Src, as Src−/− mice are very susceptible to CVB3 infections in vivo (Fig. 5b and c ). From our data it is evident that p56lck is the limiting and essential host factor that controls in vivo replication and pathogenicity of CVB3.

As p56lck is mainly expressed in T and B cells, one explanation for the protective effect of the p56lck mutation against CVB3 infection in vivo could be that CVB3 requires T and/or B cells for infection and a normal life cycle. To test this, we inoculated CVB3 into mice deficient in the recombination activation gene (Rag-1−/− mice), which completely lack T and B cells due to a defect in T- and B-cell receptor gene rearrangement23. Rag-1−/− mice remained very susceptible to CVB3 infection. All Rag-1−/− mice died after CVB3 inoculation (Fig. 5b), because of uncontrolled viral replication in the heart (Fig. 5c) and severe tissue damage. As-yet-unidentified immunomodulatory mechanisms in p56lck−/− mice could contribute to increased protection against CVB3.

p56 lck is not a general regulator of picornavirus pathogenicity

In contrast to their resistance to the picornavirus CVB3, p56lck−/− mice show a profound lack of anti-viral activity against viruses of other replicative classes, including vaccinia virus, lymphocytic choriomeningitis virus and vesicular stomatitis virus24. These viruses belong to different replicative classes: Lymphocytic choriomeningitis virus is an RNA arenavirus; vaccinia is a DNA-containing poxvirus; and vesicular stomatitis virus is an RNA rhabdovirus. To determine whether p56lck is required for infection by other picornaviruses, we inoculated p56lck−/− mice with encephalomyocarditis virus. Like CVB3, encephalomyocarditis virus is a picornavirus that causes acute myocarditis and encephalomyocarditis in mice25. p56lck−/− mice were very susceptible to encephalomyocarditis virus infections ( Fig. 5d) and were unable to clear the virus (data not shown). The fact that p56lck expression is required for CVB3 but not for encephalomyocarditis virus infection indicates that p56lck is not a general regulator of picornavirus pathogenicity.

p56 lck −/− mice are protected from chronic DCM

Viral persistence, chronic low-grade infections and autoimmune attacks ‘sparked’ by CVB3-induced damage to cardiomyocytes may be involved in the progression of acute disease to chronic DCM (refs. 26,27). Wild-type (data not shown) and p56lck+/− mice rapidly developed severe cardiomyopathy characterized by increased ratios of heart weight to body weight (Fig. 6a), thinning of ventricular walls and dilation of the ventricles (Fig. 6b) and considerable destruction of heart muscle (Fig. 6d). In contrast, CVB3-infected p56lck−/− mice had normal heart morphology and heart weight:body weight ratios (Fig. 6a, c and e). Whereas CVB3 persisted in the hearts of p56lck+/− mice, we did not detect virus in p56lck−/− heart muscle 10 and 42 days after the primary infection, as determined by PCR for positive-stranded CVB3 RNA in total heart tissue ( Fig. 3e). An increase in the number of CVB3 plaque-forming units (PFUs) to a viral load that leads to 100% lethality in wild-type mice still did not trigger acute or chronic disease in infected p56lck−/− mice. Thus, in the absence of p56lck, CVB3 can start to replicate in some organs and induce a low-grade infection. However, the specific expression of p56lck is necessary for efficient CVB3 replication to cause acute pathogenicity and for viral persistence in vivo to produce chronic dilated heart disease.

Figure 6: p56lck−/− mice are protected from chronic DCM.
figure 6

a, Ratios of heart weight to body weight. p56lck+/− (⋄) and p56lck−/− (□) mice were infected with CVB3. Data represent mean heart weight:body weight ratios (± s.d.) for at least three mice per group for each time point. The ratios of the p56lck+/− group were significantly higher (P<0.05) than those of p56lck−/− mice on days 4, 7, 10, 14 and 42 after infection (variance analysis using Neuman-Keul's statistics). There is a biphasic disease progression in p56lck+/− mice: The first phase is due to acute CBV3 cytopathicity and heart inflammation; the second phase is caused by chronic DCM (ref. 26). b–e, Heart histopathology of p56lck+/− (b and d) and p56lck−/− (c and e) mice infected with CVB3; hearts were analyzed on day 42 after infection. There is thinning of ventricular walls and enlargement of cardiac chambers ( b) and severe destruction of the heart muscle characterized by necrosis, fibrosis and cellular infiltration (d) that occurs in all infected p56lck+/− mice. p56lck−/− mice have normal heart morphologies and heart weight:body weight ratios. Original magnifications (and staining): ×4 (hematoxylin and eosin, midventricular regions; b and c) and ×40 (masson; d and e).

Full size image

Discussion

DCM is a common cause of progressive heart disease, heart failure, and sudden death and often necessitates heart transplantation. Infections are now thought to be involved in the pathogenesis of many heart diseases, and CVB3 has been epidemiologically linked as the most prevalent virus associated with DCM in humans2,3. Our study here has shown that the Src family kinase p56lck is the essential host factor required for the replication, persistence and pathogenicity of CVB3 in vivo. Mice lacking the p56lck gene were completely protected from CVB3-induced acute pathogenicity and chronic heart disease. These data therefore define a previously unknown function for Src family kinases in the pathogenesis of heart disease. Identification of p56lck as an essential regulator of CVB3 replication may allow the design of drugs that specifically interfere with the replication and persistence in vivo of this virus, avoiding the onset of acute myocarditis, pancreatitis and encephalitis in children, and preventing the development of CVB3-associated chronic heart diseases.

Methods

CVB3 binding assays and replication in vitro.

p56lck−/− and CD45−/− Jurkat T cells and Molt4 T cells have been described16,17 and were purchased from American Type Culture Collection (Rockville, Maryland). p56lck−/− Jurkat cells reconstituted with wild-type p56lck cDNA have been described16. B cells and dendritic cells from p56lck−/− and p56lck+/+ mice were purified by fluorescence-activated cell sorting (purity: more than 99% B220+ B cells and more than 98% CD11c+ dendritic cells). Macrophages were purified from the peritoneal cavity 4 d after intraperitoneal injection of thioglycolate. In all experiments, the CVB3 isolate Gauntt-Chow was used19. CVB3 was grown in HeLa cell monolayers, and infectious CVB3 released by multiple cycles of freezing and thawing was fractionated by sucrose gradient centrifugation. For viral binding, CBV3 was radiolabeled with 100 μCi 35S-methionine in methionine-free RPMI medium for 4 h. The radiolabeled virus (1×104 c.p.m.) was incubated with 1×107 T cells for 1 h at room temperature, after which cells were washed free of medium and excess labeled virus. The percentage of CVB3 bound was calculated as (c.p.m. of membrane-bound virus/c.p.m. of total CVB3 in medium before binding) ×100%. For the detection of viral RNA, IFN-α and infectious CVB3, cells were inoculated with CVB3 for 1 h at 37 °C, then washed and resuspended in RPMI medium containing 10% fetal bovine serum. PP2 (4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine), an inhibitor specific for the Src family kinase, was used according to the manufacturer's specifications (Calbiochem, La Jolla, California). At days 1, 2 and 5 after infection, cells were collected by centrifugation and the supernatants recovered for plaque assays. Plaque assays were done in triplicate according to established protocols on HeLa cell monolayers plated in six-well plates (Nunc, Rochester, New York).

Positive and negative strands of CVB3 RNA were identified in total cellular RNA by RT-PCR as described6. Total RNA (1 μg) was reverse-transcribed into cDNA using Superscript II (RNase H-negative; Life Technologies). The following primers were used: positive-strand, 5′–CACCGGATGGCCAATCCA–3′; negative-strand, 5′–GCGAAGAGTCTATTGAGCTA–3′. cDNA was analyzed for positive- and negative-strand CVB3 sequences using Taq Polymerase (Boehringer) and the primers 5′–GCGAAGAGTCTATTGAGCTA–3′ and 5′–CTCTCAATTGTCACCATAAGCAGCCA–3′. PCR products were analyzed on a 2% agarose gel and visualized using ethidium bromide. Amplification products were analyzed for specificity by cycle sequencing of gel-purified PCR products. The CVB3 control was transcribed CVB3 cDNA. For the detection of IFN-α mRNA, total RNA was isolated from infected cells, and 15 μg were separated by formaldehyde agarose gel electrophoresis followed by transfer to a nitrocellulose membrane; blots were hybridized to probes specific for IFN-α and GAPDH.

CVB3 infections in vivo.

Mutant mice with deletions of the p56lck, Src, Cd4, Cd8, Cd28 or Rag1 genes have been described18,20,21,22. Mice were back-crossed to an A/J (H2k/k) background (five generations) and a C57BL/6 background (ten generations). Littermate mice were used in all experiments. For CVB3 infection, mice 4 and 6 weeks old were inoculated intraperitoneally with 1×105 PFUs CVB3. For the generation of T-cell chimeras, p56lck+/+ T cells were purified using Dynal beads (purity, more than 98% Cd3+ T cells) and 1×107 T cells were transferred intraperitoneally into 4-week-old p56lck−/− hosts; these T-cell-chimeric mice were infected 10 days after T-cell transfer with CVB3 as described above. For EMCV infection, mice were inoculated intraperitoneally with 1×105 PFUs EMCV variant M (ref. 25). For lethality assessment, mice were monitored daily after initial infection. At different times, mice were killed and their organs were processed for histology and CVB3 detection. For histology, organs were fixed in 10% neutral buffered formalin, embedded in paraffin, and extensively sectioned at various levels. For detection of DCM, hearts were sectioned transversely at the mid-ventricular region. Sections were stained with hematoxylin and eosin and with masson blue. For detection of infectious CVB3 or EMCV, whole organs were weighed, homogenized with a polytron homogenizer and then subjected to three cycles of freezing and thawing to release the virus from the homogenates. CVB3 plaque assays were done on HeLa monolayers. EMCV titers were detected using plaque assays on BHK21 cells. CVB3 persistence was detected by RT–PCR of positive-stranded viral RNA using the primers and controls described above.