Abstract
The MRE11/RAD50/NBS1 complex is the primary sensor rapidly recruited to DNA double-strand breaks (DSBs). MRE11 is known to be arginine methylated by PRMT1 within its glycine-arginine-rich (GAR) motif. In this study, we report a mouse knock-in allele of Mre11 that substitutes the arginines with lysines in the GAR motif and generates the MRE11RK protein devoid of methylated arginines. The Mre11RK/RK mice were hypersensitive to γ-irradiation (IR) and the cells from these mice displayed cell cycle checkpoint defects and chromosome instability. Moreover, the Mre11RK/RK MEFs exhibited ATR/CHK1 signaling defects and impairment in the recruitment of RPA and RAD51 to the damaged sites. The MRKRN complex formed and localized to the sites of DNA damage and normally activated the ATM pathway in response to IR. The MRKRN complex exhibited exonuclease and DNA-binding defects in vitro responsible for the impaired DNA end resection and ATR activation observed in vivo in response to IR. Our findings provide genetic evidence for the critical role of the MRE11 GAR motif in DSB repair, and demonstrate a mechanistic link between post-translational modifications at the MRE11 GAR motif and DSB processing, as well as the ATR/CHK1 checkpoint signaling.
Similar content being viewed by others
Introduction
Protein arginine methylation results in the addition of one or two methyl groups to the guanidino nitrogen atoms of arginine 1. There are three main forms of methylated arginine identified in eukaryotes: ω-NG-monomethylarginines, ω-N′G,NG-asymmetric dimethylarginines and ω-NG,NG-symmetric dimethylarginines. There are nine protein arginine N-methylation enzymes (PRMTs) that catalyze the transfer of a methyl group from S-adenosylmethionine to a guanidino nitrogen of arginine 2. Arginines located within glycine-arginine-rich (GAR) motifs are preferred sites of methylation of several PRMTs including PRMT1 2, the predominant enzyme in mammalian cells, responsible for most of the asymmetrical arginine dimethylation reactions in human cells 3. PRMT1-null mice are embryonically lethal and contain numerous hypomethylated substrates 4. Using a conditional null PRMT1 allele in mice, it was shown that PRMT1-deficient mouse embryonic fibroblasts (MEFs) exhibit spontaneous DNA damage, chromosome instability, polyploidy and defective checkpoint activation following DNA damage 5. These findings highlight the importance of arginine methylation in the DNA damage response pathway and the maintenance of genomic stability. A large number of GAR motif-containing proteins were shown to be arginine methylated using candidate and proteomic approaches 6. These substrates are functionally involved in diverse intracellular processes from nuclear export and gene expression to DNA damage signaling 2.
The MRE11/Rad50/NBS1 (MRN) complex is the primary sensor rapidly recruited to DNA double-strand breaks (DSBs) 7, 8, 9. The MRN complex tethers the DNA ends 10, 11, leading to the recruitment and activation of the ATM kinase 12, 13. The MRN complex is also thought to participate in ATR-CHK1 kinase activation by facilitating DNA end resection 14, 15, 16, 17, 18. It participates in multiple downstream pathways for checkpoint signaling, DNA replication, telomere maintenance, non-homologous end joining and meiotic recombination 19, 20, 21, 22, 23, 24.
The in vivo function of the MRN complex has been revealed by hypomorphic alleles in human MRE11 and NBS1, leading to ataxia-telangiectasia-like disorder (ATLD) and Nijmegen breakage syndrome (NBS), respectively 25, 26. These disorders share characteristic features including hypersensitivity to ionizing radiation, immunodeficiency and an increased predisposition to the development of malignancies 27. The in vivo deletion of components of the MRN complex is embryonically lethal in mice 28, 29, 30, 31. However, animal models of ATLD (Mre11ATLD1/ATLD1) and NBS have been generated and share many common features of the human disorders 32, 33.
MRE11 is a conserved protein with an N-terminal nuclease domain 11, 34 and a DNA-binding region 10, 35 encompassing the GAR motif 36. MRE11 nuclease-defective mice have been generated (Mre11H129N/H129N), defining a physiological role of the MRE11 nuclease activity in homologous recombination and the maintenance of genomic stability 30. Mammalian MRE11 is also involved in the classical and alternative non-homologous end-joining (NHEJ) pathways 21, 23. The arginines within the MRE11 GAR motif are asymmetrically dimethylated by PRMT1 and have been shown to regulate its exonuclease activity in vitro 36, 37, but the physiological significance of arginine methylation remains to be elucidated. In this study, we generated an Mre11 allele (Mre11RK) in mice that substitutes the arginines with lysines within the GAR motif. We report the requirement for the MRE11 GAR motif in regulating the ATR activation during DNA damage signaling and the maintenance of genomic stability.
Results
Generation of Mre11RK knock-in mice
We generated a mouse knock-in allele at the Mre11 locus that substitutes the nine arginines within the GAR motif with lysines (Figure 1A). This Mre11RK allele was generated to assess the in vivo physiological role of the methylarginines within the MRE11 GAR motif. Lysine was chosen to maintain the positive charge of the residues. The Mre11RK allele was generated by homologous recombination targeting exon 14 that encodes the GAR motif (Figure 1B). Mouse genotypes were verified by PCR using genomic DNA (Figure 1C). Moreover, the genomic DNA and the mRNA expressed from this mutant allele were sequenced, verifying that the codons encoding the nine arginines within the GAR motif were replaced with lysine-encoding codons (data not shown). The Mre11RK allele was also engineered to introduce an EcoRI site within the middle of the exon 14 to distinguish the mRNAs encoding wild-type Mre11 and Mre11RK. As expected, the DNA fragment generated by RT-PCR spanning the exon 14 was undigested by EcoRI in wild-type cells, digested 50% and 100% in Mre11RK/+ and Mre11RK/RK cells, respectively, further confirming the genotypes (Figure 1D).
The Mre11RK/RK mice were born in the expected Mendelian ratio and did not display any overt phenotypes (data not shown), unlike the Mre11Δ/Δ and Mre11H129N/H129N nuclease-defective mice, which die during early embryogenesis 30. The Mre11RK/RK females and males were fertile and gave rise to normal litter sizes of six to eight pups (data not shown), unlike the Mre11ATLD1/ATLD1 mice where the females are subfertile 32.
Mre11RK/RK mice and MEFs are hypersensitive to γ-IR
We first decided to challenge the mice with γ-irradiation (IR), as a known phenotype of MRN hypomorphic alleles is their hypersensitivity to IR. Cohorts of Mre11+/+, Mre11RK/+ and Mre11RK/RK mice were irradiated with 10 Gy of IR and closely monitored for radiation toxicity. All of the Mre11RK/RK mice succumbed to 10 Gy of IR treatment within ∼2 weeks, while less than half of the wild-type and the Mre11RK/+ mice died within 35 days (Figure 2A).
The hypersensitivity to IR was also demonstrated in the cells isolated from Mre11RK/RK mice. Immortalized Mre11RK/RK and wild-type MEFs were generated and treated with varying IR doses. After IR treatment, the cell colony number was significantly reduced in Mre11RK/RK MEFs, demonstrating more than 100-fold hypersensitivity to IR compared to wild-type MEFs (Figure 2B).
MRE11 participates in NHEJ pathways 21, 23, which are required for class switch recombination (CSR). Complete absence of MRE11 in developing B lymphocytes causes a significant reduction in CSR, whereas MRE11 defective only in nuclease activities causes a mild CSR defect 23. To determine if the MRE11 GAR motif is required for its function in NHEJ, we compared the impact on CSR of Mre11RK/RK to that of Mre11Δ/Δ and Mre11Δ/H129N. Conversion of Mre11cond to Mre11Δ in mature IgM+ B lymphocytes was facilitated by the CD21-Cre transgene 23, 38. CSR was assessed in B lymphocytes isolated from spleens. Comparing Mre11RK/RK to Mre11+/+, no difference in spleen size or cellularity was evident (data not shown). We induced switching from IgM to IgG1 and noted defects in Mre11Δ/Δ and Mre11Δ/H129N cells similar to those reported previously (Figure 2C, 2D) 23. In contrast, Mre11RK/RK cells display a small statistically significant difference (P = 0.0409), which is unlikely to be biologically significant (Figure 2C, 2D). Taken together, these findings show that we have generated a novel Mre11 hypomorphic allele and that the GAR motif affects sensitivity to IR, but has no major effects on mouse viability, fertility or CSR.
Defective genomic stability and checkpoint control in Mre11RK/RK MEFs
Metaphase spreads were then prepared to determine chromosome damage with passage 2 primary Mre11RK/RK and wild-type MEFs treated with 1 Gy of IR. We observed a significant increase in chromosomal anomalies in these Mre11RK/RK MEFs (Figure 3A, left panel, and quantified in Figure 3B). Genomic instability was also observed in later stage Mre11RK/RK MEFs without DNA damage treatment (Figure 3A, right panel, and quantified in Figure 3C). For example, in passage 7 primary cells, ∼60% of Mre11RK/RK MEFs harbored at least one chromosome aberration per metaphase, compared to 22% in wild-type cells (Figure 3C). Interestingly, we observed a significant number of radial chromosomes in the passage 7 Mre11RK/RK MEFs but not in the wild-type MEFs (Figure 3A, right panel and Table 1). These findings demonstrate the requirement for the MRE11 GAR motif for the maintenance of chromosomal stability.
In response to DNA damage, cell cycle checkpoints are activated to arrest cell cycle progression, allowing time for repair 39. ATLD cells are known to have checkpoint defects in response to DNA damage 25, 32. To examine the activation of the G2/M checkpoint of Mre11RK/RK MEFs, we measured the abundance of cells entering mitosis 90 min after IR treatment with anti-histone H3pS10 antibody and expressed it as a mitotic ratio with untreated cells. After 10 Gy IR treatment, a mitotic ratio of ∼0.1 was observed for wild-type and Mre11+/RK MEFs, suggesting that ∼10% of the cells progressed through M phase (Figure 3D). By contrast, a mitotic ratio of ∼0.3 was observed for Mre11RK/RK MEFs, suggesting that ∼30% of the cells progressed through the M phase (Figure 3D). A similar significant difference was also observed with 5 Gy IR (Figure 3D), suggesting that a significant fraction of the Mre11RK/RK cells lost their G2/M checkpoint.
MRN complex formation, localization to sites of DNA damage and ATM activation are normal in Mre11RK/RK MEFs
To define the molecular defects observed in Mre11RK/RK cells, we first assessed the integrity of the MRKRN complex. Using control and MRE11 immunoprecipitations, we showed that the MRE11RK protein was slightly less abundant than endogenous MRE11, but it maintained its interaction with NBS1 and RAD50 (Figure 4A). We also investigated the arginine methylation status of MRE11RK with the anti-methylarginine-specific antibody ASYM25b. Indeed, MRE11RK was hypomethylated in Mre11RK/RK MEFs (Figure 4A), and the newly introduced lysines were not acetylated (Supplementary information, Figure S1). We next examined the ability of the MRKRN complex to localize to sites of DNA damage by indirect immunofluorescence. MRE11RK localized at sites of DNA damage in response to IR treatment similar to wild-type MRE11 (Figure 4B). These findings show that MRE11RK maintains interactions within the MRN complex.
We next examined whether Mre11RK/RK MEFs harbor defects in ATM activation, since MRE11 is required for recruiting and activating the kinase and cells with MRE11 deficiencies are impaired in this pathway 12, 25, 30, 32. The dynamic of ATM activation was normal in Mre11RK/RK MEFs following IR, as assessed by ATM autophosphorylation using the anti-ATMpS1981 antibody 40 and by evaluating phosphorylation of the ATM substrate CHK2, visualized as a slower migrating species by SDS-PAGE (Figure 4C). Moreover, the IR-induced foci of γ-H2AX and 53BP1 were equally formed in Mre11RK/RK and the wild-type MEFs (Figure 5), consistent with the MRKRN complex properly localizing at DSBs, resulting in ATM activation.
Defective CHK1 activation in Mre11RK/RK MEFs in response to IR treatment
Cells from ATLD patients have both impaired ATM activation and G2/M checkpoint control 32, whereas the MRE11 nuclease-defective cells have both normal ATM activation and G2/M checkpoint control, although MRE11 nuclease activity is essential for cell survival and DNA damage repair 30. Therefore, the Mre11RK hypomorphic allele provides a unique genetic system to assay ATM-independent MRE11 contributions to G2/M checkpoint control in mammalian cells. It has been proposed that the dual action of ATM and ATR is required to initiate the G2/M checkpoint in response to IR 41. Moreover, ATM and MRE11 are required to enhance IR-induced ATR-dependent CHK1 phosphorylation 14, 42, but the role of MRE11 and its GAR motif in ATR activation remains unclear. To assess ATR function, we monitored the phosphorylation of CHK1 using anti-CHK1pS345 antibodies. We observed a dramatic defect in CHK1 activation in Mre11RK/RK MEFs compared to wild-type cells in response to IR treatment (Figure 6A). A CHK1 activation defect was also observed in Mre11RK/RK MEFs by immunoprecipitating CHK1 and assaying its activity using an in vitro kinase assay (Figure 6B). CDC25A is a CHK1 substrate and its phosphorylation is required for its ubiquitination and degradation in response to IR 43. We observed that CDC25A degradation was impaired in Mre11RK/RK MEFs, compared to wild-type MEFs, after IR treatment, consistent with the Mre11RK/RK MEFs exhibiting a CHK1 activation defect (Figure 6C). We also observed a mild defect in CHK1 phosphorylation in Mre11RK/RK MEFs compared to wild-type cells in response to UV and hydroxyurea treatment, respectively (Supplementary information, Figure S2).
We next performed a rescue experiment with ectopic expression of wild-type MRE11 and MRE11RK in Mre11RK/RK MEFs. We observed that increasing the protein levels of wild-type MRE11 in the Mre11RK/RK MEFs rescued the CHK1 phosphorylation defect (Figure 6D, lanes 9 and 10), but increasing the protein levels of MRE11RK had little or no effect on CHK1 activation (Figure 6D, lanes 11 and 12). The MRE11RK protein level in the MRE11RK viral vector-infected Mre11RK/RK MEFs was comparable to that in the empty viral vector-infected wild-type MEFs (see MRE11 panel, Figure 6D, comparing lanes 11 and 12 with lanes 1 and 2). These findings show that Mre11RK/RK MEFs with restored MRE11RK to levels of endogenous wild-type MRE11 still display impaired ATR/CHK1 activation. These findings show that the lack of a functional MRE11 GAR motif directly contributes to the ATR/CHK1 activation defects observed in Mre11RK/RK MEFs.
Defective exonuclease activity and DNA binding of MRKRN complex
The presence of RPA-coated single-strand DNA (RPA-ssDNA) promotes ATR-ATRIP recruitment, which leads to CHK1 phosphorylation and activates the G2/M checkpoint 44. Hence, the CHK1 activation defect in Mre11RK/RK MEFs might result from abnormal DNA resection, leading to a reduction in RPA-ssDNA formation. To assess these molecular mechanisms, we first monitored whether purified MRKRN displayed DNA resection defects compared to the wild-type MRN complex (Figure 7A). We showed previously that recombinant MRE11RK had impaired 3′-5′ exonuclease activity in vitro 36, 37, and we now extend these findings to show that MRE11RK within the MRKRN complex also has impaired 3′-5′ exonuclease activity. Interestingly, three times more MRKRN was required to achieve the same level of DNA resection as MRN, suggesting that the MRKRN complex has impaired resecting activity (Figure 7B, compare MRN at 5 nM and MRKRN at 15 nM). In addition, we performed a DNA-binding analysis comparing the ability of the MRN and MRKRN complexes to bind ssDNA, dsDNA and splayed arm DNA. As expected, the MRN complex bound both dsDNA and ssDNA, as well as splayed arm DNA (Figure 7C, 7D). The MRKRN complex bound all three types of DNA with relative weaker affinity than the MRN complex (Figure 7C, 7D). For example, at the concentration of 5 nM, the wild-type MRN complex bound almost 80% splayed arm DNA, whereas the MRKRN complex bound only 30% splayed arm DNA (Figure 7D). These findings suggest that the DNA-binding ability of MRE11 may be required for the processivity of its intrinsic exonuclease activity.
Defective IR-induced RPA2 and RAD51 foci formation in Mre11RK/RK MEFs
To assess whether RPA-ssDNA complexes were formed in Mre11RK/RK MEFs, we assayed RPA foci formation in response to DSBs using anti-RPA2 antibodies after IR treatment. We observed a more than 50% decrease of Mre11RK/RK MEFs containing >5 RPA2 foci compared to wild-type MEFs (Figure 8A, 8B). Since RPA-ssDNA complexes are subsequently replaced with RAD51 for homologous recombination to proceed 45, 46, we examined the formation of RAD51 foci. Indeed, we also observed a significant reduction in RAD51 foci formation in Mre11RK/RK MEFs (Figure 8A, 8B). Two hours after 10 Gy IR treatment, ∼40% of wild-type MEFs had > 5 RAD51 foci compared to ∼20% in Mre11RK/RK MEFs (Figure 8A, 8B). At 4 h, ∼40% of the wild-type MEFs retained > 5 RAD51 foci, while the Mre11RK/RK MEFs with >5 RAD51 foci increased to nearly 30%. Moreover, Mre11RK/RK MEFs had less RPA2 foci per cell than wild-type MEFs (Figure 8C). These results show that the Mre11RK/RK MEFs are defective in recruiting RPA and RAD51 to DSBs.
Discussion
In the present study, we have generated a mouse knock-in allele of Mre11 that substitutes the arginines with lysines in the GAR motif. The Mre11RK/RK mice were sensitive to γ-IR and the MEFs isolated from the Mre11RK/RK mice accumulated increased number of aberrant chromosomes, defining a physiological role for the GAR motif in maintaining genomic stability. The Mre11RK/RK MEFs displayed defects of ATR/CHK1 signaling and G2/M checkpoint activation, and reduced recruitment of RPA and RAD51 proteins to the damaged sites in response to γ-IR. MRE11RK was assembled normally within the MRKRN complex, localized to sites of DNA damage and normally activated the ATM pathway. In vitro biochemical analysis suggested that the MRKRN complex exhibited defects in exonuclease processivity and DNA binding, which are likely to be responsible for the impaired DNA end resection and ATR/CHK1 activation observed in the Mre11RK/RK MEFs in response to IR. Our findings provide genetic evidence for the critical role of the MRE11 GAR motif in DSB repair, and define a mechanistic link between the MRE11 GAR motif, MRN exonuclease processivity, the processing of DSBs and cell cycle checkpoint activation (Figure 9).
The GAR motif is a characteristic signature of clusters of methylated arginines. The arginines located within the GAR motif have been shown to mediate protein-protein and protein-nucleic acid interactions 2. Moreover, the GAR motif was shown to regulate protein localization, but this may be indirect due to protein-protein and protein-nucleic acid interactions. Using the unique genetic system and several biochemical and cytological methods, we demonstrate the molecular mechanism by which GAR motif regulates MRE11 function for the activation of ATR signaling and recruitment of RPA and RAD51 proteins to the DNA damage sites, both of which rely on ssDNA resection, a relatively later event of MRE11 action in response to DSBs. In contrast, the GAR motif mutation did not affect the initial response of the MRN complex to DSBs, as it was normally recruited to sites of DNA damage and normally activated the ATM pathway. The Mre11RK/RK mice provide an important tool to study the roles of the MRN complex at the later stage in response to DNA damage.
The physiological function of the MRE11 nuclease domain was assessed by the generation of mice carrying the nuclease-defective Mre11H129N mutation 30. Homozygous Mre11H129N/H129N mice are embryonically lethal, like Mre11-null mice, confirming the requirement for the MRE11 nuclease domain during embryogenesis. Cells from Mre11H129N/H129N mice exhibited hypersensitivity to IR and genomic instability. The MH129NRN complex was stable, localized to sites of DNA damage and activated ATM. The cellular defect of Mre11H129N/H129N mice lies in their inability to properly repair DNA by homologous recombination 30. We demonstrated significant impairment of the 3′-5′ exonuclease processivity of the MRKRN complex (Figure 7) 36, 37. The intrinsic activity of nuclease activities of MRE11 may be sufficient to promote fork degradation 47. In conjunction with other factors, such as 5′-3′ exonucleases CtIP and EXO1, the MRN complex is functionally involved in the extensive degradation, leading to DNA end resection and homologous recombination 15, 16, 48, 49. Our findings suggest that the GAR motif may modulate the MRE11 exonuclease activity within the MRN complex in vivo, contributing to the defective ssDNA resection observed in Mre11RK/RK MEFs (Figure 8).
The impaired DNA-binding activity of MRE11RK that we observed may also contribute to the defect of DNA end processing observed with the MRKRN complex. The MRE11 GAR motif is likely to be required to bind selective types of DNA ends at the sites of DNA damage to modulate ATR activation during DSB repair. Indeed, we found that MRN bound splayed arm DNA, representative of a DNA replication intermediate, preferentially over ssDNA and dsDNA substrates. We infer that the MRE11 exonuclease activity is required to generate ssDNAs needed to activate the ATR pathway via ssDNA binding by ATRIP. The fact that Mre11RK/RK mice are viable, suggests that the exonuclease defect we that observed is not as severe as observed in Mre11H129N/H129N mice in which both exonuclease and endonuclease activities are defective 30. We observed that Mre11RK/RK MEFs display a G2/M checkpoint defect not observed in Mre11H129N/H129N MEFs 30. These findings suggest that some phenotypes of Mre11RK/RK MEFs cannot be solely explained by impaired MRE11 exonuclease activity (Table 2). As such, it is important to note that cells from ATR-deficient Seckel Syndrome 50, like Mre11RK/RK MEFs, also display a G2/M checkpoint defect. In addition, we observed the formation of radial chromosomes in Mre11RK/RK MEFs (Figure 3A and Table 1), a feature also observed in ATR and Fanconi-deficient cells. Our results suggest that defects in the methylation of mammalian MRE11 GAR motif are likely to manifest themselves as defects in the level of ATR activation, leading to genomic instability and cell death.
In conclusion, our findings provide genetic and biochemical evidence for the critical role of the MRE11 GAR motif in DSB repair. Our data define a mechanistic link between the MRE11 GAR motif, MRN exonuclease processivity, DSB end processing and cell cycle checkpoint activation. The fact that the GAR motif is widely found in proteins implies that this mechanism of regulation may also occur in other systems.
Materials and Methods
Reagents and antibodies
Rabbit anti-MRE11 antibodies were from Novus Biologicals (Littleton, CO, USA), Cell Signalling Technology (Danvers, MA, USA) and GeneTex Inc. (Irvine, CA, USA), respectively. Rabbit anti-53BP1, anti-RAD50 and anti-mouse NBS1 antibodies were from Novus Biologicals. Mouse anti-ATM-pS1981 (mouse Ser1987) antibody was from Rockland (Gilbertsville, PA, USA). Mouse anti-γH2AX monoclonal antibody, rabbit anti-phospho-histone H3-Ser10, ASYM25b, and anti-CHK2 antibodies were obtained from Millipore (Billerica, MA, USA). Rabbit anti-RAD51, anti-CHK1 and anti-CDC25A antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Rabbit anti-phospho-CHK1 ser345 antibody was from Cell Signalling Technology. Rabbit anti-acetyl-lysine antibody was from Abcam (Cambridge, MA, USA). Rabbit anti-RPA2 antibodies were generated with a peptide located at the C-terminal end of the mouse RPA2 using the following peptide as antigen, NEGHIYSTVDDDHFKSTDAEC. Propidium iodide (PI) and the Alexa Fluor 488-conjugated goat anti-rabbit antibodies and anti-mouse antibodies were from Invitrogen (Carlsbad, CA, USA). Protein A-sepharose and mouse anti-α-tubulin monoclonal antibody were from Sigma (St Louis, MO, USA). Protease inhibitor cocktail and protein phosphatase inhibitor cocktail were from Roche (Mississauga, ON, USA). CHK1 substrate peptide (KKKVSRSGLYRSPENLNRPR) derived from CDC25C was purchased from AnaSpec Inc. (San Jose, CA, USA). Immunoprecipitations and immunoblotting were performed as previously described 5.
Generation of the Mre11RK/RK mice
The mutant Mre11 knock-in allele (Mre11RK) was generated using a targeting construct 3lox-2frt flanking a neomycin resistance cassette for selection 5. The primers used to introduce arginine to lysine mutations were: 5′-CTGCCCTTTGGCTCCTTTCTTCCCTTTGCCTTTGCCTTTGCCTTTGCTCGGCACTGCTG-3′ and 5′-AATTCGGCACCTAAAGGAGGCTCTCAGAAAGGCCGAGGTCAGCACC-3′. For the 5′ arm of the construct, a 3.2 kb DNA fragment was amplified using the following oligonucleotides: 5′-TTTTCCGCGGATGGAATCTGAACACACACTGAGTGG-3′ and 5′-TTTTGCGGCCGCATGTTTGTAAAAGACAGTCATGAG-3′ and the fragment was subcloned into SacI and NotI unique sites of the pGK-neo vector. A 3.1 kb fragment for the 3′ arm was amplified by PCR with 5′-TTTTGTCGACTACTATCAGGAGATAAAGTACTTACATG-3′ and 5′-TTTTGGCCGGCCTGAAAGATGTAGTCCTGTCAC-3′ and subcloned into SalI and FseI. To insert the mutated exon 14 of Mre11, gDNA was amplified and engineered to have AscI and XhoI ends. The completed vector was then sequenced to verify the absence of any undesired mutations. In order to clearly identify the mutated allele, an EcoRI site was introduced, also changing serine at position 583 to an asparagine. An FseI site was introduced at the 3′ end of the 3.1 kb fragment and was used to linearize the plasmid for electroporation into embryonic stem (ES) cells. Potential homologous recombinant ES cells emerging from neomycin selection were screened, as determined through a long template PCR system (Roche, 11681842001). Primers for verification included: 5′ arm: ATTGGCACCTATTGTGCAGC and AGGTCGAGGGACCTAATAACTTCG, 3′ arm: GCGTGCAGAATGCCGGGCTTCCGGAG and GATCTGAAAGCTAGTATG, and the fragment between the insert and 5′ arm: AGTGCAGTCAGTGCTCTTTA and CTCTCATTCAGTCATATCAA. Approximately 500 ES colonies were screened and several clones were identified that contained the Mre11 mutant allele. Targeted ES cells were injected into 3.5-day-old blastocytes and were transferred into CD-1 foster mothers, and animals classified as chimeras by coat color were mated with C57BL/6 mice. Germline transmission was achieved and mice were maintained in C57BL/6 background. These mice were then crossed with a transgenic mouse containing FLP1 recombinase gene (Jackson Lab) under the direction of the Gt(ROSA)26Sor promoter to promote recombination and removal of the neomycin cassette. The resulting DNA sequence yielded an ∼600 bp band in the recombinant allele due to the insertion of 90 bp encompassing the loxP and FRT site of the vector.
Mouse genotyping and RT-PCR of the Mre11 transcript
All mouse procedures were performed in accordance with McGill University guidelines, which are set by the Canadian Council on Animal Care. Genomic DNA was isolated from ear biopsies and analyzed by PCR analysis. The Mre11 allele was identified using the following oligonucleotides: 5′-TGTAGTAGAACTTGGACAGT-3′ and 5′-TGAACCCAGGTCATCTAGAA-3′ yielding a 525 bp band in the wild-type allele and a 591 bp band in the Mre11RK allele. Total cellular RNA was prepared by TRIzol reagent according to the manufacturer's protocol (Invitrogen) to ensure proper splicing of the knock-in transcript. Total RNA (6 μg) was reverse transcribed, and cDNA samples were subjected to PCR analysis. The following 5′ and 3′ primers were used to evaluate the Mre11 transcript: 5′-GCGGTTTCTTAAGGAGCGCCATATT-3′ and 5′-TGTGCCCGACCACCTTTGATCAGCC-3′, yielding a 550 bp band.
Isolation, immortalization and culture of MEFs
Primary MEFs were isolated from E14.5 embryos. Spontaneously immortalized MEFs were created according to the standard 3T3 protocol. All cells were grown in DMEM containing 10% fetal bovine serum.
Ionizing radiation treatment of mice and MEFs
Mice and cells were irradiated at room temperature using a Theratron T-780 Cobalt Unit located in the Department of Radiation Oncology at the Jewish General Hospital (Montreal, Quebec, Canada). Doses ranging from 2 to 10 Gy were delivered at a dose rate of 0.66 Gy/min. The cells were returned to an incubator after the IRs and maintained at 37 °C for further analysis. For in vivo survival experiments, 8- to 10-week-old mice (n = 7) of each genotype were whole-body irradiated at a dose of 10 Gy and then monitored for radiation toxicity.
Chromosome breakage studies: scoring of chromosome aberrations
We have analyzed more than 50 Giemsa-stained metaphases for the passage 7 MEFs without and passage 2 MEFs with 1 Gy IR for each genotype, respectively. The number and type of structural chromosome abnormalities were scored. Chromatid and isochromatid gaps, chromatid and isochromatid breaks, deletions and fragments were scored as a single break. Structural rearrangements including translocations and radial figures were scored as two breakage events. The total number of chromosome aberrations and the mean number of chromosome aberrations per metaphase were scored. Diploid and tetraploid cells were analyzed separately.
Clonogenic assay
Approximately 200-400 cells were plated on 10 cm dishes and treated with varying dosage of IR in duplicate 24 h after plating. The cells were maintained in the regular medium and allowed to grow for 14-20 days. The colonies were fixed and stained with 0.1% crystal violet for 30 min. The stained colonies were counted. The surviving fraction was determined by dividing the average number of colonies for each treatment by the average number of colonies in the control plates.
Class switch recombination
Breeding and genotyping of mice harboring combinations of the Mre11cond, Mre11Δ, Mre11H129N and CD21-Cre alleles were as previously described 23, 30. Analyses of CSR was as previously described 23.
Cytometry analysis
For all flow cytometry experiments, both cells growing on the surface of the dishes and in the culture medium were harvested, fixed with 75% ethanol and stored at −20 °C for less than 1 week before staining and analysis. All flow cytometry measurements were performed using BD FACSCalibur flow cytometer (BD Biosciences). Data were analyzed using BD CellQuest Pro software. For measurement of phosphorylated histone H3, fixed cells were first stained with anti-H3 pS10 rabbit antibody for 1 h and then with FITC-conjugated goat anti-rabbit IgG (Invitrogen) for another hour after washing with dilution buffer (1% FBS and 0.1% Triton X-100 in PBS) as described previously 5. Cells were then counterstained with PI and subjected to flow cytometry analysis.
Immunofluorescence
Cells growing on glass coverslips were washed with PBS twice and fixed with 4% paraformaldehyde at room temperature for 10 min. The cells were then permeabilized (0.5% Triton X-100 in PBS) for 10-15 min. Following three washes with PBS, cells were blocked with 10% serum in PBS and stained with mouse anti-γH2AX (1:1 000), anti-MRE11 (1:200), rabbit anti-53BP1 (1:200), anti-RPA2 (1:100) or anti-RAD51 (1:20) antibodies diluted in PBS containing 5% serum and 0.1% Triton X-100. After three washes, the cells were then stained with Alexa Fluor 488-conjugated goat anti-rabbit or anti-mouse secondary antibodies. DNA was counterstained with 4,6-diamidino-2-phenylindole after three washes with PBS and coverslips were mounted with Immu-Mount purchased from Thermo Scientific. Images were taken using a Zeiss M1 fluorescence microscope.
CHK1 activity assays
MEFs were lysed with lysis buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl supplemented with phosphatase inhibitor cocktails and protease inhibitor cocktails) and whole-cell lysates were incubated with anti-CHK1 antibody for 2 h and then protein A-sepharose beads for 1 h. The beads were then washed three times with lysis buffer and then twice with kinase reaction buffer (50 mM Tris-HCl, pH 7.0, 1 mM DTT, 5 mM MgCl2, 0.4 mM MnCl2). The washed beads were resuspended in 20 μl kinase reaction buffer containing 10 μg peptide and 10 μCi γ-32P-ATP and incubated at 30 °C for 20 min with rotation. After spinning for 10 s at 4 °C, the reaction tubes were placed on ice and immediately 10 μl of supernatant was spotted onto thick Fisherbrand Whatmann paper. The papers were then washed five times with 0.5% orthophosphoric acid and rinsed once with ethanol and dried. After drying, the papers were counted with a multi-purpose Scintillation Counter LS 6500, Beckman Coulter (Mississauga, ON, USA). The CHK1 activity was expressed as percentage of the activity in the non-treated samples.
Purification of MRN and MRKRN
MRN and MRKRN were purified as follows. Insect cells (800 ml, 106 cells/ml) were co-infected with MRE11-HIS (or MRE11RK-HIS) and FLAG-RAD50 dual baculovirus and a GST-NBS1 baculovirus for 48 h in a spinner flask. The cells were collected by centrifugation and the pellet was frozen on dry ice. Cells were lysed in PBS300 (1× PBS, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.05% Triton X-100, and protease inhibitors). The cell lysate was centrifuged in 35 000 rpm. for 40 min. Glutathione Sepharose (2 ml, GE Healthcare) was added to the supernatant and incubated for 1.5 h at 4 °C. The beads were washed three times with PBS300, twice with PBS500 (1× PBS, 350 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.05% Triton X-100 and protease inhibitors) and once with P5 buffer (20 mM NaPO4, pH 7.0, 500 mM NaCl, 10% glycerol, 0.02% Triton X-100, 5 mM imidazole). The MRN complex was eluted by cleavage with PreScission protease (60 U/ml, GE Healthcare) for 5 h at 4 °C. The supernatant was added to 400 μl of Talon resin (Clontech) and incubated for 1.5 h at 4 °C. The resin was washed with 10 ml of P30 Talon washing buffer (20 mM NaHPO4, pH 7.4, 1 M NaCl, 10% glycerol, 0.02 % Triton X-100, 30 mM imidazole). MRN complexes were eluted with buffer containing 500 mM imidazole and dialyzed in storage buffer (20 mM Tris-Cl, pH 7.5, 200 mM NaCl, 10% glycerol, 1 mM DTT).
Exonuclease and DNA-binding assays
Exonuclease assays were performed as described previously 36. DNA-binding reactions (10 μl) contained 32P-labelled DNA oligonucleotides (25 nM in nucleotides of each substrate) and MRN or MRKRN, at the indicated concentrations, in binding buffer (25 mM MOPS (morpholinepropanesulfonic acid), pH 7.0, 60 mM KCl, 0.2% Tween, 2 mM DTT, 1 mM Mg(CH3COO)2). Reaction mixtures were incubated at 37 °C for 15 min, followed by 15 min of fixation in 0.2% glutaraldehyde. Reactions were loaded on an 8% TBE acrylamide gel.
References
Bedford MT, Richard S . Arginine methylation an emerging regulator of protein function. Mol Cell 2005; 18:263–272.
Bedford MT, Clarke SG . Protein arginine methylation in mammals: who, what, and why. Mol Cell 2009; 33:1–13.
Tang J, Kao PN, Herschman HR . Protein-arginine methyltransferase I, the predominant protein-arginine methyltransferase in cells, interacts with and is regulated by interleukin enhancer-binding factor 3. J Biol Chem 2000; 275:19866–19876.
Pawlak MR, Scherer CA, Chen J, Roshon MJ, Ruley HE . Arginine N-methyltransferase 1 is required for early postimplantation mouse development, but cells deficient in the enzyme are viable. Mol Cell Biol 2000; 20:4859–4869.
Yu Z, Chen T, Hébert J, Li E, Richard S . A mouse PRMT1 null allele defines an essential role for arginine methylation in genome maintenance and cell proliferation. Mol Cell Biol 2009; 29:2982–2996.
Boisvert FM, Chénard CA, Richard S . Protein interfaces in signaling regulated by arginine methylation. Sci STKE 2005; 271:re2.
Mirzoeva OK, Petrini JH . DNA damage-dependent nuclear dynamics of the Mre11 complex. Mol Cell Biol 2001; 21:281–288.
Lisby M, Barlow JH, Burgess RC, Rothstein R . Choreography of the DNA damage response: spatiotemporal relationships among checkpoint and repair proteins. Cell 2004; 118:699–713.
Berkovich E, Monnat RJJ, Kastan MB . Roles of ATM and NBS1 in chromatin structure modulation and DNA double-strand break repair. Nat Cell Biol 2007; 9:683–690.
Hopfner KP, Craig L, Moncalian G, et al. The Rad50 zinc-hook is a structure joining Mre11 complexes in DNA recombination and repair. Nature 2002; 418:562–566.
Williams RS, Moncalian G, Williams JS, et al. Mre11 dimers coordinate DNA end bridging and nuclease processing in double-strand-break repair. Cell 2008; 135:97–109.
Lee JH, Paull TT . Direct activation of the ATM protein kinase by the Mre11/Rad50/Nbs1 complex. Science 2004; 304:93–96.
Falck J, Coates J, Jackson SP . Conserved modes of recruitment of ATM, ATR and DNA-PKcs to sites of DNA damage. Nature 2005; 434:605–611.
Jazayeri A, Falck J, Lukas C, et al. ATM- and cell cycle-dependent regulation of ATR in response to DNA double-strand breaks. Nat Cell Biol 2006; 8:37–45.
Sartori AA, Lukas C, Coates J, et al. Human CtIP promotes DNA end resection. Nature 2007; 450:509–514.
Limbo O, Chahwan C, Yamada Y, et al. Ctp1 is a cell-cycle-regulated protein that functions with Mre11 complex to control double-strand break repair by homologous recombination. Mol Cell 2007; 28:134–146.
Mimitou EP, Symington LS . Sae2, Exo1 and Sgs1 collaborate in DNA double-strand break processing. Nature 2008; 455:770–774.
Zhu Z, Chung WH, Shim EY, Lee SE, Ira G . Sgs1 helicase and two nucleases Dna2 and Exo1 resect DNA double-strand break ends. Cell 2008; 134:981–994.
Mirzoeva OK, Petrini JH . DNA replication-dependent nuclear dynamics of the Mre11 complex. Mol Cancer Res 2003; 1:207–218.
Williams RS, Williams JS, Tainer JA . Mre11-Rad50-Nbs1 is a keystone complex connecting DNA repair machinery, double-strand break signaling, and the chromatin template. Cell Biol 2007; 85:509–520.
Xie A, Kwok A, Scully R . Role of mammalian Mre11 in classical and alternative nonhomologous end joining. Nat Struct Mol Biol 2009; 16:814–818.
Rass E, Grabarz A, Plo I, et al. Role of Mre11 in chromosomal nonhomologous end joining in mammalian cells. Nat Struct Mol Biol 2009; 16:819–824.
Dinkelmann M, Spehalski E, Stoneham T, et al. Multiple functions of MRN in end-joining pathways during isotype class switching. Nat Struct Mol Biol 2009; 16:808–813.
Deng Y, Guo X, Ferguson DO, Chang S . Multiple roles of MRE11 at uncapped telomeres. Nature 2009; 460:914–918.
Stewart GS, Maser RS, Stankovic T, et al. The DNA double-strand break repair gene hMRE11 is mutated in individuals with an ataxia-telangiectasia-like disorder. Cell 1999; 99:577–587.
Carney JP, Maser RS, Olivares H, et al. The hMre11/hRad50 protein complex and Nijmegen breakage syndrome: linkage of double-strand break repair to the cellular DNA damage response. Cell 1998; 93:477–486.
Shiloh Y . ATM and related protein kinases: safeguarding genome integrity. Nat Rev Cancer 2003; 3:155–168.
Luo G, Yao MS, Bender CF, et al. Disruption of mRad50 causes embryonic stem cell lethality, abnormal embryonic development, and sensitivity to ionizing radiation. Proc Natl Acad Sci USA 1999; 96:7376–7381.
Xiao Y, Weaver DT . Conditional gene targeted deletion by Cre recombinase demonstrates the requirement for the doubl-strand break repair Mre11 protein in murine ES cells. Nucl Acid Res 1997; 15:2985–2991.
Buis J, Wu Y, Deng Y, et al. Mre11 nuclease activity has essential roles in DNA repair and genomic stability distinct from ATM activation. Cell 2008; 135:85–96.
Zhu J, Petersen S, Tessarollo L, Nussenzweig A . Targeted disruption of the Nijmegen breakage syndrome gene NBS1 leads to early embryonic lethality in mice. Curr Biol 2001; 11:105–109.
Theunissen JW, Kaplan MI, Hunt PA, et al. Checkpoint failure and chromosomal instability without lymphomagenesis in Mre11(ATLD1/ATLD1) mice. Mol Cell 2003; 12:1511–1523.
Difilippantonio S, Celeste A, Fernandez-Capetillo O, et al. Role of Nbs1 in the activation of the Atm kinase revealed in humanized mouse models. Nat Cell Biol 2005; 7:675–685.
Paull TT, Gellert M . The 3′-5′ exonuclease activity of Mre 11 facilitates repair of DNA double-strand breaks. Mol Cell 1998; 1:969–979.
de Jager M, Dronkert ML, Modesti M, et al. DNA-binding and strand-annealing activities of human Mre11: implications for its roles in DNA double-strand break repair pathways. Nucleic Acids Res 2001; 29:1317–1325.
Déry U, Coulombe Y, Rodrigue A, et al. A glycine-arginine domain in control of the human MRE11 DNA repair protein. Mol Cell Biol 2008; 28:3058–3069.
Boisvert FM, Déry U, Masson JY, Richard S . Arginine methylation of MRE11 by PRMT1 is required for DNA damage checkpoint control. Genes Dev 2005; 19:671–676.
Kraus M, Alimzhanov MB, Rajewsky N, Rajewsky K . Survival of resting mature B lymphocytes depends on BCR signaling via the Igalpha/beta heterodimer. Cell 2004; 117:787–800.
Zhou BB, Elledge SJ . The DNA damage response: putting checkpoints in perspective. Nature 2000; 408:433–439.
Bakkenist CJ, Kaston MB . DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature 2003; 421:499–506.
Brown EJ, Baltimore D . Essential and dispensable roles of ATR in cell cycle arrest and genome maintenance. Genes Dev 2003; 17:615–628.
Myers JS, Cortez D . Rapid activation of ATR by ionizing radiation requires ATM and Mre11. J Biol Chem 2006; 281:9346–9350.
Mailand N, Falck J, Lukas C, et al. Rapid destruction of human Cdc25A in response to DNA damage. Science 2000; 288:1425–1429.
Zou L, Elledge SJ . Sensing DNA damage through ATRIP recognition of RPA-ssDNA complexes. Science 2003; 300:1542–1548.
Sugiyama T, Zaitseva EM, Kowalczykowski SC . A single-stranded DNA-binding protein is needed for efficient presynaptic complex formation by the Saccharomyces cerevisiae Rad51 protein. J Biol Chem 1997; 272:7940–7945.
Benson FE, Stasiak A, West SC . Purification and characterization of the human Rad51 protein, an analogue of E. coli RecA. EMBO J 1994; 13:5764–5771.
Schlacher K, Christ N, Siaud N, et al. Double-strand break repair-independent role for BRCA2 in blocking stalled replication fork degradation by MRE11. Cell 2011; 145:529–542.
Uanschou C, Siwiec T, Pedrosa-Harand A, et al. A novel plant gene essential for meiosis is related to the human CtIP and the yeast COM1/SAE2 gene. EMBO J 2007; 26:5061–5070.
Mimitou EP, Symington LS . DNA end resection: many nucleases make light work. DNA Repair 2009; 8:983–995.
Andreassen PR, D'Andrea AD, Taniguchi T . ATR couples FANCD2 monoubiquitination to the DNA-damage response. Genes Dev 2004; 18:1958–1963.
Acknowledgements
We thank Mélanie Morel for expert technical assistance. We thank Drs Eric Brown, John Petrini and Junjie Chen for helpful discussions and Dr David Cortez for reagents. We also thank Julie Birraux for MRN baculoviruses and Cyril Charbonnel for technical help. This study was supported by grant MOP-67070 from the Canadian Institutes of Health Research to SR. JH is supported by a grant from the Cancer Research Network of Fonds de la Recherche en Santé du Québec. DOF is supported by NIH R01 HL079118 and the Leukemia and Lymphoma Society. JYM is a FRSQ Chercheur Senior supported by funds from the CIHR (MOP-102722). SR is a Chercheur-National of the Fonds de la recherche en Santé du Québec.
Author information
Authors and Affiliations
Corresponding author
Additional information
(Supplementary information is linked to the online version of the paper on the Cell Research website.)
Supplementary information
Supplementary information, Figure S1
Lysines within the MRE11RK GAR motif are not acetylated. (PDF 97 kb)
Supplementary information, Figure S2
CHK1 phosphorylation defects observed in Mre11RK/RK MEFs treated with HU and UV. (PDF 61 kb)
Rights and permissions
About this article
Cite this article
Yu, Z., Vogel, G., Coulombe, Y. et al. The MRE11 GAR motif regulates DNA double-strand break processing and ATR activation. Cell Res 22, 305–320 (2012). https://doi.org/10.1038/cr.2011.128
Received:
Revised:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1038/cr.2011.128
Keywords
This article is cited by
-
PRMT1 in human neoplasm: cancer biology and potential therapeutic target
Cell Communication and Signaling (2024)
-
PRMT1 and PRMT5: on the road of homologous recombination and non-homologous end joining
Genome Instability & Disease (2022)
-
Arginine methylation and ubiquitylation crosstalk controls DNA end-resection and homologous recombination repair
Nature Communications (2021)
-
Protein arginine methyltransferases: promising targets for cancer therapy
Experimental & Molecular Medicine (2021)
-
Suppression of DDX39B sensitizes ovarian cancer cells to DNA-damaging chemotherapeutic agents via destabilizing BRCA1 mRNA
Oncogene (2020)