Original Article

The American Journal of Gastroenterology (2005) 100, 1274–1282; doi:10.1111/j.1572-0241.2005.40852.x

Host TNF-alpha-1031 and -863 Promoter Single Nucleotide Polymorphisms Determine the Risk of Benign Ulceration after H. pylori Infection

Cheng-Chan Lu PhD1, Bor-Shyang Sheu MD1, Ten-Wen Chen MS1, Hsiao-Bai Yang MD1, Kuey-Hsian Hung PhD1, Ai-Wen Kao MD1, Chiao-Hsiung Chuang MD1 and Jiunn-Jong Wu PhD1

1Departments of Internal Medicine, Pathology, and Medical Technology, Institute of Microbiology and Immunology and Institute of Basic Medicine, Medical College, National Cheng Kung University, Tainan, Taiwan

Correspondence: Bor-Shyang Sheu, MD, Department of Internal Medicine, National Cheng Kung University Hospital, 138 Sheng Li Road, Tainan 704, Taiwan

Received 26 May 2004; Revised  0000; Accepted 8 December 2004.

Top

Abstract

OBJECTIVES:

 

This study tested whether host genotypes of the tumor necrosis factor-alpha (TNF-alpha) promoter single nucleotide polymorphism (SNP) could determine clinical and histological outcomes after Helicobacter pylori infection.

METHODS:

 

A total of 524 dyspeptic patients, 424 with and 100 without H. pylori infection, were checked for TNF-alpha promoter SNP over the locus on -1031(T/C), -863(C/A), -857(C/T), -806(C/T), and -308(G/A) by sequence-specific oligonucleotide probe. Each patient received panendoscopy to take gastric biopsy to detect H. pylori infection and its related histology using the updated Sydney's system. Gastric TNF-alpha expressions were stained by immunohistochemistry.

RESULTS:

 

In H. pylori-infected patients, -1031C or -863A carriers of TNF-alpha promoter had more severe gastric neutrophil infiltration and TNF-alpha gastric staining than individuals with -1031TT or -863CC genotype, respectively (p < 0.05). The multivariate logistic regression verified both -1031C and -863A carriers were independent risk factors to have duodenal ulcers and gastric ulcer without IM in the H. pylori-infected hosts (p < 0.05). As compared to -863CC and -1031TT genotype combinations, the ulcer risk after H. pylori infection was 2.46 (95% CI: 1.32–4.59, pless than or equal to 0.00001) for the carriers with either -1031C or -863A allele, and even elevated to 6.06 (95% CI: 3.57–10.21, pless than or equal to 0.00001) for the individuals harboring both -863A and -1031C alleles. For patients with gastric ulcer, the 863CC genotype had a higher rate to have intestinal metaplasia than -863A carrier (pless than or equal to 0.005).

CONCLUSIONS:

 

TNF-alpha-1031 and -863 promoter SNP should be novel host factors to determine the gastric inflammation and risk of peptic ulceration upon H. pylori infection.

Top

INTRODUCTION

Helicobacter pylori infection is now recognized as closely related to peptic ulcer diseases and even gastric carcinogenesis (1,2). Despite positive clinical evidence illustrating how the eradication of H. pylori improves ulcer healing and diminishes ulcer relapse (3,4), the exact pathophysiology of H. pylori in ulcerogenesis warrants further investigation. While H. pylori infection often leads to chronic gastric inflammation, only some of those infected develop peptic ulcers. Therefore, there appear to be differences in the bacterial virulence factors in those with and those without peptic ulceration after H. pylori infection.

A more virulent triple-positive strain of H. pylori—positive for cagA, vacAs1, and babA2—increases the risk of ulcers and cancer in western countries (5,6,7). In Asian countries with a high prevalence of triple-positive H. pylori, bacterial factors have limited value for determining disease outcomes as either peptic ulcers or cancers (8,9,10,11,12). Therefore, it is worth determining whether there could be any host genetic predispositions or consequences of immunological responses related to the different outcomes after H. pylori infection in Taiwan, where nearly 100% of the H. pylori isolates have been triple-positive (8,9,10).

A hallmark of H. pylori-triggered mucosal inflammation is the continuous recruitment of neutrophils and mononuclear cells to the gastric lamina propria (1,2,3). This process is thought to be induced by inflammatory cytokines, tumor necrosis factor-alpha (TNF-alpha), for example, after H. pylori infection (13,14). TNF-alpha may then play a crucial role in the host immunological defense against the infection, because a high concentration of TNF-alpha is also closely related to the damage of gastric epithelium (13,14,15). The production of TNF-alpha may be regulated at the transcriptional, posttranscriptional, and translational levels (16,17,18,19). Several biallelic polymorphisms have been described within the TNF-alpha promoter region upstream of the transcriptional start site: positions -238, -308, -857, -863, and -1031 (20,21,22). There are striking individual differences in the ability to produce cytokines with genetic polymorphisms within the regulatory regions (19,23,24). It is thus logical to see whether polymorphisms in the TNF-alpha promoter region affect TNF-alpha levels in gastric tissue or affect the gastric histopathological change upon H. pylori infection.

Unlike the -238 locus, the TNF-alpha-308 promoter polymorphism is closely related to cagA-positive H. pylori infection, and to an increase in the risk of atrophic gastritis, peptic ulceration, and even gastric cancer (20,25). The role of the other novel positions of TNF-alpha promoter should be promising tested in the patients with H. pylori infection. Moreover, there is no available data that directly show the difference of tissue TNF-alpha levels in gastric mucosa epithelium between patients with different polymorphisms in the TNF-alpha promoter region after H. pylori infection. In this study, therefore, we enrolled dyspeptic patients to examine whether the genotypes defined by TNF-alpha promoter single nucleotide polymorphism (SNP) at -308, -806, -857, -863, and -1031 determine the histopathologic changes and clinical course of H. pylori infection in Taiwan. This study is, to the best of our knowledge, the first one to demonstrate novel TNF-alpha promoter SNP, other than -308 locus, and is closely associated with the risk of peptic ulceration in an endemic area with nearly 100% of H. pylori infections triple-positive for cagA, vacA sl, and babA2.

Top

MATERIALS AND METHODS

Patients and Study Design

After obtaining informed consent, each of the 524 enrolled dyspeptic subjects underwent panendoscopy to obtain biopsy tissue for histology studies and H. pylori cultures. Five gastric biopsy specimens, two from the antrum, two from the corpus, and one from the cardia, were obtained during endoscopy (26). The specimen from each of the three sites was stained with hematoxylin-eosin and modified Giemsa stains. The remaining antrum and corpus specimens were used for H. pylori cultures (8,10). H. pylori infection was defined as a positive result of histology or culture. None of the 524 subjects was long-term aspirin or NSAID users. As well, none of the 524 enrolled patients had previous history of receiving anti-H. pylori therapy. Subjects should refrain from taking aspirin and NSAID medications at least 2 wk before gastroscopy. Subjects who were identified with malignant gastric ulcer or other gastric malignancy were excluded. The blood sample of each patient was also checked for the TNF-alpha promoter SNP over the locus on -1031 (T/C), -863 (C/A), -857 (C/T), -806 (C/T), and -308 (G/A) by sequence-specific oligonucleotide probe (SSOP). For some selected patients with different genotypes of the TNF-alpha promoter, the antral and corpus specimens were immunohistochemically graded for TNF-alpha expression.

Genotyping of TNF-alpha Promoter SNP by SSOP

The DNA was extracted from the peripheral blood mononuclear cell (27). Some modifications were made, including the isolated nuclei digested with proteinase K, and extracted with a commercial blood and tissue genomic DNA extraction miniprep system according to the manufacturer's directions (Viogene, Taiwan). The SNPs at nucleotide loci on -1031 (T/C), -863 (C/A), -857 (C/T), -806 (C/T), and -308 (G/A) were determined by SSOP, modified from the procedures described previously (23). A 1279-bp DNA fragment for the 5'-flanking region of the TNF-alpha gene at positions -1094 to -185 was amplified by PCR, using a sense primer (5'-1094GATGGACTCACCAGGTGAG-1076) and antisense primer (5'185CTCATGGTGTCCTTTCCAGG166). One volume of PCR product was denatured at 25°C by adding five volumes of 0.4 N NaOH, 25 mM EDTA for 10 min. Subsequently, 50 mul of PCR product was spotted on a positively charged nylon membrane, Hybond-N+ (Amersham Pharmacia Biotech, Buckinghamshire, England) using a 96-well blotter (SRC 96D Minifold I; Schleicher & Schull, Dassel, Germany). The DNA was fixed to the membrane by UV-cross linking using a UV Stratalinker 1800 (Stratagene CA, USA). Each membrane was incubated for 30 min with 10 ml of blocking solution A (4times SSPE, 0.1% lauroylsarcosine, and 1% blocking solution) (GmbH Roche Molecular Biochemicals, Mannheim, Germany) before prehybridization in 10 ml of DIG EASY HYB solution (GmbH Roche) for 1 h at 42°C. Each membrane was hybridized for 2 h at 42°C in DIG EASY HYB solution containing 2 pmol/ml of DIG-labeled SSO probes (Table 1) and a predetermined concentration of competitor. After hybridization, the membrane was washed twice in 2times SSPE-0.1% SDS at room temperature for 5 min and then washed in 10 ml washing solution (50 mM Tris-HCl, pH 8.0, 0.1% SDS, 2 mM EDTA, 3 M TMACl, and 5times Denhardt's solution) at 46°C for 15 min. The subsequent immunological and enzymatic detection was the same as previously described (28). The genotypes of promoter polymorphism in each site were confirmed by direct sequencing of PCR products from 37 randomly selected patients using the ABI Prism 377 automated DNA sequencer (PE Applied Biosystems, Foster City, CA).


Analysis of H. pylori-Related Histology

The same pathologist, blinded to the endoscopic findings and host genotypes of TNF-alpha promoter SNP, examined the gastric histology. The following features were scored using the updated Sydney System: acute inflammation (range, 0–3), chronic inflammation (range, 0–3), atrophic change (absence: 0; presence: 1), and intestinal metaplasia (IM; absence: 0, presence: 1) (29). The total acute (AIS) and chronic (CIS) inflammation scores were a sum of the scores from the antrum and corpus (range: 0–6). Based on histology AIS, the patients were divided into either a dense (AIS greater than or equal to 4) or loose (AIS < 4) neutrophil infiltration group (AIG). Also, by selecting a cut-off of 6 for CIS, patients were defined into a mild (CIS < 4) or severe (CIS greater than or equal to 4) chronic inflammation group (CIG). Antral atrophy (AT) was defined as the presence of atrophy only in the antrum (score 1 in the antrum, but 0 in the corpus and cardia).

Immunohistochemistry for the Gastric Expression of TNF-alpha

Tissue immunohistochemical staining was performed using monoclonal antibodies of human TNF-alpha (mouse IgG1kappa; BMS154; Bender MedSystem Diagnostics, Vienna, Austria) and an HRP polymer detection method (PicTure-Plus Kit (Mouse-DAB); Zymed Laboratories, Inc., South San Francisco, CA). Formalin-fixed paraffin-embedded tissues were deparaffinized and immersed in 3% peroxide in methanol to stop the endogenous peroxidase activity. Nonspecific binding sites were saturated with 0.3% bovine serum albumin. Tissue sections were treated with primary antibody against TNF-alpha at a dilution of 1:40 at room temperature for 1 h. HRP/Fab polymer conjugate (PicTure-Plus Kit (Mouse-DAB); Zymed Laboratories) was adapted for staining by the manufacturer's instructions. 3-Amino-9-ethylcarbazole was selected as the chromogen. Sections were counterstained with hematoxylin. Non-immune mouse IgG was substituted for the primary antibody to serve as a negative control. The TNF-alpha+ cells were calculated by direct counting under a 40times objective lens for the 1 mM scheduled mucosal area. Epithelial cells and mononuclear cells of the lamina propria were counted and recorded separately. The TNF-alpha+ grades were as follows: grade 0, less than or equal to30 cells; grade 1, 31–100 cells, grade 2, 101–300 cells; grade 3, 301–500 cells; and grade 4, >500 cells with positive staining. The other investigator, blinded to the host genotypes of TNF-alpha promoter, graded the TNF-alpha expression in gastric tissue.

Statistics

Hardy-Weinberg equilibrium was tested among the non-H. pylori-infected controls and among the group of H. pylori-infected subjects without peptic ulcer to confirm the control as suitable. The Student's t-test and a one-way analysis of variance (ANOVA) model with Bonferroni corrections were applied for parametric differences as appropriate. Pearson's chi2 test was used for nonparametric differences. The difference of the TNF-alpha genotypes among patients with duodenal ulcer, gastric ulcer, and non-ulcer controls was also assessed by Pearson's chi2 test (Table 3). Fisher's exact test was used to verify whether different TNF-alpha genotypes have different histological parameters (Table 3) and whether different TNF-alpha genotype combinations varied in the peptic ulcer rates (Table 7). The odds ratio (OR) and 95% confidence interval (95% CI) were calculated. The multiple stepwise logistic regressions were applied to determine the independent risk factor related with the presence of gastroduodenal ulcers with enrolling age and sex as adjustment to prevent confounding bias. All tests were 2-tailed with statistical significance setting at the level of p < 0.05.



Top

RESULTS

H. pylori Infection among Different Genotypes of TNF-alpha Promoter SNP

A total of 524 dyspeptic patients, 424 with and 100 without H. pylori infections, were analyzed. There were no differences in the age, sex, or genotype frequency distribution of TNF-alpha promoter SNP between patients with and without H. pylori infection (Table 2). The rate of the benign gastroduodenal ulcers was significantly higher in the patients with H. pylori-infection than in the patients without H. pylori-infection (p < 0.0001).


Specific H. pylori-related Histology Associated with TNF-alpha Promoter SNP

In Table 3, the correlation between TNF-alpha promoter SNP and specific H. pylori-related histological pattern was listed for those 264 patients without peptic ulceration. No loci of TNF-alpha promoter SNP were related to the CIG, AT, or IM in H. pylori-infected patients (Table 3). Two loci (-1031 and -863) of TNF-alpha promoter SNP were correlated with a high rate of dense neutrophil infiltration (dense AIG). Patients who were C carriers of the -1031 locus had a significantly higher rate of dense AIG than those with the -1031 TT genotype (p < 0.05, OR: 2.05; 95% CI: 1.05–4.01). In addition, patients who were A carrier at the -863 locus had a higher rate of dense AIG than those homozygous for the -863C allele (p < 0.05, OR: 2.25; 95% CI: 1.18–4.27).

TNF-alpha Promoter SNP and Peptic Ulcer Risk

In this study, there were 90 H. pylori-infected patients with duodenal ulcers and 70 with gastric ulcer. Excluding those patients whose DNA could not be determined, the distribution of genotypes at the -308, -806, and -857 loci of TNF-alpha promoter were similar among the H. pylori-infected patients with duodenal ulcer, gastric ulcer, and the non-ulcer gastritis control (Table 4). In contrast, also in Table 4, there were significant higher genotype frequencies of -863A carrier and -1031C carrier in the patients with either duodenal ulcer or gastric ulcer than in the non-ulcer patients (p < 0.001). Moreover, the patients with gastric ulcer had a higher genotype frequency of -863A carrier than the patients with duodenal ulcer (60%vs 43.3%, p < 0.05).


Based on the difference in the -863 genotype of TNF-alpha, the difference of demographic and histological features of gastric ulcer and duodenal ulcer was compared in Table 5. For both duodenal and gastric ulcer patients, the -863 A carrier had a higher rate of dense AIG (p < 0.05) than those of patients with genotype as -863CC. Moreover, the -863 A allele had a linkage disequilibrium with -1031 C allele (p < 0.001). Also in Table 5, the gastric ulcer patients with -863CC genotype had a higher rate of AT (p < 0.05) and IM (p < 0.005) than the -863A carriers. Moreover, such gastric ulcer patients with -863CC genotype had fewer dense AIG, but had a higher rate of AT and IM than that of the duodenal ulcer patients with both -863CC and -863A carrier (p < 0.05).


As gastric ulcer with IM carries a higher risk of gastric malignancy than those without IM, we divided the patients with gastric ulcer into either with or without IM. In Table 6, the multivariate logistic regression verified both -1031C and -863A carriers were two independent risk factors to have duodenal ulcers and gastric ulcer without IM in the H. pylori-infected hosts (p < 0.05). In contrast, the independent risk factor to have gastric ulcer with IM was only -1031C carrier, different from that of getting duodenal ulcer and gastric ulcer without IM.


There is genetic linkage between -863A and -1031C allele of TNF-alpha among the H. pylori-infected patients (chi2= 147.4, pless than or equal to 0.0001) and non-infected patients (chi2= 46.3, pless than or equal to 0.0001). In Table 7, the risk of getting duodenal ulcer and/or gastric ulcer without IM were listed for the different genotype combinations of -863 and -1031 loci of TNF-alpha promoter. As compared to individuals with -863CC and -1031TT, the ulcer risk was elevated to 2.46 (95% CI: 1.32–4.59, p < 0.00001) for the individuals carrying either -1031C or -863A allele. For those harboring both -863A and -1031C alleles, the odd ratio was further increased to 6.06 (95% CI: 3.57–10.21, p < 0.00001).

Gastric TNF-alpha Level by Different TNF-alpha Promoter SNP on -1031 and -863 Loci

The gastric biopsy of 90 H. pylori-infected patients included 30 non-ulcer patients with -1031TT and -863CC, 20 non-ulcer patients with either -1031C or -863A carrier, 20 non-ulcer patients with both -1031C and -863A carriers, and 20 duodenal ulcer patients with both -1031C and -863A carriers. The mean grades of TNF-alpha over the epithelium and the lamina propria of the corpus were significantly higher in the 90 selected H. pylori-infected patients than in the 10 H. pylori-negative non-ulcer controls (p < 0.001) (Fig. 1).

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

The mean grades of -alpha of the 90 selected H. pylori-infected (70 without and 20 with ulcer) and the 10 H. pylori-negative non-ulcer controls are shown over the antrum (white column) and the corpus (black column) in A (for epithelium) and B (for lamina propria). For *over-the-corpus epithelium, **over-the-antrum lamina propria, and ***over-the-corpus lamina propria, there was a lower grade of TNF-alpha in the 20 H. pylori-negative controls than in the H. pylori-positive patients (p < 0.001). a,b,c indicate an upward trend of TNF-alpha grade over-the-corpus epithelium in the non-ulcer H. pylori-infected patients whose genotype ranking was -1031TT and -863CC, -1031C or -863A carrier, -1031C and -863A carrier (p < 0.05, one-way ANOVA). d indicates that among H. pylori-infected patients with -863 A and -1031 C alleles, those currently with ulcer had a higher TNF-alpha grade on the corpus epithelium than did those without ulcer (p < 0.05).

Full figure and legend (31K)

In H. pylori-infected non-ulcer patients, the grade of TNF-alpha on the corpus epithelium was lower in those homozygotes with both -863C and -1031T alleles than in those who were carriers of either -863A or -1031C (p < 0.05, one-way ANOVA model) (Fig. 1A). There was an upward trend of TNF-alpha grade over-the-corpus epithelium in the non-ulcer H. pylori-infected patients whose genotype ranking was -1031TT and -863CC, -1031C or -863A carrier, -1031C and -863A carrier (p < 0.05, one-way ANOVA). Furthermore, for H. pylori-infected patients, carriers of both -863A and -1031C who also had ulcers had an even higher TNF-alpha grade on the corpus epithelium than those without ulcers (2.69 vs 1.75, p < 0.05). In contrast, the TNF-alpha grade of the lamina propria over the antrum or corpus was similar in all patients irrespective of their genotypes (p > 0.05) (Fig. 1B).

Top

DISCUSSION

This study disclosed that, in addition to the -308 loci, the other loci of the TNF-alpha promoter, including -1031, -863, -857, and -806, were not related to the increase of the prevalence of H. pylori infection. Our data indicated that TNF-alpha promoter polymorphism would not be a key factor in determining the success of H. pylori colonization and persistence. This study, however, also showed that individuals manifesting different gastric histological pictures or immune responses after H. pylori infection are associated not with the widely studied -308 locus but with different genotypes of TNF-alpha promoter at two novel loci, -1031 and -863. Dense infiltration of PMN was the only histological feature significantly related to the genotypes of TNF-alpha promoter over -1031 and -863 loci. The dense PMN infiltration disclosed in the patients with -1031C and -863A alleles addressed several issues. First, the data illustrated that host factors such as TNF-alpha played a significant role in dictating the extent of gastric PMN infiltration after H. pylori infection. Second, different genotypes classified by these two loci of TNF-alpha promoter SNP may induce different levels of gastric immune responses after H. pylori infection. Last, it once again indicated that host genetic composition might determine the gastric pathological outcome in H. pylori infection (20,21,22).

Both the -863A and the -863C alleles can bind NF-kappaB (p65-p50). The -863C allele, however, has a higher affinity for p50-p50, which inhibits transcription activation of p65-p50 and subsequently express less TNF-alpha than the -863A allele upon LPS induction (30). These facts may help account for the observations that -863A carriers expressed high TNF-alpha in gastric tissue and had dense PMN infiltration, and thus had nearly a 4-fold increase of ulcer risk after H. pylori infection. Nevertheless, up to now, there was no available molecular genetic mechanism to explain why an individual with the -1031C allele may have more tissue TNF-alpha than an individual homozygous for the -1031T allele. Further study is thus anticipated to test whether the presence of H. pylori may enhance nuclear protein binding to -1031C allele and thus leads to higher TNF-alpha expression over the gastric epithelium.

H. pylori infection increased TNF-alpha expression over the epithelium of the antrum and over the lamina propria of both the antrum and the corpus (Fig. 1). In addition, for those with H. pylori infection but without ulceration, significantly higher TNF-alpha levels over the epithelium of corpus was observed in -863A or -1031C carriers, or both, than in those with both 863CC and 1031TT genotypes. Because TNF-alpha is a strong chemoattractant for PMN and monocytes, such high gastric levels of TNF-alpha expression after H. pylori infection in patients different at the -863 and -1031 loci were consistent with the observation that dense infiltration of PMN was more readily detected in -863A and/or -1031C carriers.

In non-ulcer H. pylori-infected patients, TNF-alpha expression over the epithelium of the corpus was further increased in those harboring both the -863A and -1031C alleles than in those carrying either the -863A or the -1031C allele alone. In addition, multivariate regression analysis confirmed that -1031 and -863 polymorphisms are two independent risk factors to get peptic ulceration in the H. pylori-infected host. In Table 7, the genotype combination analysis confirmed that the ulcer risk is getting higher to 2.46 for the carrier of either -1031C or -863A, and for individuals with both -863A the -1031C allele, the risk was even increased to 6.06 (p < 0.00001). Although there is genetic linkage between -863A and -1031C alleles, our data support there could be synergistic effect to enhance the gastric tissue level of TNF-alpha (Fig. 1) and thus to carry a higher risk of peptic ulceration after H. pylori infection.

It is interesting to disclose the -863 genotypes as A carrier of TNF-alpha promoter was significantly higher in the patients with gastric ulcer than in patients with duodenal ulcer (60%vs 43.3%, p < 0.05) (Table 4). As gastric ulcer is disclosed with an increased risk as compared to duodenal ulcer to get carcinogenesis, it is thus important to test whether there were any specific features between gastric ulcer patients with -863CC genotype and -863A carrier. As shown in Table 5, the gastric ulcer patients with -863CC genotype had fewer dense AIG, but had a higher rate of AT and IM than that of -863A carrier (pless than or equal to 0.05). We agree it is particularly impressed by the fact that there are differences between gastric ulcer with the -863CC genotype and gastric ulcer with the -863CA or -863AA genotypes. These data strongly suggest that gastric ulcer patients may include two entities: The first one expressed as -863CC and had a higher rate of IM, which may predispose to a higher risk of carcinogenesis. The second one expressed as -863A carrier and has similar features to the duodenal ulcer patients, which may thus carry less risk of gastric cancer. In Table 6, the independent risk factor of gastric ulcer with IM is only -1031C carrier of TNF-alpha promoter SNP, crucially different to both -863A and -1031C carriers for gastric ulcer without IM or duodenal ulcer. Such a genomic evidence further supports that there should be different pathophysiology between gastric ulcer with and without IM. Moreover, it may imply the genomic analysis to host -863 loci will be promising to clarify the risk of gastric carcinogenesis among patients with gastric ulcers.

In contrast to PMN infiltration, the other histological features, such as chronic inflammation, atrophy, and intestinal metaplasia were not different between patients with different genotypes of any loci of TNF-alpha promoters (Table 3). This data could indirectly support to Machado et al., disclosing patients infected by cagA (+) strains had an increased risk of getting gastric atrophy and cancers than those infected with cagA (-) strains, despite their TNF-alpha-308 polymorphism to be either A allele carriers or GG genotype (21). As our study was conducted in Taiwan, where nearly 100% of H. pylori infections are cagA (+) (8,9,10), it was thus reasonable to see genotyping of the -308 locus only is inadequate for predicting the risk of such precancerous lesions after H. pylori infection. In this study, we also disclosed similar -308 distributions between patients with and without ulcer, which was quite different from the previous studies (31,32). We supposed the nearly 100%cagA-positive infection in Taiwan would be also accounted for the difference of such finding between oriental and western countries.

This study denoted that TNF-alpha promoter SNP as -1031C and -863A carriers had a higher risk of benign peptic ulceration after H. pylori infection. Nevertheless, as shown in Table 3, there remained many patients with peptic ulcer without expressing as either -1031C or -863A carriers. That is to say, for certain patients, none of these polymorphisms is of functional significance and the true culprit for the peptic ulcer association is an as yet unidentified variant in linkage disequilibrium with these promoter polymorphisms.

In summary, TNF-alpha promoter SNP on the -1031 and -863 loci should be novel host factors related with the severity of gastric inflammation, TNF-alpha expression, and the peptic ulcer risk after H. pylori infection. Applying such host factors to select a subset of non-ulcer dyspeptic patients for anti-H. pylori therapy would be promising to control the development of peptic ulcers in health care and clinical practice.

Top

References

  1. Bravo, LE, van Doom, LJ, Realpe, JL, et al. Virulence-associated genotypes of Helicobacter pylori: Do they explain the African enigma? Am J Gastroenterol 2002;97: 2839–2842.
  2. Suerbaum, S, Michetti, P. Helicobacter pylori infection. N Engl J Med 2002;347: 1175–1186. | Article | PubMed | ISI | ChemPort |
  3. Peterson, WL. Helicobacter pylori and peptic ulcer disease. N Engl J Med 1991;324: 1043–1048. | PubMed | ISI | ChemPort |
  4. Graham, DY. Treatment of peptic ulcers caused by Helicobacter pylori. N Engl J Med 1993;328: 349–350.
  5. Ilver, D, Arnqvist, A, Ogren, J, et al. Helicobacter pylori adhesin binding fucosylated histo-blood group antigens revealed by retagging. Science 1998;279: 373–377. | Article | PubMed | ISI | ChemPort |
  6. Zambon, CF, Navaglia, F, Basso, D, et al. Helicobacter pylori babA2, cagA, and s1 vacA genes work synergistically in causing intestinal metaplasia. J Clin Pathol 2003;56: 287–291. | Article | PubMed | ISI |
  7. Gerhard, M, Lehn, N, Neumayer, N, et al. Clinical relevance of the Helicobacter pylori gene for blood-group antigen-binding adhesin. Proc Natl Acad Sci USA 1999;96: 12778–12783. | Article | PubMed | ChemPort |
  8. Sheu, BS, Sheu, SM, Yang, HB, et al. Host gastric Lewis expression determines the bacterial density of Helicobacter pylori in babA2 genopositive infection. Gut 2003;52: 927–932.
  9. Wang, HJ, Kuo, CH, Yeh, AA, et al. Vacuolating toxin production in clinical isolates of Helicobacter pylori with different vacA genotypes. J Infect Dis 1998;178: 207–212.
  10. Sheu, SM, Sheu, BS, Yang, HB, et al. The presence of iceA1 but not cagA, cagC, cagE, cagF, cagN, cagT, or orf13 genes of Helicobacter pylori is associated with a more severe gastric inflammation in Taiwanese. J Formos Med Assoc 2002;101: 18–23.
  11. Maeda, S, Ogura, K, Yoshida, H, et al. Major virulence factors, VacA and CagA, are commonly positive in Helicobacter pylori isolates in Japan. Gut 1998;42: 338–343.
  12. Mizushima, T, Sugiyama, T, Komatsu, Y, et al. Clinical relevance of the babA2 genotype of Helicobacter pylori in Japanese clinical isolates. J Clin Microbiol 2001;39: 2463–2465.
  13. Crabtree, JE, Shallcross, TM, Heatley, RV, et al. Mucosal tumor necrosis factor alpha and interleukin-6 in patients with Helicobacter pylori associated gastritis. Gut 1991;32: 1473–1477. | PubMed | ISI | ChemPort |
  14. Noach, LA, Bosma, NB, Jansen, J, et al. Mucosal tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-8 production in patients with Helicobacter pylori infection. Scand J Gastroenterol 1994;29: 425–429. | PubMed | ISI | ChemPort |
  15. Strieter, RM, Kunkel, SL, Bone, RC. Role of tumor necrosis factor-alpha in disease states and inflammation. Crit Care Med 1993;21(suppl 10):S447–S463. | Article | PubMed | ISI | ChemPort |
  16. Han, J, Brown, T, Beutler, B. Endotoxin-responsive sequences control cachectin/tumour necrosis factor biosynthesis at the translational level. J Exp Med 1990;171: 465–475. J Exp Med (erratum) 1990;171: 971–972. | Article | PubMed | ISI | ChemPort |
  17. Sariban, E, Imamura, K, Luebbers, R, et al. Transcriptional and posttranscriptional regulation of tumor necrosis factor gene expression in human monocytes. J Clin Invest 1988;81: 1506–1510. | PubMed | ChemPort |
  18. Raabe, T, Bukrinsky, M, Currie, RA. Relative contribution of transcription and translation to the induction of tumor necrosis factor-alpha by lipopolysaccharide. J Biol Chem 1998;273: 974–980. | Article | PubMed | ISI | ChemPort |
  19. Wilson, AG, Symons, JA, McDowell, TL, et al. Effects of a polymorphism in the human tumor necrosis factor alpha promoter on transcriptional activation. Proc Natl Acad Sci USA 1997;94: 3195–3199. | Article | PubMed | ChemPort |
  20. Yea, SS, Yang, YI, Jang, WH, et al. Association between TNF-alpha promoter polymorphism and Helicobacter pylori cagA subtype infection. J Clin Pathol 2001;54: 703–706. | PubMed |
  21. Machado, JC, Figueiredo, C, Canedo, P, et al. A proinflammatory genetic profile increases the risk for chronic atrophic gastritis and gastric carcinoma. Gastroenterology 2003;125: 364–371. | Article | PubMed | ChemPort |
  22. El-Omar, EM, Rabkin, CS, Gammon, MD, et al. Increased risk of noncardia gastric cancer associated with proinflammatory cytokine gene polymorphisms. Gastroenterology 2003;124: 1193–1201. | Article | PubMed | ISI | ChemPort |
  23. Higuchi, T, Seki, N, Kamizono, S, et al. Polymorphism of the 5'-flanking region of the human tumor necrosis factor (TNF)-alpha gene in Japanese. Tissue Antigens 1998;51: 605–612. | PubMed | ISI | ChemPort |
  24. Eskdale, J, Gallagher, G, Verweij, CL, et al. Interleukin 10 secretion in relation to human IL-10 locus haplotypes. Proc Natl Acad Sci USA 1998;95: 9465–9470. | Article | PubMed | ChemPort |
  25. Lanas, A, Garcia-Gonzalez, MA, Santolaria, S, et al. TNF and LTA gene polymorphisms reveal different risk in gastric and duodenal ulcer patients. Genes Immun 2001;2: 415–421. | Article | PubMed | ChemPort |
  26. Yang, HB, Sheu, BS, Su, IJ, et al. Clinical application of gastric histology to monitor treatment of dual therapy in H. pylori eradication. Dig Dis Sci 1997;42: 1835–1840.
  27. Lu, CC, Chen, JC, Jin, YT, et al. Genetic susceptibility to nasopharyngeal carcinoma within the HLA-A locus in Taiwanese. Int J Cancer 2003;103: 745–751. | Article | PubMed | ChemPort |
  28. Chen, DF, Endres, W, Meyer, SA, et al. A polymerase chain reaction-sequence-specific oligonucleotide procedure for HLA class II typing using biotin- and digoxigenin-labeled probes simultaneously in hybridization. Hum Immunol 1994;39: 25–30.
  29. Dixon, MF, Genta, RM, Yardley, JH, et al. Classification and grading of gastritis. The updated Sydney system. International Workshop on the Histology of Gastritis, Houston 1994. Am J Surg Pathol 1996;20: 1161–1181. | Article | PubMed | ISI | ChemPort |
  30. Udalova, IA, Richardson, A, Denys, A, et al. Functional consequences of a polymorphism affecting NF-kappa B p50–p50 binding to the TNF promoter region. Mol Cell Biol 2000;20: 9113–9119. | Article | PubMed | ChemPort |
  31. Kunstmann, E, Epplen, C, Elitok, E, et al. Helicobacter pylori infection and polymorphisms in the tumor necrosis factor region. Electrophoresis 1999;20: 1756–1751. | PubMed |
  32. Lanas, A, Garcia-Gonzalez, MA, Santolaria, S, et al. TNF and LTA gene polymorphisms reveal different risk in gastric and duodenal ulcer patients. Genes Immun 2001;2: 415–421. | Article | PubMed | ChemPort |
Top

Acknowledgements

This study was supported by grants NSC-91-2314-B-006-001 and NSC-92-2314-B-006-043 from the National Science Council, Taiwan.

Extra navigation

.

gastrojobs

More gastro jobs
ADVERTISEMENT